Embryogenesis 동안 중복 기능을 테스트하기 위해 역방향 유전자 접근

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

다른 유전자에 의해 보상이있다면 유전자 기능이 손실의 기능 실험에 드러나지 수 있습니다. zebrafish 모델은 생활 배아에서 이러한 기능 중복을 나타내기 위해 상대적으로 높은 처리량 방법을 제공합니다.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Rikin, A., Rosenfeld, G. E., McCartin, K., Evans, T. A Reverse Genetic Approach to Test Functional Redundancy During Embryogenesis. J. Vis. Exp. (42), e2020, doi:10.3791/2020 (2010).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

embryogenesis 동안 유전자 기능은 일반적으로 마우스를 대상으로 돌연변이 유발 (녹아웃)에 의해 예를 들어, 손실의 기능을 실험에 의해 정의됩니다. zebrafish 모델에서 효과적인 반대로 유전자 기술은 유전자 특정 안티 센스 morpholinos의 microinjection을 사용하여 개발되었습니다. Morpholinos은 embryogenesis (최저)에 며칠 동안 억제 번역 또는 splicing에 의해 transiently 특정 기본 - 페어링 및 차단 유전자 기능을 통해 mRNA를 타겟팅할 수 있습니다. 그러나, 마우스 또는 zebrafish과 같은 척추 동물에서 일부 유전자의 기능이 손실에 대한 보상 다른 유전자의 존재로 인해 이러한 방식으로 드러나지 수 있습니다. 이 같은 개발 조직의 공동 표현 자매 유전자를 포함한 유전자 가족에 특히 사실이다. zebrafish에서 기능성 보상은 morpholinos의 공동 주입하여 상대적으로 높은 처리량 방식으로 테스트할 수있는 동시에 유전자의 대상 최저. 마찬가지로, morpholinos를 사용하여 임의의 두 유전자 사이에 유전자 상호 작용이 하위 임계값 수준에서 함께 두 유전자의 분해에 의해 입증하실 수 있습니다. 예를 들어, morpholinos는 어느 개인의 분해가 표현형을 생성 이러한 titrated 수 있습니다. 이러한 조건에서 두 morpholinos의 공동 주사가 표현형 원인 경우, 유전자 상호 작용이 나타납니다. 여기 두 관련 가타의 전사 요소의 컨텍스트에서 기능 중복을 표시하는 방법을 보여줍니다. 가타 요인은 심장 progenitors의 사양에 필수적인,하지만 이것은 Gata5와 Gata6 모두의 손실에 의해 드러났습니다. 우리는 microinjection 실험을 수행 morpholinos를 확인하고, cardiogenesis에 대한 보상 표현형을 평가하는 방법을 보여줍니다.

Protocol

여기서 우리의 목표는 cardiomyocyte progenitors의 사양 두 가지 전사 인자의 기능 중복을 테스트하는 것입니다. 요소는 두 관련 유전자 gata5gata6로 인코딩하고 우리는 그들의 상대적인 기능 하나를 이해하기 위해 zebrafish 모델을 사용하고 있습니다. 우리의 전략은 morpholinos 2를 사용 유전자 기능을 차단하는 것입니다. 우리는 하나 또는 수정된 달걀에 다른 유전자에 대한 morpholinos를 삽입하고, 두 morpholinos와 동시에 주입 계란에서 파생 배아로 배아 표현형을 비교합니다. phenotypes의 평가를 단순화하기 위해, 우리는 cardiomyocytes에서 GFP를 표현 transgene 들고 생선에서 나온 계란을 사용합니다.

1 단계. microinjection 준비.

물고기의) 설정 번식 쌍

사전 주사에 저녁은 하나의 남성과 여성의 단일 성인 물고기 (세 3~18개월)은 다음 날 아침까지 구분선으로 구분 개종 탱크에 쌍에 배치됩니다. 우리는 일반적으로 물고기의 10~20쌍을 설정하고, 이러한 생산력을 유지하기 위해 관계없이 계란을 사용 여부의 주일에 한 번씩 성관계를하고 있습니다. 그것이 차별화 cardiomyocytes를 식별하는 간단한 기록을 제공하기 때문에, egfp :이 실험을 위해 우리는 cmlc2 위해 유전자 변형을 기자의 긴장을 사용하고 있습니다. 다음날 아침은 일단 조명은, 물을 변경 켜져 있으며, 디바이더는 물고기 쌍은 달걀을 친구와 생산 수 탱크에서 가져온 있습니다. 계란 생산 모니터링 할 수 있으며, 즉시 시작되거나 시간 이상의 기간이 지난 후, 물고기에 따라 다릅니다. 일반적으로 중단 짝짓기의 약 20 분 후, 계란은 피펫 또는 스트레이너를 사용하여 수집하고 시스템 물을 포함 100mm 배양 접시에 부어. 배아는 세포 1-4 단계 사이에 주입하는 보장하기 위해 계란 생산을 모니터하는 것이 중요합니다. 한 번에 여러 쌍을 발표함으로써, 계란 생산 비틀함으로써 초기 발달 단계에서 주입 수있는 계란의 양을 극대화할 수 있습니다. 물고기의 좋은 쌍이 200 개 이상의 배아를 생성할 수 있으며, 그들은 4 세포 단계 이후 개발되기 전에 한 조사 신속하게 충분한 그들을 주입 수 없을 것입니다 때문에 그것은 동시에 알을 수천를 수집하는 어떤 실질적인 의미도하지 않습니다 . 물고기가 빛을주기에 번식을 자극하므로이 일찍 시작되어 있어야하고, 계란은 보통 정오 이후에 취득하지 경험할 수 있습니다.

B) 바늘 준비

  1. 다음 조건 사용하여 두 바늘 생성 Micropipette의 풀러와 3.5 "유리 모세관을 사용하여 열을 = 626은 = 60 속도 = 60, 및 시간 = 250 세워 우리는 필라멘트가 포함되지 않은 열 핵심 바늘을 사용하기 때문에. 우리는 흡입 그들을 전면 입력합니다.
  2. 각 바늘의 끝 부분이 부드럽게 깨끗한 면도날이나 집게를 사용하여 깨진하고, 이후 EG - 4 마이크로 그라인더를 사용하여 약 20 초 동안 30도 각도에서 beveled입니다. 이 팁은 선명하고 chorion을 통해 주사하는 경우 중요합니다.
  3. 약 15 미크론의 일관성 바늘 직경 팁 크기 (1-2 NL 사출 볼륨을 조정할 수 있도록 gridded 현미경의 접안 렌즈를 사용하여 4 단위로 보정)을 구하는 것이 중요합니다.
  4. 바늘은 사전에 준비를 안전한 장소에 안전하게 저장하고, 각각 개별적으로 (자세한 내용은 섹션 D 참조) 일관성 사출 량을 보장하기 위해 주사를 시작하기 직전 교정해야합니다. 당신이 운이있다면, 당신은 전체 실험에​​ 대해 하나의 바늘을 사용할 수 있습니다. 그러나, 바늘 쉽게 실험의 중간에 휴식 수 있으며, 새로운 바늘을 잡아 시간을 사용 싶지 않아요.

C) 사출 접시 만들기

  1. 전자 레인지에서 끓고에 의해, 시스템 물에 2 % 아가로 오스 솔루션 100 ML를 준비합니다.
  2. 시원한, 그리고 100mm 페트리 접시의 뚜껑에 거꾸로 12ml에 대한 잔.
  3. 뚜껑의 양쪽에 약 45도 각도에서 한쪽으로 치우 쳤던이 현미경 슬라이드를 삽입합니다. 아가로 오스가 확정되면, 부드럽게 뚜껑 떨어져 두 슬라이드를 당겨.
  4. 이것은 태아가 위치하고 이후 주입됩니다 골짜기를 만듭니다. 여러 접시는 미리 준비하실 수 있습니다. 그들은 원래 접시의 바닥을 추가하고, parafilm와 실링, 70 % 에탄올의 레이어를 추가한 후 4 ° C에서 무한정 저장할 수 있습니다. 사용하기 전에 잘 씻어 것을 잊지 마십시오.

D) Microinjection 역 및 바늘 보정

  1. 압축 질소 소스와 PLI - 100 microinjector 켭니다. 인젝터는 18 PSI의 지속적인 흐름의 압력 조정해야합니다.
  2. 바늘을 삽입하기 전에 micromanipulator은 운동의 다양한 수 있도록 적절한 위치에 있다고 확신하고, 삽입된 바늘은 테이블을 공격하지 않을. 중 하나를 삽입바늘이 단단히 봉인가 있는지 확인하고 micromanipulator에 (섹션 C 참조) 이전에 준비. 바늘을 깰하지 않도록주의하십시오.
  3. 그것이 교정을하기 전에 막힌 있지 않은지 확인하기 위해 현미경으로 바늘 끝을 관찰.
  4. parafilm의 작은 조각에 주입 용액 또는 ddH 2 O의 드롭 (2-3 μl)을 놓고 채우기 버튼을 사용하여 바늘에 그것을 당기는하여 150 μl를 입력합니다. 당신이 완전히 솔루션에 바늘 팁 있고, 모든 공기 방울의 그림을 피하기 위해 현미경을 통해 액체 흡입을 준수하는지 확인합니다.
  5. 마이크로 미터의 그리드에 미네랄 오일 한 방울을 넣으십시오.
  6. 분사의 시간이 드롭 크기는 직경 약 1.5 미크론 있는지 확인하기 위해 경험적으로 조정합니다. 이것은 ~ 1.8 NL의 주사 량을 제공합니다. 실제 볼륨이 선택하도록 조정하지만, 실용적인 관점에서 그것은 정확하게 한 NL 아래의 볼륨을 교정하기 어려운, 그리고 수정란은 2 NL 이상의 볼륨을 용납하지 않을 수 있습니다 수 있습니다. 상관없이 볼륨 크기의 당신이 컨트롤을 포함한 모든 주사에 대해 동일하게 선택하고, 주입 morpholino의 양을 적정하다 귀하의 솔루션 농도를 (오히려 사출 볼륨 이상) 조정합니다.
  7. 바늘 끝 크기가 달라집니다 이후 Recalibration는 바늘이 교체 때마다 필요합니다.

2 단계. 두 개의 유전자를 대상으로 morpholinos 검증

Morpholinos는 번역 개시 사이트 또는 따라서 단백질 합성 또는 적절한 mRNA 처리를 차단 대상 mRNA의 스플 라이스 사이트를 대상으로 설계되었습니다. 그들은 특정 최저를 나타냅니다 동일한 표현형를 생성하면 처음으로 유전자를 분석하면, 우리는 테스트 morpholinos 두 가지 유형의를 사용합니다. 스플 라이스 - 차단기의 이점은 당신이 대상 유전자에 대한 항체가없는 경우 특히 유용합니다 RT - PCR에 의해 일반 성적표의 분해를 확인할 수있다는 것입니다. gata6 5; : '; 5' - TCTTAAGATTTTTACCTATACTGGA - 3 gata5 스플 사이트 MO 순서'5' - AAGATAAAGCCAGGCTCGAATACAT - 3 : 우리는 일관성있는 심장 표현형가 morpholinos을 (gata5 5'UTR MO 시퀀스를 사용하여 gata5gata6 유전자에 대해 이루어집니다 방법을 보여줍니다 'UTR MO 순서 : 5' - AGCTGTTATCACCCAGGTCCATCCA - 3').

  1. Morpholinos는 진 도구, LLC (필로 매스, OR)에서 얻을 수 있습니다. 진 도구는 자신의 지원 직원에게 물으면, 당신이 대상으로 최상의 순서를 선택하는 데 도움이됩니다. 당신은 그들에게 가입 번호를 보내, 그들이 알려 드릴 것입니다 필요합니다. 당신이 활동의​​ 유효성을 검사 준비를해야 왜 그러나, morpholino이 작동한다는 보장이 없다, 어떤 있습니다. morpholino가 OpenBiosystems에서 사용할 수있는 경우 당신은 또한 확인할 수 있습니다. 진 도구 OpenBiosystems로 합성 morpholinos의 주식을 제공합니다. 그것이 작동 보장 다시가 없지만, 그들은 새로운 목표를 테스트하기 위해 부담 비용을 도움이 될 수있는, 저렴한 비용으로 작은 수량을 판매하고 있습니다. transcriptome로부터 morpholino 재촉해야합니다, 우리는 UCSC 게놈 브라우저 zebrafish (genome.ucsc.edu)에 BLAT 기능을 사용합니다. morpholino가 문학에서 (엄격) 검증되어있다면 물론, 그것은 당신이 동일한 순서를 구입할 것을 권장합니다.
  2. morpholino는 1 mm의 최종 농도로 멸균 ddH 2 0에 용해하고 실온에서 저장됩니다. 저온 가끔 집계 및 침전물에 발생할 수 있습니다 어떤 이유로 morpholino 솔루션을 멈추게하지 마십시오. Morpholinos는 프로 테아제 또는 nucleases로 구별되도록 한 추가할 물이 멸균이므로, 그들은 상온에서 매우 안전합니다.
  3. 주입 전에 65 morpholino을 품어 ° C를 보장 5 분 완전히 해소하고, 실온에 시원한 수에있다. 얼음 샘플을 올려 놓지 마십시오. 사출 때까지 상온에서 morpholino 보관하십시오.
  4. morpholino을 적정하다 위해, 우리는 일반적으로 1 mm의 작업 농도를 얻을 수에 0.5 밀리미터, 0.25 MM, 그리고 0.125mM을 ddH 2 0에서 재고 농도의 시리얼 dilutions을 준비합니다. 사출 량의 1.8 NL를 사용하여 순서에 따라이 약 20ng, 10ng, 5ng 및 사출 당 morpholino의 2.5ng을 나타냅니다. 이것은 각 morpholino의 관용과 효능이 달라질 수 있기 때문에, 단지 출발점이며 예측할 수 없습니다. 대부분의 morpholinos가 많은 20 NG 이상 용납되지 않겠지만 일부는 잘 한 NG 아래의 복용에 효과적일 수 있습니다. 우리의 접근 방식에서 표현형 "대지"는 농도를 정의하는 것입니다. 정의된 표현형가 2.5 NG를 사용하여 볼 수 있지만, 5 NG에 이상 금액을 사용하여 유사한되지 않은 경우 즉, 우리는 임계값 금액으로 5 NG를 선택합니다. 물론, 당신이 "국경의"오히려 지금보다 reproducibly 임계값 이상 작동되는 것을 보장하기 위해, 2.5 및 5.0 NG NG 사이에 다음 적정하다하는 것이 유용 하리라 생각됩니다.
  5. 첨부된와 눈금 바늘을 작성최저 작동 농도 (대부분의 희석) morpholino 솔루션 (위 참조). 그것이 단순히 물질을 낭비하므로 피하, 바늘을 통해 - 필링. 당신은 단 1 μl를 입력하는 경우, 500 주사에 대한 충분한 해결책이 있습니다.
  6. 일회용 피펫을 사용하여 microinjection 판의 골짜기로 한 세포 배아를 수정된 전송합니다. 배아는 사출 골짜기의 바닥에 떨어질 수 있도록 여분의 물을 제거합니다. 그들은 부동 아니라 아가로 오스 침대을 준수해서는 안됩니다.
  7. micromanipulator이 chorion 통하여 주입에 대한 노른자에 바늘 끝을 내려가다 수 있도록 사출 접시를 놓습니다. 개인 배아를 위치로, 사출 바늘 끝이 못살게 굴지 또는 적절한 위치로 배아를 가져옵니다되는 사출 접시 같은 조작. 바늘 팁 또는 손상 배아를 깰하지 않도록주의! 이것은 어떤 연습이 필요하지만, 원칙적으로 당신은 오히려 신속하고 깔끔하게 밖으로 사출 후에 배아에 주입 바늘을 이동하고 단순히 micromanipulator를 사용합니다. 배아는 (당신의 오른손으로 주입하면 손을 왼쪽) 무료 손을 사용하여 번호판을 이동하여 주입 위치로 이동됩니다. 새로운 학습자의 경우, 그것은 주입 솔루션을 시각화하기 위해 0.25 % 페놀 레드가 포함된 솔루션을 사용하여 연습하는 데 유용합니다. 그 솔루션을 확인하는 대신 남북 chorion 공간보다 배아에 주입했다., 자신감도 포함하는 형광 - 태그 microspheres 것은 (F - 8794 분자 프로브) 솔루션을 주사하여 얻은 것입니다 그러나, 연습 몇 라운드 후, 이러한 에이즈는 일반적으로 더 이상 필요하지 않습니다. 그냥 바늘이 끈적 거 리고 주입되고있는 볼륨이 적절 나타나 아니라는 것을 확인하기 위해, 때때로 공중으로 투입하는 것이 좋습니다.
  8. 주입 배아은 시스템 물로 100mm 페트리 접시로 다시 전송하고 28.5C에서 양식입니다. 가장 낮은 작업 농도 주입 후, 남아있는 솔루션은 퇴학 morpholino의 다음 높은 작업 농도는 바늘을 채우는 데 사용할 수 있습니다. morpholino의 각 농도에 대해 반복합니다. 그것은 바늘을 사용 물을 씻어 수 있지만, 뚜렷한 morpholino을 테스트할 때, 우리는 바늘을 변경하고 재조정하는 것을 선호합니다. 배아의 특정 배치가 건강하고 정상적인되었는지 확인 uninjected 배아의 코호트를 유지해야합니다.

3 단계. 개별 임계값 접종에 morpholinos의 공동 주입

위의 수행 적정의 목표는 각 morpholino에 대한 임계값 복용을 정의하는 것이었다. 대상 유전자가 필수적인 기능이있다면 최선의 시나리오에서 morphants의 기본적으로 100 %, 정의된 표현형을 표시합니다. 그러나, 당신은 잘못 분사 유물 몇 가지 변화로 인해 기대할 수 있습니다. 연습이 10 %를 초과해서는 안됩니다. 배아 (uninjected 컨트롤 포함)의 일부 배치는 실험을 할인해야 할 수있는 경우에 잘 생존하지 않을 수 있습니다. 개인 배아 더 많거나 적은 최저로 허용 수 있기 때문에 한편, 생물 다양성도있다. 마지막으로, 일부 morpholinos는 강력한 (탐상) 최저를 달성하기위한 충분 효율되지 않을 수 있습니다. 표현형가 배아의 낮은 비율로 발생하지만, 재현할 수있다면, 그것은 별개의 morpholino를 테스트 가치가있을 수도 있습니다. 이번 실험의 목표는 두 유전자가 동시에 타겟 때 완전히 새로운 표현형 볼 있는지 확인하는 것입니다. 중 개별 유전자의 테스트를 할 때 우리는 단순히 임계값 수준 이상 볼 수없는 독특한 표현형의 생성을 위해 다소 morphant 표현형를 배아의 비율 증가를 찾고 있지만,되지 않습니다.

  1. 정의된 표현형을 생성 각 morpholino의 문턱 농도에서 이전에 테스트 morpholinos의 조합의 혼합물을 준비합니다. 예를 들어, 각각의 유전자에 대한 임계값 5 NG 경우, 각 5 NG + 5 NG (10 NG 합계)가 포함됩니다 작동하는 솔루션을 준비합니다. 배아 20 NG 총 morpholino보다 더 용납되지 않을 수 있기 때문에 효율적으로 각각의 유전자를 대상으로 충분 각각의 최소 금액을 사용하는, 이전 실험을 바탕으로 중요합니다.
  2. 컨트롤이 조합에 사용되는 것과 동일한 농도에서 각각 morpholino 혼자 주사 배아의 집합을 포함해야합니다. 사출 솔루션의 볼륨 (예 : 1.8 NL) 지속적인 보관해야합니다. 기자 스트레인을 사용하는 큰 이점은 당신이 반복 언제든지 표현형 (예 : cardiomyocyte 차별화) 평가하고, 수있다는 것입니다. 배아는 현장 하이브리드화에 의해 유전자 발현에 대해 평가하는 경우, 무대 일치하는 배아과 컨트롤이 여러 번 후 주사로 해결할 수 있습니다. 우리의 실험을 위해, 우리는 약 24 HPF에서 cardiomyocyte 차별 화를위한 대리로 GFP 발현을 평가하는거야.

4 단계. Ephenotypes의 평가

  1. 주입 배아는 그냥 주사 후 모니터링해야하고, 이들은 나머지 morphants의 생존을 위태롭게 수 있기 때문에 하루 동안 여러 번, 어떤 죽거나 죽어가는 태아를 제거합니다. 리포터 유전자의 표현을 평가하려면 배아는 형광 용량 복을 해부 현미경을 사용하여 검사하고 있습니다. 우리는 0.75x에서 11.25x로 1X 또는 1.6X 목적과 배율의 범위, 니콘 SMZ1500 현미경을 사용합니다. 형광 필터를 사용하면, 빛의 강도를 극대화하는 완전히 열려 설정으로 피임기구를 열고해야합니다. 또한 리포터 유전자 (GFP, RFP 등)에 따라 올바른 필터를 사용해야합니다.
  2. 태아는 일반적으로 tricaine의 methanesulfonate의 4mg/ml 주식의 시스템 물이 20분의 1 희석을 사용하여 마취하고 있습니다. 주식은 - 20C에서 냉동 저장됩니다. 또는 배아는 20x tricaine 주식을 사용하여 euthanized 수 있습니다. 그들이 chorion 아직하더라도 태아는 일반적으로 검사를하실 수 있습니다. 그러나, 그들이 촬영됩니다 특히면, 그것은 날카로운 집게를 사용하여 chorions를 제거하는 것이 좋습니다. 배아는 tricaine 솔루션에 우울증 슬라이드에 배치하거나,​​ 더 나은 3 % 메틸 셀룰로오스의 작은 방울로 배치 사진 그들을 고정하는 후 볼 수 있습니다.
  3. 단일 morphants에 비해 morpholinos의 조합으로 주입 사람의 배아 phenotypes을 관찰. 여기서 우리는 원시 심장 관에서 GFP 표현의 패턴을 찾고 있습니다. 이 기자의 변형 GFP에 심장 사양과 심장 튜브 morphogenesis의 상세 분석을 수있는 cmlc2 발기인를 통해 cardiomyocytes에만 표시됩니다.

대표 결과

상당한 생물 학적 다양성 3,4가 있지만, 임계값 수준 주입했을 때 우리의 실험에서, gata5gata6 단일 morphants 모두 재현할 심장 phenotypes을 보여줍니다. 예를 들어, gata5 morphants 대부분의 두 지역에있는 GFP 표현과 이열의 마음을 생성할 수 있습니다. 심장 progenitors 심장 관 형성 중 정중선에서 퓨즈 제대로 마이 그 레이션 실패하기 때문에 이러한 문제가 발생합니다. 그러나, gata5 morphants 중 일부는 결함이 심장 튜브를 생성 할, 그리고 소수 (5 %)에 GFP +는 세포의 양을 크게 감소가 있습니다. 우리는이 생물 학적 다양성을 반영 믿고, 또한 morpholinos가 "NULL"돌연변이에 해당하지 않는 사실 때문일 수 있습니다.

마찬가지로, gata6 morphants은 모든 심장 표현형을 보여주지만, 이열의 소수의 가열을 포함 phenotypes의 범위가있다, 그리고 형태학의 아르 마음은 uninjected 제어 배아에 비해 불안. 심장 형성은 동적 프로세스이며 최소한 심장 표현형 중 일부가 배아 morphogenetic 결함에서 간접적으로 인해 수 있기 때문에이 변화는 심장 morphogenetic의 표현형 드문되지 않습니다. 그러나, 중요한 것은 gata5gata6 모두 morphants에 대한 심장 morphogenetic 결함의 범위는 일관되고 재현성이며 대부분 태아는 실질적인 GFP + cardiomyocytes를 생성합니다.

gata5gata6 단일 morphants에 스탁 대조적으로, 두 가지 요인의 고갈 배아는 cardiomyocytes의 손실과 일치 GFP 표현의 전체 손실을 보여줍니다. 그러므로, gata5gata6 각각 심장 morphogenesis가 아닌 중복 기능을 가지고 있지만, 두 유전자 차별 cardiomyocytes의 생성을위한 요구 사항에 기능 중복됩니다. 우리의 이전 연구는 cardiomyocyte 사양 3 요구 사항을 제안도 nkx2.5을 포함한 최초의 cardiomyocyte 마커의 손실을 보여주었다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

실험이 여기에 설명된에서는, 우리는 두 morpholinos 혼자 phenotypes의 독특한 범위를 생성하는 각각을 결합하고, 그들이 함께 공동으로 주입되었다 완전히 다른 표현형을 발견했습니다. 물론, 우리는 처음부터이 실험을 수행하는 명분이 필요했습니다. 우리는 두 유전자이 경우 심장 사양에, 이전 기능에 대한 서로를 보상 수도 의심. 유전자가 매우 관련이 있습니다 (같은 DNA 시퀀스에 바인딩 수)과 5 embryogenesis 동안 패턴을 중복으로 표현되기 때문입니다. 또한, Drosophila의 유전자 실험은 가타의 전사 요소 심장 사양 6 필요합니다 지적했다.

그러나이 전략은 유전자 상호 작용에 대한 더 일반적으로 기능 중복 또는 테스트에 사용될 수있는 다른 상황이있다. 첫째, 하나 또는 둘 모두 유전자의 분해는 명백한 표현형를 생성하지 않을 수도 있습니다. 이 경우, 각 유전자에 대한 정의 임계값 수준가 없으며, 사용하는 morpholino의 금액들이 배아에서 용납되는 방법을 잘 따라 제한, 경험적으로 정의됩니다. 다시 테스트 보상에 대한 근거 가능성이 유전자가 높은 관련 및 공동 표현 패턴을 확인하는 것을 것입니다. 둘째, 유전자 상호 작용은 하위 임계값 금액 morpholinos의를 사용하는 유전자 쌍에 대한 테스트를하실 수 있습니다. 이 전략에서는 표현형를 생성하지 않는 최대한의 금액은 각 morpholino에 사용됩니다. 두 morpholinos를 결합하는 것은 표현형을 생성하는 경우가 상당히 간접적하거나 심지어 병렬 경로를 나타내는 수 있지만, 이것은 유전자 상호 작용에 대한 강력한 증거를 제공합니다. 두 유전자가 대립하게 (다시 간접 수있는)에 상호 작용하는 경우 두 번째 morpholino의 셋째, 공동 주사는 최초의 표현형를 구출 수 있습니다. 더 정의된 제한 다른​​ 유전자가 타겟이 될 수있는 방법을 많은가 없지만, 실용적인 의미에서 그것은 임계값 응답에 필요한 각 morpholino의 양에 따라, 아마도 3-4 유전자이다.

새로운 유전자 기능을 나타내기 위해 반대로 유전자를 사용하여이 일반적인 접근 방식이 상대적으로 높은 처리량이지만, morpholinos을 재고해주의는 여러 가지가 있습니다. 이것은 이미 성취되지 않은 경우 morpholinos를 결합하기 전에 상당한 노력 개별 시약의 유효성을 검사하기 위해 필요합니다. 다른 생성할 수있을 때 하나라도 morpholino가 작동하지 않을 수 있습니다 떨어져 타겟팅 특히 광범위한 apoptosis의 활성화와 관련 "유물"phenotypes합니다. 시약은 저렴하지 않습니다, 그리고 두 개 이상의 morpholinos 각 유전자를 확인하는 데 필요한 경우,이 투자는 중요할 수 있습니다.

여러 고려 사항이 실험 전략을 안내합니다.

I) 알려진 돌연변이 표현형가 있습니까? 그렇다면, 하나의 pheno - 복사 morpholino이 충분해야합니다.

II) 가능한 항체가 있습니까? 그렇다면, 번역 차단이 선호 될 수도 있고, 그렇지 않으면, 그것은 스플 라이스 - 차단기가 효과적으로 사전 mRNA를 타겟으로 해당 문서 것이 중요합니다.

3) 당신은 mRNA의 주입에 의해 morphant를 구출 수 있습니까? 이 작동한다면, 그것은 morpholino의 특이성 우수한 증거를 제공합니다. 그러나, 그것은 자주 주입 mRNA의 잘못 타겟팅으로 인해 작동하지 않을 수 있습니다. 이것은 타겟 유전자의 표현 이상의 엄격한 공간과 시간적 제어를 허용할 수 있기 때문에 구조도, transposon 기반 transgenesis을 사용하여 테스트할 수 있습니다. 각각의 경우에, 구조 유전자가 morpholino의 대상이되지 않도록하는 것이 중요합니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

관심 없음 충돌 선언하지 않습니다.

Acknowledgments

이 프레 젠 테이션을 준비하는 그들의 도움 에반스 실험실 구성원 감사합니다. 여기에 사용되는 morpholinos는 원래 박사 오드리 Holtzinger에 의해 확인되었다. TE는 국립 보건원 (HL064282 및 HL056182)에서 기금에 의해 지원됩니다. 동물 실험은 웨일 코넬 메디컬 칼리지의 동물 관리 및 사용위원회 연구소에 의해 명시된 지침 및 규정에 따라 수행되었다.

Materials

Name Company Catalog Number Comments
Fish breeder tanks and dividers Aquatic Habitats
Fish nets Aquatic Habitats
System water 60mg Instant Ocean” per liter dH2O
100mm Petri dishes BD Biosciences 351029
Micropipette needle puller Sutter Instrument Co. P-97 Flaming/Brown
3.5" glass capillaries Drummond Scientific 3-000-203-G/X
Razor blade Personna Medical Care 94-120-71
Micro grinder Narishige International EG-4
Gridded microscope eyepiece Premiere MF-02
Micrometer WARD’s Natural Science 94 W 9910
Ultrapure agarose Invitrogen 15510-027
Spatula Fisher Scientific 14-357Q
Scale Mettler Toledo AB54-S/FACT
Disposable weigh dishes Fisher Scientific 2-202-B
Conventional microwave GE Healthcare
Erlenmeyer flask Corning 4980
Microscope slides Fisher Scientific 12-552
Graduated cylinder Fisher Scientific 08-572-6D
Automatic pipette man BrandTech 2026333
70% ethanol wash solution Tarr 801VWR
N2 tank Tech Air
Microinjector Harvard Apparatus PLI-100
Micromanipulator Micro Instruments LTD
Dissecting microscope Nikon Instruments SMZ1500
Parafilm American National Can PM-992
Mineral oil Sigma-Aldrich M5904
Kimwipes Kimberly-Clark Corporation 34155
gata5 splice site morpholino Genetools, LLC 5’-TCTTAAGATTTTTACCTATACTGGA-3’
gata5 ATG Blocker Genetools, LLC 5’-AAGATAAAGCCAGGCTCGAATACAT-3’
gata6 Long Isoform ATG Blocker Genetools, LLC 5’-AGCTGTTATCACCCAGGTCCATCCA-3’
Disposable Pasteur Pipette Fisher Scientific 13-678-20B
Tricaine Methanesulfonate Argent Labs MS-222
Methycellulose ICN Biomedicals 155495
Heat Block Fisher Scientific 11-718-4
Sharp forceps Dumont Size 55
Depression Microslides VWR international 48339-009

DOWNLOAD MATERIALS LIST

References

  1. Heicklen-Klein, A., McReynolds, L. J., Evans, T. Using the zebrafish model to study GATA transcription factors. Semin Cell Dev Biol. 16, 95-106 (2005).
  2. Bill, B. R., Petzold, A. M., Clark, K. J., Schimmenti, L. A., Ekker, S. C. A primer for morpholino use in zebrafish. Zebrafish. 6, 69-77 (2009).
  3. Holtzinger, A., Evans, T. Gata5 and Gata6 are functionally redundant in zebrafish for specification of cardiomyocytes. Dev Biol. 312, 613-622 (2007).
  4. Peterkin, T., Gibson, A., Patient, R. Redundancy and evolution of GATA factor requirements in development of the myocardium. Dev Biol. 311, 623-635 (2007).
  5. Holtzinger, A., Evans, T. Gata4 regulates the formation of multiple organs. Development. 132, 4005-4014 (2005).
  6. Sorrentino, R. P., Gajewski, K. M., Schulz, R. A. GATA factors in Drosophila heart and blood cell development. Semin Cell Dev Biol. 16, 107-116 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics