एक दिन बैक्टीरियल पैथोजन और रक्त संस्कृति से रोगाणुरोधी प्रतिरोध परीक्षण जांच के लिए कार्यप्रवाह योजना

Immunology and Infection
 

Summary

एक सीधा एक दिन बैक्टीरियल रोगज़नक़ निदान के लिए कार्यप्रवाह योजना के डिजाइन खून में संक्रमण का तेजी से मान्यता के लिए सक्षम बनाता है. आठ नैदानिक ​​प्रासंगिक जीवाणु लक्ष्य और उनके एंटीबायोटिक प्रतिरोध प्रोफाइल के शामिल किए जाने के clinician के एक ही दिन पर एक प्रारंभिक समझ है, जो और अधिक पर्याप्त चिकित्सा के लिए नेतृत्व कर सकते हैं प्रदान करता है.

Cite this Article

Copy Citation | Download Citations

Hansen, W. L., Beuving, J., Verbon, A., Wolffs, P. F. One-day Workflow Scheme for Bacterial Pathogen Detection and Antimicrobial Resistance Testing from Blood Cultures. J. Vis. Exp. (65), e3254, doi:10.3791/3254 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

खून में संक्रमण पूति के संभावित अभिव्यक्ति, गंभीर पूति और सेप्टिक एक सदमे की वजह से उच्च मृत्यु दर के साथ जुड़े रहे हैं. इसलिए, पर्याप्त एंटीबायोटिक चिकित्सा की तेजी से प्रशासन के खून में संक्रमण के इलाज में सबसे महत्वपूर्ण महत्व का है. इस प्रक्रिया में महत्वपूर्ण तत्व समय, भारी जीवाणु पहचान और एंटीबायोटिक संवेदनशीलता परीक्षण के परिणाम पर निर्भर है. इन मानकों के दोनों नियमित रूप से संस्कृति आधारित परीक्षण है, जो समय लेने वाली है और औसत 24-48 2 घंटे, 4 पर ले जाता है के द्वारा प्राप्त कर रहे हैं. अध्ययन का उद्देश्य खून में संक्रमण की तेजी से पहचान के लिए डीएनए आधारित assays, साथ ही तेजी से रोगाणुरोधी संवेदनशीलता परीक्षण विकसित किया गया था. पहली परख एक eubacterial rDNA - आधारित वास्तविक समय पीसीआर परख 16S प्रजातियों या जीनस 5 विशेष जांच के साथ पूरित है. इन जांच, स्यूडोमोनास एसपीपी सहित ग्राम नकारात्मक जीवाणुओं का प्रयोग, Pseudomonas aeruginosaऔर Escherichia कोलाई के रूप में अच्छी तरह से Staphylococcus एसपीपी Staphylococcus aureus, उदर गुहा एसपीपी, स्ट्रैपटोकोकस एसपीपी. और स्ट्रैपटोकोकस निमोनिया सहित ग्राम पॉजिटिव बैक्टीरिया प्रतिष्ठित किया जा सकता है. इस multiprobe परख का प्रयोग, प्रेरणा का सूक्ष्म जीव की पहली पहचान 2 घंटे के बाद दिया गया था.

दूसरे, हम एस एंटीबायोटिक संवेदनशीलता परीक्षण के लिए एक अर्द्ध आणविक परख विकसित aureus, उदर गुहा एसपीपी. और (ऐच्छिक) aerobe ग्राम नकारात्मक 6 छड़. इस परख में जो पीसीआर 7 बैक्टीरिया की वृद्धि को मापने के लिए इस्तेमाल किया गया था एक अध्ययन के आधार पर किया गया था. रक्त संस्कृतियों से सीधे काटा जीवाणु एंटीबायोटिक दवाओं के एक चयन के साथ 6 घंटे के लिए incubated हैं, और एक Sybr ग्रीन आधारित वास्तविक समय पीसीआर परख के बाद विकास के अवरोध को निर्धारित करता है. इन दो विधियों के संयोजन एक ही दिन (चित्रा 1) पर एक उपयुक्त एंटीबायोटिक चिकित्सा की पसंद प्रत्यक्ष सकता है. अंत में, दोनों की पहचान और एंटीबायोटिक संवेदनशीलता की आणविक विश्लेषण एक तेजी से रोगज़नक़ पता लगाने के लिए विकल्प प्रदान करता है और खून में संक्रमण के निदान में सुधार सकता है.

Protocol

भाग मैं रोगज़नक़ पहचान:

1. नमूना तैयार करना

नोट: पूरे आणविक वर्कफ़्लो के रूप में निम्नलिखित प्रोटोकॉल में वर्णित है आणविक निदान में गुणवत्ता आश्वासन 3 के लिए सिफारिशों के अनुसार किया जाना चाहिए.

  1. 0.9 मिलीलीटर 0.9% 1.5 मिलीग्राम प्रतिक्रिया ट्यूब में NaCl 01:10 पतला नमूना बनने के लिए एक 0.1 रक्त संस्कृति के मिलीलीटर अशेष भाजक जोड़ें (पतला qPCR अवरोध को रोकने के क्रम में).
  2. 13,400 XG पर 5 गोली न्यूनतम जीवाणु के डीएनए के लिए नमूना अपकेंद्रित्र.
  3. 100 μl बाँझ demineralised एच 2 ओ में बैक्टीरिया गोली Resuspend
  4. 4 डिग्री तक सी आगे उपयोग के डीएनए नमूने की दुकान.

2. पहचान की परख: वास्तविक समय -16 rDNA पीसीआर

  1. प्रतिक्रिया के रूप में मिश्रण तैयार करें. परख नमूना प्रति चार अलग - अलग प्रतिक्रियाओं के होते हैं. प्रत्येक मिश्रण 12.50 μl मास्टरमिश्रण में 0.9 माइक्रोन आगे प्राइमर (5 TCCTACGGGAGGCAGCAGT 3) 7, 0.6 माइक्रोन रिवर्स प्राइमर (5 GGACTACCAGGGTATCTAATCCTGTT 3) 8 और जांच के एक पैनल. जांच की राशि नीचे में चार अलग - अलग प्रतिक्रियाओं के प्रत्येक के लिए दिया जाता है.
  2. पहली प्रतिक्रिया में शामिल हैं:
    • 0.2 माइक्रोन सार्वभौमिक जांच (5 - परिवार-CGTATTACCGCGGCTGCTGGCAC-3-BHQ1) 8
    • 0.2 माइक्रोन पी. aeruginosa जांच (5 - जो CCAAAACTACTGAGCTAGAGTACG-3-BHQ1)
  3. 2 प्रतिक्रिया में शामिल हैं:
    • 0.2 माइक्रोन ई. कोलाई जांच (5 - जो GGAGTAAAGTTAATACCTTTGCTCATT-3-BHQ1)
    • 0.2 माइक्रोन स्यूडोमोनास एसपीपी. जांच (5 NED से - CCTTCCTCCCAACTTAAAGTGCTT-3-MGBNFQ)
  4. 3 प्रतिक्रिया में शामिल हैं:
    • 0.2 माइक्रोन Staphylococcus एसपीपी. जांच (5 NED से - AATCTTCCGCAATGGGCGAAAGC-3-MGBNFQ)
    • 0.2 एस माइक्रोन aureus जांच (5 - परिवार-AGATGTGCACAGTTACTTACACATAT-3-BHQ1)
    • 0.2 माइक्रोन उदर गुहा एसपीपी. (5 जो - TCCTTGTT केCTTCTCTAACAACAGAG-3-BHQ1)
  5. 4 प्रतिक्रिया में शामिल हैं:
    • 0.2 माइक्रोन सार्वभौमिक जांच (5 - परिवार-CGTATTACCGCGGCTGCTGGCAC-3-BHQ1)
    • 0.3 माइक्रोन स्ट्रैपटोकोकस एसपीपी. जांच (5 NED से - CCAGAAAGGGACSGCTAACT-3-MGBNFQ)
    • 0.2 एस माइक्रोन निमोनिया जांच (5 - जो CCAAAGCCTACTATGGTTAAGCCA-3-BHQ1)
  6. बाँझ demineralised एच 2 हे 20 μl की कुल मात्रा तक पहुँचने के लिए. एक 96 अच्छी तरह से पीसीआर थाली के कुओं के लिए प्रत्येक प्रतिक्रिया मिश्रण की 20 μl जोड़ें.
  7. प्रत्येक अच्छी तरह से करने के लिए नमूने के 5 μl जोड़ें.
  8. 96 अच्छी तरह से पीसीआर थाली सील चिपकने वाला एक फिल्म का उपयोग करें.
  9. अबी चश्मे 7900HT रियल समय पीसीआर सिस्टम निम्नलिखित इष्टतम थर्मल साइकिल चालन की स्थिति का उपयोग करता पर थाली चलाएँ:
    • 50 डिग्री सेल्सियस पर 10 मिनट के लिए पूर्व हीटिंग
    • 15 मिनट के लिए 95 डिग्री सेल्सियस पर प्रारंभिक विकृतीकरण
    • के 42 चक्र
      • 95 ° C पर 15 के लिए विकृतीकरण
      • 1 मिनट के लिए 60 डिग्री सेल्सियस पर एनीलिंग

3. परिणामों का विश्लेषण

  1. सीटी विश्लेषण की सीमा 0.1 से टैब विश्लेषण सेटिंग्स समायोजित करें. 6 और समाप्ति (साइकिल): 15 आधारभूत शुरू करने के विन्यास (साइकिल) संकीर्ण.

  2. रिकार्ड चक्र सभी नमूनों के लिए सीमा मान (सीटी). कट ऑफ के लिए सकारात्मक रूप में एक पीसीआर परिणाम पर विचार के मूल्य 35 की सीटी - मूल्य के लिए सेट किया जा सकता है. रक्त संस्कृतियों में मौजूद बैक्टीरिया की मात्रा 10 7 से 10 / CFU मिलीलीटर 11 से लेकर 35 के नीचे सीटी मान पैदा.

एंटीबायोटिक संवेदनशीलता परीक्षण: भाग द्वितीय

4. जीवाणुओं की सकारात्मक रक्त संस्कृति 9 से अलगाव

  1. एक सकारात्मक रक्त संस्कृति बोतल से शोरबा के 5 मिलीलीटर महाप्राण (व्यंजन) और यह एक सीरम विभाजक ट्यूब में स्थानांतरित.
  2. 10 मिनट के लिए 2000 XG पर सीरम विभाजक ट्यूब अपकेंद्रित्र.
  3. सीरम विभाजक ट्यूब से सतह पर तैरनेवाला त्यागें.
  4. स्थानांतरण बीएसीteria 0.9% खारा में ट्यूब के एक बाँझ कपास झाड़ू के साथ जेल परत से 0.5 मैकफ़ारलैंड मानक निलंबन तक प्राप्त की है.

5. माइक्रो titre प्लेट्स का टीका

  1. 5 x 10 5 CFU / एमएल के एक निलंबन के रूप में डबल केंद्रित के म्यूएलर हिंटन द्वितीय शोरबा में 0.5 मैकफ़ारलैंड निलंबन पतला.
  2. एक माइक्रो अनुमापांक एंटीबायोटिक दवाओं (तालिका 1) का एक चयन युक्त थाली के कुओं को इस निलंबन जोड़ें.
  3. 37 ° C पर 6 घंटे के लिए माइक्रो अनुमापांक थाली सेते हैं.
  4. 4 डिग्री सेल्सियस (नकारात्मक वृद्धि पर नियंत्रण के रूप में) पर निलंबन की अशेष भाजक की दुकान.
  5. ऊष्मायन के 6 घंटे के बाद, एक बाँझ ट्यूब में एक अच्छी तरह की सामग्री हस्तांतरण, के रूप में नकारात्मक वृद्धि नियंत्रण नमूना अच्छी तरह से है कि 4 डिग्री सेल्सियस पर संग्रहीत किया गया
  6. 5 मिनट के लिए 16,000 XG ट्यूबों अपकेंद्रित्र.
  7. ध्यान से बैक्टीरिया गोली परेशान बिना सतह पर तैरनेवाला हटायें.
  8. बाँझ demineralised एच में गोली Resuspend
  9. नमूने बाँझ demineralised एच 2 ओ में 10 गुना पतला

6. वास्तविक समय rDNA 10 पीसीआर -16

  1. पीसीआर के रूप में मिश्रण तैयार करें:
    • 12.50 μl बुद्धि SYBR ग्रीन Supermix
    • 0.5 आगे माइक्रोन 16S-1 प्राइमर (5 TGGAGAGTTTGATCCTGGCTCAG - 3) 11
    • 0.25 माइक्रोन रिवर्स प्राइमर-16S 2 (5 TACCGCGGCTGCTGGCAC 3) 11
    • बाँझ demineralised 20 μl की कुल मात्रा के लिए एच 2 हे
  2. एक 96 अच्छी तरह से पीसीआर थाली के कुओं को पीसीआर मिश्रण के 20 μl जोड़ें.
  3. प्रत्येक अच्छी तरह से करने के लिए नमूने के 5 μl जोड़ें.
  4. 96 अच्छी तरह से पीसीआर थाली सील चिपकने वाला एक फिल्म का उपयोग करें.
  5. MyiQ एकल रंग वास्तविक समय पीसीआर जांच प्रणाली पर थाली चलाने के लिए, निम्नलिखित इष्टतम थर्मल साइकिल चालन की स्थिति का उपयोग:
    • 4 मिनट के लिए 95 डिग्री सेल्सियस पर प्रारंभिक विकृतीकरण
    • ° 30 के लिए सी प्रारंभिक 65 में annealing के
    • के 35 चक्र
      • 9 में विकृतीकरण5 ° C 15
      • 1 मिनट के लिए 60 डिग्री सेल्सियस पर एनीलिंग
    • वक्र विश्लेषण पिगलो (डिग्री सेल्सियस 0.57 डिग्री सेल्सियस की वृद्धि के साथ 20 मिनट में 60-95 से)

7. परिणामों का विश्लेषण

  1. कट ऑफ सीटी (एंटीबायोटिक के प्रकार पर निर्भर करता है) निम्न सूत्रों का उपयोग मूल्य की गणना.
    • सामान्य रूप में:
      कटअॉॉफः सीटी मूल्य = सीटी मूल्य सकारात्मक वृद्धि नियंत्रण + 0.5 x (सीटी मूल्य नकारात्मक वृद्धि नियंत्रण सीटी मूल्य सकारात्मक विकास नियंत्रण)
    • Piperacillin piperacillin / tazobactam और ग्राम नकारात्मक छड़ में ceftazidime, Amoxicillin oxacillin, और Trimethoprim / S.aureus में sulfamethoxazole, उदर गुहा में Amoxicillin एसपीपी: कटअॉॉफः सीटी मूल्य = सीटी मूल्य सकारात्मक वृद्धि नियंत्रण + x 0.25 (सीटी मूल्य नकारात्मक विकास नियंत्रण - सीटी मूल्य सकारात्मक वृद्धि नियंत्रण)
  2. सकारात्मक विकास के नियंत्रण के रूप में को बाँझ demineralised एच 2 हे के साथ incubated नमूना का उपयोग करें.
  3. सूक्ष्मजीव पर निर्भर करता है, उपयुक्त नकारात्मक वृद्धि नियंत्रण का उपयोग करें:
    • ग्राम नकारात्मक छड़ नमूना एंटीबायोटिक दवाओं के मिश्रण के साथ incubated
    • उदर गुहा एसपीपी नमूना 4 डिग्री सेल्सियस पर संग्रहित
    • S.aureus नमूना 4 डिग्री सेल्सियस पर संग्रहित
  4. संवेदनशीलता (एस) या के रूप में परीक्षण एंटीबायोटिक के लिए तनाव की प्रतिरोध (नि.) निर्धारित:
    • एक सीटी काट सीटी मूल्य से अधिक मूल्य संवेदनशीलता इंगित करता है
    • एक सीटी काट सीटी मूल्य से कम मूल्य प्रतिरोध इंगित करता है

8. प्रतिनिधि परिणाम

दो मॉडल जीवों के लिए, एक ग्राम नकारात्मक ई. अर्थात् कोली और एक ग्राम सकारात्मक एस. aureus, बैक्टीरियल रोगज़नक़ों और उनके रोगाणुरोधी प्रोफ़ाइल के दृढ़ संकल्प का पता लगाने और पहचान के लिए संयुक्त प्रक्रिया की कल्पना करने के लिए चुना जाता है. प्रोटोकॉल के पहले भाग रोगज़नक़ पहचान शामिल हैं. Specific जांच आठ नैदानिक ​​प्रासंगिक सूक्ष्मजीवों का पता लगाने के लिए डिजाइन किए हैं. एक जीवाणु पैनल में शामिल लक्ष्य की उपस्थिति में, प्रवर्धन घटता उत्पन्न होते हैं और सीटी मूल्यों (चित्रा 2) की गणना कर रहे हैं. काट सकारात्मक रूप में एक पीसीआर परिणाम पर विचार करने के लिए मान 35 के एक सीटी मूल्य के लिए सेट कर दिया जाता है. चित्रा 2A में एक ई. कोलाई संक्रमित रक्त संस्कृति की पहचान प्रोफ़ाइल दिखाया गया है. 16S सार्वभौमिक जांच दो अलग - अलग प्रतिक्रिया मिश्रण में शामिल है और फलस्वरूप दो प्रवर्धन घटता है (25.20 और 25.95 की सीटी) उत्पन्न करता है. तीसरा संकेत जांच के लिए विशिष्ट ई. से ली गई है कोली (27.04 की सीटी). एक एस के पहचान aureus संक्रमित रक्त संस्कृति चित्रा 2B में दिखाया जाता है. 16S सार्वभौमिक जांच 33.35 और 33.71 के प्रवर्धन संकेत है. शेष दो Staphylococcus एसपीपी के लिए विशिष्ट जांच से संकेत प्राप्त कर रहे हैं. और एस. aureus (32.48 और 30.59 की सीटी).

चित्रा 3 एक एंटीबायोटिक संवेदनशीलता परीक्षण प्रवर्धन साजिश, ई. कोलाई तनाव भी दिखाया गया था का प्रतिनिधित्व का एक उदाहरण है. चित्रा 2A में. प्रत्येक पंक्ति एक एंटीबायोटिक है कि बैक्टीरिया का नमूना के साथ incubated का प्रतिनिधित्व करता है. एक कम सीटी मूल्य के साथ एक नमूना एक नमूना है जिसमें विकास एक एंटीबायोटिक है, यह दर्शाता है परीक्षण एंटीबायोटिक प्रतिरोध की उपस्थिति में हुई है. इसके विपरीत, एक उच्च सीटी मूल्य एक नमूना है जो में कोई विकास नहीं प्रभावी एंटीबायोटिक, संवेदनशीलता का संकेत के परीक्षण एंटीबायोटिक के लिए काम करने की वजह से हुई है प्रतिनिधित्व करता है. तालिका 1 ई. का रोगाणुरोधी प्रोफ़ाइल के दृढ़ संकल्प दिखाता है कोलाई और एस. aureus आइसोलेट्स. सभी सीटी मूल्यों की रिपोर्ट, प्रोटोकॉल पाठ (7.1) में वर्णित सूत्रों का उपयोग, दो काट सीटी मूल्यों Calcuप्रतिरोध और संवेदनशीलता के बीच भेद करने के लिए lated. तनाव एंटीबायोटिक के लिए प्रतिरोधी है अगर रिपोर्ट सीटी मूल्य गणना कटौती बंद सीटी मूल्य (और इसके विपरीत) से कम है.

चित्रा 1

चित्रा 1 रोगज़नक़ पहचान और एंटीबायोटिक संवेदनशीलता परीक्षण प्रक्रिया का उपयोग कर वास्तविक समय 16S rDNA पीसीआर के प्रवाह चार्ट.

चित्रा 2
चित्रा 2 पहचान परख: प्रवर्धन भूखंडों और चक्र दहलीज मूल्यों (सीटी मूल्यों) एक सकारात्मक रक्त संस्कृति सार्वभौमिक 16S rDNA जांच से पता चला है, जबकि विशिष्ट जांच कारण रोगज़नक़ की पहचान के लिए उपयोग किया जाता है. ई. ए रक्त संस्कृति के प्रवर्धन साजिश युक्त कोलाई, बी रक्त संस्कृति का प्रवर्धन साजिश एस युक्त aureus, Pseu ऐ, Pseudomonaeruginosa के रूप में, विश्वविद्यालय, 16S जांच सार्वभौमिक, ecoli, Escherichia कोलाई जांच; Pseu सपा, स्यूडोमोनास एसपीपी. जांच एस, टायर स्ट्रैपटोकोकस निमोनिया जांच, Strep सपा, स्ट्रैपटोकोकस एसपीपी. जांच, अँतड़ियों से संबद्ध, उदर गुहा एसपीपी. जांच, एस aureus, Staphylococcus aureus जांच, Staph सपा, Staphylococcus एसपीपी. जांच.

चित्रा 3
चित्रा 3. एक की एंटीबायोटिक संवेदनशीलता परीक्षण के प्रवर्धन साजिश कोली को अलग (1 नमूना). प्रत्येक वक्र एक एंटीबायोटिक है कि तनाव के साथ incubated का प्रतिनिधित्व करता है. एक प्रारंभिक संकेत एक उच्च बैक्टीरियल लोड है, जिसका अर्थ है कि तनाव परीक्षण एंटीबायोटिक की उपस्थिति में हो गया है और इस प्रकार एंटीबायोटिक प्रतिरोधी है के कारण होता है. देर संकेतों से संकेत मिलता है कि तनाव एंटीबायोटिक की उपस्थिति में नहीं हो गया है, दूसरे शब्दों में, यह संभावना है.

1 नमूना: ई. कोलाई 2 नमूना: एस. aureus
AST सीटी आर / एस AST सीटी आर / एस
Amoxicillin 8 मिलीग्राम / एल 16,83 आर Amoxicillin 0.25 मिलीग्राम / एल 21,03 आर
Amoxicillin-clavulanate 8/4 मिलीग्राम / एल 17,36 आर Oxacillin 2 मिलीग्राम / एल 25,80 एस
Piperacillin 16 मिलीग्राम / एल 16,67 आर Vancomycin 2 मिलीग्राम / एल 25,20 एस
Piperacillin - tazobactam / 164 मिलीग्राम / एल 24,15 एस Gentamicin 4 मिलीग्राम / एल 25,86 एस
Ciprofloxacin 1 मिलीग्राम / एल 29,72 एस Trimethoprim-sulfamethoxazole 2/38 मिलीग्राम / एल 24,62 एस
Ceftazidime 1 मिलीग्राम / एल 24,03 एस
Ceftazidime 8 मिलीग्राम / एल 26,58 एस
Gentamicin 4 मिलीग्राम / एल 29,83 एस
Trimethoprim-sulfamethoxazole 2/38 मिलीग्राम / एल 27,60 एस
नकारात्मक विकास नियंत्रण (एंटीबायोटिक दवाओं के मिश्रण) 30,41 नकारात्मक वृद्धि नियंत्रण (नमूना डिग्री सेल्सियस 4 में संग्रहीत) 27,42
सकारात्मक विकास नियंत्रण 16,90 सकारात्मक विकास नियंत्रण 20,22
कटौती बंद 1 सीटी के मूल्य * 21,76 कटअॉॉफः 1 सीटी के मूल्य *** 23,82
कटौती बंद 2 सीटी - मूल्य ** 18,75 कट - सीटी - मूल्य 2 **** 22,02
* Amoxicillin, amoxicillin-clavulanate, ciprofloxacin, gentamic के लिए, Trimethoprim-sulfamethoxazole
** Piperacillin, piperacillin tazobactam, ceftazidime
Vancomycin के लिए *** और gentamicin
**** से amoxicillin oxacillin और Trimethoprim-sulfamethoxazole

तालिका 1. दो नमूने (ई. कोलाई और S.aureus) एंटीबायोटिक संवेदनशीलता परीक्षण का निर्धारण. पीसीआर - परख की सीटी मूल्यों इस एक्सेल फ़ाइल को कॉपी किया गया है, जो के रूप में स्वचालित रूप से सकारात्मक और नकारात्मक वृद्धि नियंत्रण से दो कट ऑफ सीटी alues ​​की गणना कर सकते हैं, सूत्रों का उपयोग प्रोटोकॉल पाठ में दिखाया गया है. यदि एक एंटीबायोटिक एक सीटी मूल्य काट सीटी मूल्य से कम से पता चलता है, तनाव एंटीबायोटिक के लिए प्रतिरोधी है, अगर सीटी मूल्य कटौती बंद की तुलना में अधिक था, तनाव अतिसंवेदनशील है.

Discussion

यहां वर्णित प्रोटोकॉल रोगज़नक़ों के तेजी से पहचान सक्षम बनाता है और एक कार्यात्मक रोगाणुरोधी प्रोफ़ाइल है कि पर्याप्त जिससे खून में संक्रमण के साथ रोगियों के रोग का निदान में सुधार एंटीबायोटिक दवाओं के जल्दी प्रशासन के लिए ले जा सकता है प्रदान करता है. एक परीक्षण का अनुरोध शर्तों पर निर्भर करता है, यानी कम लागत, उच्च throughput, कम से कम समय चारों ओर मोड़, परीक्षण की स्थिति समायोजित किया जा सकता है. पूरी प्रक्रिया एक काम कर दिन के भीतर किया जा सकता है. इसके अलावा, प्रोटोकॉल के दो भागों में एक साथ प्रदर्शन किया जा सकता है, जो बारी के आसपास समय काफी कम कर देता है. जैसा कि यहाँ प्रस्तुत है, पहचान पैनल हमारे अस्पताल में सबसे नैदानिक ​​प्रासंगिक बैक्टीरिया का एक चयन है. मुख्य सिद्धांत के बाद से 16S जीन क्षेत्र को लक्षित कर रहा है, अन्य सूक्ष्मजीवों के लिए विशिष्ट जांच और डिजाइन किया जा सकता परख करने के लिए जोड़ा है. पूरा परख मूल रूप से रक्त संस्कृतियों का तेजी से विश्लेषण के लिए इरादा था, लेकिन ओ के प्रसंस्करण के लिए भी इस्तेमाल किया जा सकता हैवहाँ नमूना सामग्री. यह भी एंटीबायोटिक दवाओं के लिए मामला है कि एंटीबायोटिक संवेदनशीलता परीक्षण के लिए इस्तेमाल किया गया है: अधिक या अन्य एंटीबायोटिक दवाओं स्थानीय प्रतिरोध पैटर्न और दिशा निर्देशों के आधार पर हो सकता है जोड़ा जा सकता है.

Disclosures

हम खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgements

यह काम Profileringsfonds AZM (PF245) द्वारा समर्थित किया गया था.

Materials

Name Company Catalog Number Comments
Sodium Chloride (NaCl) Merck Chemicals 106404 0.9% in water
Vacutainer SST Serum Separator Tube 5 ml BD Diagnostic Systems 367986
Mueller Hinton II broth BD Diagnostic Dystems 212322 44 g/L in water
Centrifuge Rotixa 50 rs Andreas Hettich GmbH Co. KG 4910
Centrifuge 5415 D Eppendorf Discontinued
Primers Sigma-Aldrich n.a.
Probes Sigma-Aldrich/Applied Biosystems n.a.
TaqManEnvironmental master mix 2.0 Applied Biosystems 4396838
iQ SYBRGreen Supermix Bio-Rad Laboratories BV 170-8880
MicroAmp Optical 96-Well Reaction Plate Applied Biosystems N8010560
MicroAmp Optical Adhesive Film Applied Biosystems 4311971
iQ 96-Well PCR Plates Bio-Rad Laboratories BV 223-9441
Microseal B Adhesive Seals Bio-Rad Laboratories BV MSB-1001
Real-time PCR Detection System Applied Biosystems ABI PRISM 7900HT
Real-Time PCR Detection System Bio-Rad Laboratories BV MyiQ Single-Color

DOWNLOAD MATERIALS LIST

References

  1. Wallet, F. Preliminary clinical study using a multiplex real-time PCR test for the detection of bacterial and fungal DNA directly in blood. Clin. Microbiol. Infect. 16, 774 (2010).
  2. Beekmann, S. E., Diekema, D. J., Chapin, K. C., Doern, G. V. Effects of rapid detection of bloodstream infections on length of hospitalization and hospital charges. J. Clin. Microbiol. 41, 3119 (2003).
  3. Raymaekers, M., Bakkus, M., Boone, E., de Rijke, B., Housni, H. E. l, Descheemaeker, P., De Schouwer, P., Franke, S., Hillen, F., Nollet, F., Soetens, O., Vankeerberghen, A. Molecular Diagnostics working group. Reflections and proposals to assure quality in molecular diagnostics. Acta. Clin. Belg. 66, 33 (2011).
  4. Peters, R. P. New developments in the diagnosis of bloodstream infections. Lancet Infect. Dis. 4, 751 (2004).
  5. Hansen, W. L., Beuving, J., Bruggeman, C. A., Wolffs, P. F. Molecular probes for the diagnosis of clinically relevant bacterial infections in blood cultures. J. Clin. Microbiol. 48, 4432-4432 (2010).
  6. Beuving, J. Antibiotic susceptibility testing of grown blood cultures by combining culture and real-time polymerase chain reaction is rapid and effective. PLoS ONE. 6, (2011).
  7. Rolain, J. M., Mallet, M. N., Fournier, P. E., Raoult, D. Real-time PCR for universal antibiotic susceptibility testing. J. Antimicrob. Chemother. 54, 538 (2004).
  8. Nadkarni, M. A., Martin, F. E., Jacques, N. A., Hunter, N. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiol. 148, 257 (2002).
  9. Waites, K. B., Brookings, E. S., Moser, S. A., Zimmer, B. L. Direct susceptibility testing with positive BacT/Alert blood cultures by using MicroScan overnight and rapid panels. J. Clin. Microbiol. 36, 2052 ( ).
  10. Vliegen, I. Rapid identification of bacteria by real-time amplification and sequencing of the 16S rRNA gene. J. Microbiol. Meth. 66, 156 (2006).
  11. Hall, L., Doerr, K. A., Wohlfiel, S. L., Roberts, G. D. Evaluation of the MicroSeq system for identification of mycobacteria by 16S ribosomal DNA sequencing and its integration into a routine clinical mycobacteriology laboratory. J. Clin. Microbiol. 41, 1447 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics