수성 환경에서 탄화수소 전환을 사용하는 툴킷

Bioengineering
 

Summary

오일 오염의 개선을 위해 박테리아 시스템을 규제 지속 가능한 자동차는 표준 호환 DNA 부품 (BioBricks)를 사용하여 설계되었습니다. 엔지니어링

Cite this Article

Copy Citation | Download Citations

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

이 작품은 앞으로 대장균에 의해 alkanes의 전환을 가능하게하고 적용의 원리의 증명을 제시하는 툴킷를 게재 할 수 있습니다. 툴킷은 여러 표준 교환 부품 (BioBricks) 9 alkanes의 전환, 독성 탄화수소 풍부한 환경에서의 유전자 발현과 생존의 규정을 해결로 구성되어 있습니다.

alkane 저하에 대해 3 단계 경로는 E.에 구현 된 각 alkanols, alkanals 궁극적으로 alkanoic - 산에 중간과 긴 체인 alkanes의 전환을 활성화 대장균. 후자는 기본 β-산화 경로를 통해 대사되었다. 중간 체인 alkanes (C5-C13)와 cycloalkanes (C5-C8), Gordonia SP에서 alkane hydroxylase 시스템 네 가지 유전자 (alkB2, rubA3, rubA4rubB)의 산화를 촉진합니다. TF6 8,21는 E.로 변환 된 대장균. 의 전환에 대한장쇄 alkanes (C15-C36)는 Geobacillus thermodenitrificans에서 라다 유전자가 구현되었습니다. 열화 과정에 필요한 자세한 단계를 들어, ADHALDH은 (G. thermodenitrificans에서 발생) 10,11을 도입했다. 활동은 휴식 세포 assays에 의해 측정되었다. 각 산화 단계에 효소 활동이 관찰되었다.

프로세스 효율을 최적화하려면, 그 표현은 낮은 포도당 조건에서 유도되었습니다 기판 - 규제 발기인, pCaiF가 사용되었습니다. pCaiF는 E.에 존재 대장균 K12 및 비 포도당 탄소 소스의 저하에 관련된 유전자의 표현을 규제하고있다.

툴킷의 마지막 부분 - 생존을 대상으로는 - PhPFDα와 β 용매 내성 유전자, Pyrococcus horikoshii OT3에서 모두를 사용하여 구현되었습니다. 유기 용제에 부정적인 affectin에 의해 세포 스트레스를 유발하고 survivability을 감소 할 수 있습니다g 단백질 폴딩. 보호자로서 PhPFDα와 β는 alkanes의 존재에 따라 단백질 접힘 과정 등을 향상시킵니다. 문화 매체에서 10 % N-헥산의 presences의 증가 성장 속도 (최대 50 %)로 표시 개선 탄화수소 허용으로 이어이 유전자의 표현이 관찰되었다.

요약, 결과는 툴킷은 E. 수있게 된 것을 나타냅니다 수성 환경에서 탄화수소를 변환하고 관대 할 수 대장균. 따라서, 그것은 합성 생물학 접근 방식을 사용하여 오일 개선을위한 지속 가능한 솔루션에 대한 초기 단계를 나타냅니다.

Protocol

1. BioBrick 조립

  1. 표준 생물 부품의 레지스트리에서 BioBricks는 iGEM 본부에 의해 제공됩니다. 기존 BioBricks에서 새로운 BioBrick을 구성하려면 수용체 부분의 기증자 부분의 하류를 위치에 대한 효소 EcoRI과 SpeI으로 기증자 BioBrick (최대 1.0 μg) 소화. 수용체 부분의 상류 기증자 부분을 위치시키기위한 XbaI 및 PstI있는 다이제스트. 기증자의 중추에 끊어 삼분의 일 적절한 제한 효소를 추가합니다. 공급 업체 (최종 농도 1X)에 따라, 해당 버퍼와 20-25 ML의 총 볼륨에 dig​​estions을 수행합니다. 제한 효소에 대해 5 단위 / μg의 DNA를 사용하십시오.
  2. EcoRI 및 XbaI 또는 SpeI 및 PstI 중과 수용체 BioBrick을 소화.
  3. 37에 하나의 시간 (최소)의 digestions을 품어 ° C. 제한이 열에 의해 endonucleases 비활성화, 80에서 부화 곧 10 분 및 원심 분리기에 대한 ° C.
  4. 소화 BioBrick을 Ligate함께 부품 (기증자와 수용체). XbaI 및 SpeI 호환 DNA 종료를 생성하기 때문에, 혼합 사이트는 4 표준 제한 사이트으로 둘러싸인 한 새로운 '통합'BioBrick에서 발생하는 제한 효소로 절단 할 수없는 그 생성됩니다. 결합 혼합물에서 최종 DNA 농도가 바람직 ~ 100 NG / μl. T4 결합 버퍼 (최종 농도 1X) 및 T4 ligase (1 단위 / μg의 DNA)와 10-15 ML의 총 볼륨의 결합 반응을 수행합니다.
  5. 적어도 3 시간 16 ° C에 결합 혼합물을 품다.
  6. 결합 믹스의 년경 반으로 변환 반응을 수행합니다.
  7. 시퀀싱과 올바른 BioBrick을 확인합니다.
  8. 합성 DNA에서 새 BioBrick을 구성하려면, E.에 최적의 표현을위한 합성에 대한 유전자를 수정 JCat 웹 사이트 도구 (수단을 이용하여 대장균 http://www.jcat.de/ ). B의 요구 사항에 따라 추가 수정 ioBrick 표준입니다. 이 표준화는 모든 BioBrick이 접두사 앞에와 접미사 다음 관심있는 DNA 순서로 구성되어 있습니다 의미합니다. 접두사와 접미사는 나머지 플라스미드 순서대로 없어졌어 미리 정의 된 제한 사이트를 포함 시퀀스입니다. 이러한 표준 제한 사이트는 교류, 9 유연하게 BioBrick 삽입을 확장하는 것이 가능합니다. 접두사와 접미사는 다음과 같은 순서를 가지고 :
이름 순서 논평
접두사 5 'GAATTCGCGGCCGCTTCTAG3'
5 'GAATTCGCGGCCGCTTCTAGAG 3' 다음 부분은 코딩 순서 또는 "ATG"로 시작하는 일부 경우
접미사 5 'TACTAGTAGCGGCCGCTGCAG 3'
생체 내 ove_title "> 2. Alkane 변환 휴식 세포 분석,

이 분석은 후지 외. (2004)에 의해 기술 된 방법에 따라 수행되었다.

  1. 문화 E. Alkane Hydroxylase 시스템 (표현 대장균 세포 BBa_K398014 빈 벡터 (수행)와 세포 BBa_J13002을 하루 아침에 적절한 항생제로 5 ML의 LB 매체에를).
  2. 신선한 LB의 50 ML (항생제 포함)에 밤 문화를 500 μl를 전송하고 세포 탁도가 600 나노 미터에서 0.3의 OD를 (광학 밀도)에 도달 할 때까지 알을 품다.
  3. 4000 rpm으로 10 분 동안 원심 분리기, 5 ML 0.1 M 인산 버퍼 (산도 7.4)에서 펠렛을 resuspend.
  4. 4000 rpm에서 10 분 동안 다시 원심 분리기 지금 E2 소금과 0.66 % V / V 글리세롤 (질소 deficien를 포함하는 5 ML 0.1 M 인산 버퍼에있는 펠릿을 resuspendt 중간).
  5. 셀 탁도 (OD 600) 측정합니다.
  6. 25 ML 폐쇄 캡 유리 플라스크없이 셀 컨트롤 (E2 소금 + 0.66 % V / V 글리세롤)에서 6 ML의 세포 혼합 aliquots를 준비합니다.
  7. 각 플라스크에 alkane 100 nmol을 추가합니다.
  8. 24 시간 (높은 속도를 얻을 때 단축)에 대한 37 ° C에서 혼합물을 품다.
  9. 부화 후 OD 600 측정합니다.
  10. 에틸 아세테이트하여 문화 미디어의 탄화수소를 추출하여 가스 크로마토 그래피 (프로토콜 3 참조)에 의해 세포 배양의 탄화수소 농도를 결정한다.
  11. 각 플라스크에 총 바이오 매스 현재 (건조 중량에 OD 600 변환)에 의해 변환 alkane의 총 금액을 나누어 바이오 매스의 단위 당 저하를 계산합니다. 실험 기간으로 결과를 나누면 시간 단위 당 단위 바이오 매스 당 저하 활동을 산출. 평균은 세 개인 점에서 가져옵니다.

3. Alkane 전환 효소 분석에서는체외

이 분석은 리 외. (2008)에 의해 기술 된 방법에 따라 기본적으로 수행되었다.

  1. 문화 E. 라다 유전자 (표현 대장균 세포 BBa_K398017 ) 및 빈 벡터 (들고 세포 BBa_J13002을 하루 아침에 적절한 항생제로 50 ML의 LB 매체에를).
  2. 신선한 LB의 50 ML (항생제 포함)에 밤 문화를 500 μl를 전송하고 세포 탁도가 600 나노 미터에서 0.6의 광학 밀도에 도달 할 때까지 품다.
  3. 4000 RPM (4 ° C)에서 10 분 원심 분리기 50 MM 트리스 버퍼의 5 ML에 펠렛을 resuspend.
  4. 4 출력 제어 40 % 듀티 사이클에서 Sonicate (셀 장애, LA Biosystems) 세포는 전체 기간 동안 얼음에 솔루션을 보관.
  5. 4 & D에 4,000 rpm으로 5 분 동안 발생하는 혼합물을 원심 분리기예를 들어, C 세포 오염 물질을 제거 할 수 있습니다. 새로운 유리 병에 표면에 뜨는을 전송합니다.
  6. 브래드 포드 분석하여 세포 추출물의 총 단백질 농도를 결정합니다. 참고 : 배경의 증가 및 / 또는 단백질의 손실을 방지하기 위해 유리 병을 사용합니다.
  7. 0.1 % V / V alkane 50 MM 트리스 - HCL 버퍼를 포함하는 100 ML 혼합물을 준비합니다.
  8. 5 분에 ° C 100 혼합물을 가열. 참고 : 높은 끓는 점과 중간 길이의 체인 alkanes에 대해이 단계를 수행합니다. (예 : C 16 : 287 ° C).
  9. alkane의 최적의 용해도를 달성하기 위해, 1 분 아직 따뜻한하는 동안 동질, 점성 혼합물을 취득 할 때까지에 sonicate.
  10. NADH의 1mM, 1 MM FMN, 1 MM MgSO 4, 0.01 브이 / v 튼 X-100을 추가합니다.
  11. 25 ML 폐쇄 캡 플라스크에서 6 ML aliquots를 준비합니다.
  12. 세포 추출물의 충분한 양을 (브래드 포드 assays, 5 MG 단백질 / L​​의 최종 농도에 따라 달라집니다)를 추가합니다. 노 단백질 제어를 준비합니다.
  13. 최적의 전자에 60 ° C (에 품다24 시간 용) 활동 nzymatic.
  14. 에틸 아세테이트하여 문화 미디어의 탄화수소를 추출하여 가스 크로마토 그래피 (프로토콜 3 참조)에 의해 세포 배양의 탄화수소 농도를 결정한다.
  15. 총 단백질에 의해 변환 alkane의 총 금액을 나누어 바이오 매스의 단위 당 저하를 계산은 각 플라스크 (브래드 포드 보정 곡선에 의해)에 추가되었습니다. 또한 실험 기간으로 나누어은 시간 단위 당 세포 단백질의 단위 당 저하 활동을 산출. 평균은 세 개인 점에서 가져옵니다.

4. 에틸 아세테이트 탄화수소 추출 및 농도 측정

  1. Alkanes은 6 ML 실험 용액에 2.5 ML 에틸 아세테이트 (apolar solvant)를 추가하여 수용액에서 추출됩니다. 내부 표준은 0.1 %의 농도 (V / V)에서 용매에 추가됩니다. 표준 (예 : cyclo-decan) 관심 봉우리의 예상 범위에 따라 다양.
  2. 옵션 : 추가 튼수성 혼합물에 X-100과 적절한 이중 phasic 시스템을 위해 4,000 rpm에서 10 분 동안 샘플을 원심 분리기.
  3. 소용돌이 두 단계 분리 될 때까지 5 초 (1,500 RPM)와 실온에서 배양을위한 혼합.
  4. 유기 층 (상단)의 최대 양을 제거하고 무수 마그네슘 황산염을 사용하여 용매를 건조.
  5. 여과 (0.2 μm)로 MgSO 4를 제거하고 -20 ° C.에있는 측정을위한 가스 크로마토 그래프 용 시험관에 여과, 또는 상점을 전송할
  6. CP-SIL 5CB 열 (길이 = 5m)를 사용하여 가스 크로마토 그래피에 의한 농도를 결정합니다. (1시 10분, 230 ° C) 분할 모드에서 샘플의 10 μl를 삽입. 1 ML / 분 (헬륨)에 열 가스의 흐름을 설정합니다. 다음 오븐 온도 프로그램이 사용됩니다 :
    온도 [° C] 시간 [분]
    0 50 7.5
    50 90 1.0
    50 110 2.0
    50 130 2.0
    50 145 2.0
    50 160 2.0
    50 170 2.0
    50 185 2.0
    50 210 2.0
    50 250 2.0
    50 320 2.0
  7. 봉우리를 통합하고 내부 표준과 관련하여 농도를 수정합니다.

5. 알코올 / 알데히드 탈수소 효소 활동 분석

이 분석은 가토 외에 기술 된 방법에 따라 기본적으로 수행되었다.(2010).

  1. 문화 E. ADH (표현 대장균 세포 BBa_K398018 ) 또는 ALDH ( BBa_K398030 ) 유전자와 빈 벡터 (들고 세포 BBa_J13002을 하루 아침에 적절한 항생제로 50 ML의 LB 매체에를).
  2. 신선한 LB의 50 ML (항생제 포함)에 밤 문화를 500 μl를 전송하고 세포 탁도가 600 나노 미터에서 0.6의 광학 밀도에 도달 할 때까지 품다.
  3. 4 ° C에서 4,000 rpm으로 10 분 원심 분리기 50 MM 트리스 버퍼의 5 ML에 펠렛을 resuspend.
  4. 4 출력 제어 (sonication 동안 얼음에 솔루션을 유지)와 40 % 듀티 사이클에서 셀 솔루션을 Sonicate.
  5. ° C는 세포 파편을 제거하기 위해 4에서 4,000 rpm으로 5 분의 결과 혼합물을 원심 분리기.
  6. 로를 결정(: 단백질 바인딩을 방지하기 위해 유리관을 사용 주) 브래드 퍼드 분석하여 세포 추출물의 할거야, 단백질 농도.
  7. 180 μl 57 MM 글리신 버퍼는 각 우물에 NAD를 (최종 농도 1 ㎜, 산도 9.5)이 포함 된과 96 잘 접시를로드합니다.
  8. 우물에 테스트 할 수있는 알코올 (알데히드)의 5 μl를 추가합니다. 참고 : 액체를 가지고 할 수있는 분석의 시작 전에 열 긴 사슬 알코올. 각 주류 (알데히드) 기판없이 제어 (대조군) 추가해야합니다. 또한, 세포 추출물없이 버퍼와 기판의 혼합물을 포함하는 빈을 준비합니다.
  9. 앞서 열을 가하다 37 번 15 분을위한 플레이트 리더 (Tecan 마젤란 v7.0)의 판 ° C 시스템의 평균을 허용 할 수 있습니다.
  10. 세포 추출물의 충분한 양을 (브래드 포드 assays, 5 MG 단백질 / L​​의 최종 농도에 따라 달라집니다)를 추가합니다. 노 단백질 제어를 준비합니다.
  11. 340 nm의 파장 37 번 1 시간마다 2-3 분 ° C. <에서 분광 광도계를 사용하여 NADH 생산을 측정/ 리>
  12. OD (340 nm 정도)의 경사면에서 NADH 생산 속도를 계산할 수 있습니다. 계정으로 빛 경로 길이 6,220 M -1 cm -1의 NADH의 흡광 계수보십시오. 단백질의 총 양에 의해 NADH 생산 속도를 나눈다는 세포 추출물에서 탈수소 효소 반응 (U / MG 전체 세포 단백질)의 활동을 표현하는 추가되었습니다. 평균 세 독립 실행에서 표준 편차를 계산합니다.

6. pCaiF 특성

  1. 문화 E. pCaiF-GFP 구조 (표현 대장균 세포 BBa_K398331 )와 단둘이 발기인 (운반 세포 BBa_K398326를 적절한 항생제 박 5 ML의 LB 매체에 하룻밤 정도).
  2. 5 ML M9는 밤 문화의 50 μl를 10g / L 포도당과 항생제를 포함하는 예방하고 하루 아침에 성장합니다. 밤새 가지의 하위 문화 50 μl 신선한 M9 with10 g / L 및 배양의 5 ML에는 세포 탁도는 600 nm의에서 0.2의 광학 밀도에 도달 할 때까지.
  3. 각 우물에 테스트 탄소 소스의 원하는 금액을 포함하는 새로운 M9 매체 100 μl와 96 잘 판을로드합니다. 통계 평가를위한 세중의 실험을 수행하고 각각의 부정적인 컨트롤을 (야생 형 대장균 K12)를 추가합니다.
  4. 매체가 포함 된 우물에 밤 문화의 5 μl를 추가합니다.
  5. 성장 곡선 (OD 600)와 플레이트 리더를 사용하여 GFP 형광 (485 나노 미터 여기와 520 방출) 37 18 시간마다 10 분 ° C 일정한 진동과를 측정합니다.
  6. 성장 속도와 각각의 측정에서 특정 GFP 내용을 계산하고 컨트롤에 비교합니다. 평균 적어도 세 독립적 인 실험의 표준 편차를 계산합니다.

7. 공차 분석

  1. 문화대장균은 PhPFDα와 β 유전자 (표현 BBa_K398406를 5 ML의 LB 매체와 적절한 항생제에 밤새). E.는 라다 유전자 (표현 대장균 BBa_K398017가 ) 대조군으로 사용됩니다.
  2. 신선한 5 LB의 ML (항생제) 및 배양에 밤새 가지의 하위 문화 10 μl의 세포 탁도는 600 nm의에서 0.4-0.3의 광학 밀도에 도달 할 때까지.
  3. 이 0.1의 OD 600에 도달 할 때까지 새로운 매체 문화를 희석.
  4. 적절한 항생제와 세중의에 독성 화합물 (예 : 0, 4, 8, N-헥산의 10 %)의 적절한 최종 농도를 포함하는 180 μl M9 매체와 96 잘 판을로드합니다. alkane - 물 혼합물은 2 단계 시스템으로 이어질 수 있기 때문에 (예 : D 번호판의 적절한 컨트롤을 가지고 필수적입니다ifferent 긴장하고 각각의 빈 실험).
  5. 우물에 문화의 20 μl (제어)를 추가합니다.
  6. 지속적인 진동과 판 독자에게 37에서 24 시간마다 10 분 ° C를 사용하여 바이오 매스 농도 (OD 600) 측정합니다.
  7. 다른 에이전트 농도에 대한 각각의 측정에서 성장 속도를 계산하고 부정적인 컨트롤에 비교할 수 있습니다. 평균 적어도 세 독립 실행의 표준 편차를 계산합니다.

8. 상 동체 상호 작용 매핑

  1. 이 응용 프로그램 HIM은 STRING 데이터베이스 (학술 사용하기 위해 무료) 20을 실행하는 PostgreSQL 서버에 단백질 쿼리를 수행하기 위해 개발되었습니다. homologue 상호 작용 매핑 응용 프로그램은 STRING 데이터베이스를 사용하여 원래의 호스트 유기체에서 상호 작용하는 단백질을 식별합니다. 각각의 상호 작용 유전자의 시퀀스는 대상 생물의 상동 유전자를 찾기 위해 BLAST 검색에 사용됩니다. Cytoscape 4 https://github.com/jcnossen/InteractionHomologMapping.
  2. 매핑을 수행하려면 (1) BioBrick의 ID를 입력하고 응용 프로그램은 자동으로 표준 생물학 부품 9, 또는 응용 프로그램의 (2)를 입력 (붙여 넣기) 시퀀스 데이터의 레지스트리에서 일부 순서 데이터를 다운로드합니다.
  3. 입력 된 아미노산 서열에 대한 STRING 단백질 ID를 찾을 수 STRING 데이터베이스 웹 사이트를 사용합니다.
  4. 높은 호몰 로지와 단백질은 BLAST를 사용하여 결정됩니다. 이후 응용 프로그램은 호스트 유기체의 homologs (예 : 대장균)의 소스 유기체와 검색에 각 알려진 상호 작용하는 단백질을 보여줍니다.
  5. 텍스트 또는 Cytoscape에 결과 putative 상호 작용 목록을 내 보냅니다.

Discussion

BioBrick의 원리는 alkanes의 저하에 대한 섀시를 만드는 데 사용되며 툴킷의 단일 구성 요소에 대한 원칙의 증명 얻은 것입니다. 여러 assays는 생체과 alkane 굴욕 경로의 효소의 체외 활동에 측정하기 위해 제안합니다. 제시 작업은 성공적으로 호스트 유기체 E.의 효소 활동과 표현을 결정하는 데 사용할 수있는 방법의 수를 보여줍니다 적절한 BioBricks를 구현 한 후 대장균. 또한,이, BioBrick의 원칙은 alkanes의 저하에 필요한 단백질을 표현하는 유전자를 디자인하는 데 사용할 수있는 것으로 나타 이러한 효소를 생산하는 규제 시스템을 제공하는 경우에만 필요하고 augments 탄화수소의 존재의 호스트 유기체의 허용 오차 . 일단 추가로 개발,이 섀시는 물을 미행 오일 샌드에서 예를 들어, 잔류 오일의 생물 저하에 사용 할 수, 또는 치료를위한석유 산업에서 폐수의.

alkane의 저하에 관해서으로, assays는 alkane 저하의 첫 번째 단계 (AH-시스템과 라다)에 관련된 효소의 특성에 대해 수행되었다. 그것은 입증 된 그 E. 대장균은 Gordonia SP의 AH 시스템을 들고 변형. TF6는 생체에 옥탄가를 변환 할 수있었습니다.이 발견은 후지 동부 표준시의 결과와 합의에 있습니다. 알. 8, N-alkanes의 biotransformation는 E.를 사용하여 AH-시스템의 최소 구성 요소 유전자를 표현 대장균이 달성되었습니다. 전환 활동은 주어진 시간 후 비교 연구 (wildtype 대 돌연변이)에 의해 측정되었다. 전체 특성화를 들어, 추가 연구 시간과 시스템의 동력학을 통해 AH 시스템의 활동에서 수행해야합니다.

장쇄 alkanes (C 15-C 36), Geoba에서 라다 유전자의 전환에 대한cillus의 thermodenitrificans이 구현되었습니다. 효소 활동은 긴 사슬 탄화수소 소스로 hexadecane을 사용하여 체외에서 테스트되었습니다. 이 수정 E. 대장균의 변종이 제어 변형에 비해 증가 효소 활동을 보여 주었다, 재조합 라다 단백질을 보여주는 것은 E.에 의한 hexadecane의 전환을 가능하게 대장균. 변환 alkanes의 재산과 더불어 alkanols, E.에 대장균의 변종는 각각 ADH와 ALDH 유전자의 구현에 의해 알코올과 aldehydes위한 개선 된 열화 과정 개발되었다. 세포 추출물의 효소 활동은 NAD +에서 NADH의 생산을 측정하여 체외에서 테스트되었습니다. E. ADH을 표현 대장균의 변종은 야생 유형의 활동에 비해 알코올 탈수소 효소 활동의 두 배 증가를 보여 주었다. 제어 변형에 비해 ALDH 단백질의 표현은 E.에 dodecanal 탈수소 효소의 활동을 증가 대장균의 cel난 3 배를 추출합니다. 명확하게 입증이 assays는 체외에서 효소의 활동을 증가 때문에 추측 할 수있는 변형 E. 대장균의 변종들도 생체 활동의 높은 수준을 갖추고 있습니다.

호스트 유도 표현 (예 : 유도 화학 물질 및 성장 중에 낮은 부담에 대한 비 의존성)의 가능성을 탐험하려면 열화 경로는 pCaiF 프로모터의 제어에 따라 표현되었다. 포도당 수준이 낮은, 예를 들어 때이 발기인은 유전자 발현을 활성화한다. 배치 성장 단계의 끝에서. 원칙의 증명 하듯이, 발기인은 차이 포도당 체제에 따라 GFP의 생산을 통해 테스트되었습니다. 이 pCaiF-GFP는 E. 변화를하는 입증 된 대장균은 기하 급수적 단계 (높은 혈당 수준)에 비해 고정 (포도당 제한적) 단계에서 더 많은 GFP를 생산. 보조 탄소 소스의 면전에서 (예를 들면. 라 우르 산), GFP 생산 속도는 AG 감소보조 탄소 소스의 catabolism에 의해 아니야.

실험이 발기인이 효과적으로 새로운 열화 경로로 포도당에서 catabolic 교대를 활성화하는 데 사용할 수 있습니다 것으로 나타났다. 이 저하 경로가 활성화되기 전에 빠르게 풍부한 매체에 생물의 광대 한 양의 성장을 할 수 있습니다. 우리는 pCaiF업자에게 상류 AlkS 전사 조절기를 사용하여 제안합니다. 모나스 putida에서 AlkS 5-C 10 N-alkanes effectors로 C를 인식합니다. AlkS-alkane 복합 이후 높은 수준 지방산 19 N-alkanes의 전환에 관여 alkBFGHJKL 오페론 인코딩 단백질의 표현의 결과로 PalkB 발기인을 활성화합니다.

셀 가능한 것으로에 대한 감지와 탄화수소의 전환이 충분하지 않습니다. 환경에서 증가 탄화수소 수준에서, 야생 유형 E.의 성장 대장균은 하이드로의 존재를 저해된다단백질 misfolding을 일으킬 수있는 막과 세포의 탄소. P. horikoshii prefoldin는 alkanes 17의 존재에 단백질의 정확한 접이식을 돕기 자야입니다. 그를 사용하면,이 단백질은 상 동체 E.와 상호 작용하는 것으로 예측되었다 E.의 prefoldin의 overexpression을 제안 대장균의 보호자 단백질, 대장균은 용매 내성을 향상 수 있습니다. BioBrick으로 BBa_K398406 (phPFDαphPFDβ 유전자로 구성된), E.의 survivability alkanes의 존재의 대장균은 50 %까지 향상되었다. 그 사람은 잠재적 인 기능 homologs를 선택하는 적절한 도구입니다.

전체 도구 상자 고려, 그것은이 수성 환경에서 탄화수소의 bioremediation을위한 섀시의 건설에 첫 걸음을 제공하는 결론을 내렸다 할 수 있습니다. 이 대표하는, 작은 자치, 자기 복제 및 Relatively 저렴한 방법입니다. 결과는 주로 효소 assays를 통해 획득과 플래시 문화를 흔들어서 따라서 큰 규모 검증 할 필요가 있었다. 이 시스템에 대한 자세한 연구는 탄화수소 저하에 대한 구상 시스템을 생성하기 위해 개별적으로 작동하도록 여기에 표시되어있는 다양한 효소의 커플 링에 초점을해야합니다. 또한, 다른 오염 물질의 저하에 대한 대체 경로의 추가도 오염 물질의 넓은 범위에 혼자 탄화수소의 bioremediation 넘어이 섀시의 사용을 확장 할 수 있으며, 가능한 제품 경로의 구현도의 생산을위한이 시스템을 활용 수 귀중한 화학 물질. 우리의 결과는 석유 오염 처리 할 수​​ 있으며, 추가로 다른 응용 프로그램의 다양한 개발하는 것이 유용 할 수 있습니다 새로운 생물체를 구성하는 합성 생물학에 BioBricks 조립 전략의 적합성을 강조한다.

Disclosures

관심 없음 충돌이 선언 없습니다.

Acknowledgments

이 비디오 문서에 수행 실험은 국제 유전 공학 기계 대회 9 개발되었다. 저자는 대한 iGEM 팀 회원 눅 Bergwerff, 에테르 TM 반 Boheemen, Jelmer Cnossen, 휴고 F. 쿠에 토 로자 스와 라몬 반 데르 Valk을 감사드립니다 연구 지원. 우리는 도움이 토론이 연구를 호스팅 한 데 Winde, 스테판 드 콕과 Esengül Yıldırım 감사드립니다. 이 작품은 생명 공학의 TU 델프트 대학과, 델프트 생물 정보학 연구실, Bionanoscience의 TU 델프트 (Delft)과, 오일 샌드 리더십 이니셔티브 (OSLI), 스터드 studentenuitzendbureau, 네덜란드 유전체학 이니셔티브, Kluyver 센터, Nederlandse Biotechnologische Vereniging (에는 Stichting 생명 공학 네덜란드)에 의해 지원되었다 , DSM, Geneart, Greiner 바이오 하나 Genencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics