Инструментарий, позволяющий конверсии углеводородов в водной среде

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Устойчивое авто регулирующих бактериальные системы для восстановления нефтяных загрязнений была разработана с использованием стандартных взаимозаменяемых частей ДНК (BioBricks). Инженерии

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Эта работа выдвигает набор инструментов, который позволяет превращения алканов кишечной палочки и представляет собой доказательство принципа его применимости. Оно состоит из нескольких стандартных взаимозаменяемых частей (BioBricks) 9 адресации преобразования алканов, регуляции экспрессии генов и выживания в токсичные богатой углеводородами окружающей среды.

Трехступенчатый путь к деградации алкана был реализован в E. палочки для того, чтобы преобразования средне-и долгосрочной цепи алканов в соответствующие спирты, alkanals и в конечном итоге алкановых кислот. Последние были усвоены через родной β-окисления пути. Для облегчения окисления средней цепи алканов (C5-C13) и циклоалканов (С5-С8), четыре гена (alkB2, rubA3, rubA4 и Rubb) из алкана системы гидроксилазы от Гордония зр. TF6 8,21 были преобразованы в E. палочки. Для преобразованиядлинной цепи алканов (С15-С36), ген ЛАДА Geobacillus thermodenitrificans был реализован. Для необходимые дальнейшие шаги процесса деградации, АДГ и ALDH (исходящие из G. thermodenitrificans) были введены 10,11. Деятельность измеряли отдыха анализов клеток. Для каждого окислительного шаг, активность фермента не наблюдалось.

Для оптимизации эффективности процесса, выражение было только индуцированных в условиях низкой глюкозы: субстрат-регулируемого промотора, pCaiF, был использован. pCaiF присутствует в E. палочки K12 и регулирует экспрессию генов, участвующих в деградации неглюкозными источников углерода.

В последней части инструментария - таргетинг выживания - был реализован с использованием растворителя генов толерантности, PhPFDα и β, как с Pyrococcus horikoshii OT3. Органические растворители могут вызывать клеточный стресс и снижение живучести отрицательно affectinг сворачивания белка. В качестве сопровождающих, PhPFDα и β улучшения сворачивания белка, например, процесс в рамках присутствии алканов. Экспрессии этих генов привела к улучшению толерантности углеводородного показали повышение темпов роста (до 50%) в присутствиях 10% н-гексана в культуральной среде не наблюдается.

Подводя итоги, результаты показывают, что инструментарий позволяет E. палочки для преобразования и терпеть углеводородов в водной среде. Как таковая, она представляет собой первый шаг на пути устойчивого решения для нефти реабилитации с использованием синтетического подхода биологии.

Protocol

1. BioBrick Ассамблеи

  1. BioBricks из реестра стандартной биологической части осуществляется ИГЕМ штаб-квартиры. Чтобы построить новую BioBrick из существующих BioBricks, переварить доноров BioBrick (до 1,0 мкг) с ферментами EcoRI и SpeI для размещения донора частью вниз по течению от акцепторной части. Дайджест с XbaI и PstI для размещения донора частью вверх по течению от акцепторной части. Добавьте третий соответствующего фермента рестрикции, что сокращение в основу донора. Выполните пищеварения в общем объеме 20-25 мл с соответствующим буфером, в соответствии с поставщика (конечная концентрация 1x). Используйте 5 единиц / мкг ДНК для ферментов рестрикции.
  2. Дайджест акцептора BioBrick либо EcoRI и XbaI или SpeI и PstI.
  3. Инкубируйте пищеварения (по крайней мере) один час при температуре 37 ° C. Деактивировать рестрикции тепла, инкубации при 80 ° С в течение 10 мин и центрифуги в ближайшее время.
  4. Лигируют переваривается BioBrickчастей (доноров и акцепторов) вместе. С XbaI и SpeI создания совместимых концы ДНК, смешанной сайт создан, которые не могут быть сокращены с любым ферментов рестрикции в результате новой "объединенной" BioBrick, что в окружении 4 стандартных сайты рестрикции. В лигирования смеси конечной концентрации ДНК предпочтительно ~ 100 нг / мкл. Выполните реакции лигирования в общем объеме 10-15 мл с T4 буфера лигирования (конечная концентрация 1x) и лигазы Т4 (1 ед / мкг ДНК).
  5. Инкубируйте перевязки смеси при 16 ° C в течение не менее 3 часов.
  6. Выполнить преобразование реакцию с около половины лигирования смеси.
  7. Подтвердите BioBrick правильной последовательности с.
  8. Чтобы построить новую BioBrick от синтезированную ДНК, изменить гены для синтеза для оптимальной экспрессии в E. палочка с помощью JCat инструмент веб-сайте ( http://www.jcat.de/ ). Проведение дальнейших модификаций в соответствии с требованиями B ioBrick стандарта. Эта стандартизация подразумевает, что каждый BioBrick состоит из последовательности ДНК интерес префикс и с суффиксом. Префикс и суффикс-последовательности, которые содержат предопределенные сайты рестрикции, которые отсутствуют в остальных плазмиды последовательности. Эти стандартные сайты рестрикции позволяет поменять и продлить BioBrick вставляет гибко 9. Префиксов и суффиксов имеют следующую последовательность:
Имя Последовательность Комментировать
Префикс 5 'GAATTCGCGGCCGCTTCTAG3 "
5 'GAATTCGCGGCCGCTTCTAGAG 3' Если следующие части кодирующей последовательности или любой его части, которая начинается с "ATG"
Суффикс 5 'TACTAGTAGCGGCCGCTGCAG 3'
ove_title "> 2. Alkane преобразования отдыха анализа Cell, In Vivo

Этот анализ проводился на основе метода, описанного Фуджи и соавт. (2004).

  1. Культура E. кишечной клетки, экспрессирующие Alkane системы гидроксилазы ( BBa_K398014 ) и клеток, несущих пустой вектор ( BBa_J13002 ) в 5 мл LB среде с соответствующими антибиотиками в течение ночи.
  2. Передача 500 мкл ночной культуры в 50 мл свежей LB (с антибиотиком) и инкубировать до ячейки мутности достигли OD (оптической плотности) 0,3 при 600 нм.
  3. Центрифуга в течение 10 мин при 4000 оборотах в минуту и ​​ресуспендируют осадок в 5 мл 0,1 М фосфатного буфера (рН 7,4).
  4. Центрифуга в течение 10 мин при 4000 оборотов в минуту и ​​ресуспендируют осадок в 5 мл 0,1 М фосфатного буфера теперь содержащих E2 соли и 0,66% объем / объем глицерина (азот deficienт среде).
  5. Измерьте клетки мутности (OD 600).
  6. Подготовка клетки смеси аликвоты 6 мл в 25 мл закрытой крышкой стеклянной колбы и не-клеточных элементов управления (E2 соли + 0,66% объем / объем глицерина).
  7. Добавить 100 нмоль алканов в каждую колбу.
  8. Инкубируйте смеси при 37 ° С в течение 24 ч (укоротить, когда более высокие темпы получены).
  9. Измерьте OD 600 после инкубации.
  10. Извлечение углеводородов в культуре средств массовой информации в этилацетат и определения концентрации углеводородов в культуре клеток с помощью газовой хроматографии (см. протокол 3).
  11. Рассчитать деградации на единицу биомассы путем деления общей суммы алканов преобразуется общего настоящее биомассы в каждой колбе (конвертировать OD 600 на сухой вес). Разделив результат на экспериментальной продолжительность приводит к деградации активность на единицу биомассы в единицу времени. Средняя берется из трех отдельных трасс.

3. Alkane преобразования ферментов анализа, вVitro

Этот анализ был выполнен по существу в соответствии с методом, описанным Li и соавт. (2008).

  1. Культура E. кишечной клетки, экспрессирующие ген Lada ( BBa_K398017 ) и клеток, несущих пустой вектор ( BBa_J13002 ) в 50 мл LB среде с соответствующими антибиотиками в течение ночи.
  2. Передача 500 мкл ночной культуры в 50 мл свежей LB (с антибиотиком) и инкубировать до ячейки мутности достигли оптической плотности 0,6 при 600 нм.
  3. Центрифуга 10 мин при 4000 оборотов в минуту (4 ° C) и ресуспендируют осадок в 5 мл 50 мМ Трис буфера.
  4. Разрушать ультразвуком (Cell разрушитель, LA Biosystems) клеток на 40% рабочий цикл с выходом управления 4, держать раствор на льду в течение всего срока.
  5. Центрифуга полученную смесь в течение 5 мин при 4000 оборотов в минуту на 4 и Dнапример, C для удаления остатков клеток. Передача супернатант в чистую пробирку.
  6. Определение общей концентрации белка в клеточных экстрактах с помощью анализа Брэдфорда. Примечание: используйте стеклянные флаконы, чтобы предотвратить увеличение фона и / или потерю белка.
  7. Подготовьте 100 мл смеси, содержащей 0,1% об / об алкана и 50 мМ Трис-HCl буфера.
  8. Смесь нагревают при 100 ° С в течение 5 мин. Примечание: Выполните этот шаг только для средне-длинной цепи алканов с высокой температурой кипения. (Например, C 16: 287 ° C).
  9. Для достижения оптимальной растворимости алканов, разрушать ультразвуком в течение 1 мин в то же время теплым до получения однородной, вязкой смеси.
  10. Добавить 1 мМ НАДН, 1 мМ FMN, 1 мМ MgSO 4 и 0,01 о / Triton X-100.
  11. Подготовить 6 мл аликвоты в 25 мл закрытой крышкой колбы.
  12. Добавить достаточного количества клеточного экстракта (в зависимости от анализов Брэдфорд, конечная концентрация 5 мг белка / л). Подготовка нет белка контроль.
  13. Инкубировать при 60 ° C (для оптимального электроннойnzymatic деятельности) в течение 24 часов.
  14. Извлечение углеводородов в культуре средств массовой информации в этилацетат и определения концентрации углеводородов в культуре клеток с помощью газовой хроматографии (см. протокол 3).
  15. Рассчитать деградации на единицу биомассы путем деления общей суммы алканов преобразуется общего белка добавляли к каждой колбе (по калибровочной кривой Bradford). Дальнейшее деление на продолжительность эксперимента приводит к деградации активность на единицу клеточного белка в единицу времени. Средняя берется из трех отдельных трасс.

4. Этиловый ацетат добычи углеводородов и измерения концентрации

  1. Алканы извлекают из водного раствора путем добавления 2,5 мл этилацетата (аполярная solvant) до 6 мл экспериментального решения. Внутренний стандарт добавляется в растворитель при концентрации 0,1% (V / V). Стандарт (например, цикло-декан) варьируется в зависимости от ожидаемого диапазона пики интереса.
  2. Дополнительно: Добавить TritonX-100 к водной смеси и центрифуги образцов в течение 10 мин при 4000 оборотов в минуту для того, чтобы получить надлежащее двухфазной системе.
  3. Vortex смесь в течение 5 секунд (1.500 оборотов в минуту) и инкубировать при комнатной температуре до двух фаз отдельно.
  4. Удалить максимальное количество органического слоя (вверху) и высушить растворитель с использованием безводного сульфата магния.
  5. Удалить MgSO 4 путем фильтрации (0,2 мкм) и передать фильтрата в газе флаконы хроматограф для измерения или хранить при -20 ° C.
  6. Определить концентрацию газовой хроматографии с использованием CP-SIL 5ЦБ колонка (длина = 5 м). Inject 10 мкл образца в режиме разделенного (1:10, 230 ° C). Установить потока газа в колонке 1 мл / мин (гелий). В следующей программе температуры печи используются:
    Скорость Температура [° C] Время [мин]
    0 50 7,5
    50 90 1,0
    50 110 2,0
    50 130 2,0
    50 145 2,0
    50 160 2,0
    50 170 2,0
    50 185 2,0
    50 210 2,0
    50 250 2,0
    50 320 2,0
  7. Интеграция пики и исправить концентрации по отношению к внутреннему стандарту.

5. Алкоголь / альдегиддегидрогеназы деятельности пробирного

Этот анализ был выполнен по существу в соответствии с методом, описанным Kato и соавт.(2010).

  1. Культура E. кишечной клетки, экспрессирующие АДГ ( BBa_K398018 ) или ALDH ( BBa_K398030 ) генов и клеток, несущих пустой вектор ( BBa_J13002 ) в 50 мл LB среде с соответствующими антибиотиками в течение ночи.
  2. Передача 500 мкл ночной культуры в 50 мл свежей LB (с антибиотиком) и инкубировать до ячейки мутности достигли оптической плотности 0,6 при 600 нм.
  3. Центрифуга 10 мин при 4000 оборотов в минуту при температуре 4 ° C и ресуспендируют осадок в 5 мл 50 мМ Трис буфера.
  4. Разрушать ультразвуком клетки решения при 40% рабочего цикла с выходом управления 4 (держать раствор на льду во время обработки ультразвуком).
  5. Центрифуга полученную смесь в течение 5 мин при 4000 оборотов в минуту при температуре 4 ° С для удаления остатков клеток.
  6. Определите дляТаль концентрации белка клеточных экстрактов по Бредфорда (Примечание: использовать стеклянный флакон для предотвращения связывания с белками).
  7. Загрузите 96-луночный планшет с 180 мкл 57 мМ глицина буфер, содержащий NAD (конечная концентрация 1 мМ, рН 9,5) в каждую лунку.
  8. Добавьте 5 мкл спирта (альдегид), которые будут проверены на скважинах. Примечание: Тепло спирты с длинной цепью до начала анализа, чтобы жидкость. Для каждого спирта (альдегид) управление без подложки должна быть добавлена ​​(отрицательный контроль). Кроме того, подготовить пустой, содержащий смесь буфера и подложки без клеточного экстракта.
  9. Подогрейте тарелки ридер (Tecan Magellan v7.0) в течение 15 мин при 37 ° C, чтобы равновесие системы.
  10. Добавить достаточного количества клеточного экстракта (в зависимости от анализов Брэдфорд, конечная концентрация 5 мг белка / л). Подготовка нет белка контроль.
  11. Измерьте NADH производства с использованием спектрофотометра при длине волны 340 нм каждые 2-3 мин в течение 1 часа при 37 ° C. </ Li>
  12. Рассчитать NADH дебит по наклону OD (340 нм). Примите во внимание длину пути света и коэффициента экстинкции NADH из 6220 М -1 см -1. Разделите NADH уровень добычи на общее количество белка добавил, чтобы выразить активность дегидрогеназы реакции в клеточный экстракт (U / мг общего белка клетки). Рассчитать среднее и стандартное отклонение от трех независимых трасс.

6. Характеристика pCaiF

  1. Культура E. кишечной клетки, экспрессирующие pCaiF-GFP конструкции ( BBa_K398331 ) и клеток, несущих промоутером в одиночку ( BBa_K398326 ) в течение ночи в 5 мл LB среднего соответствующими антибиотиками в течение ночи.
  2. Инокулировать 5 мл M9, содержащей 10 г / л глюкозы и антибиотиков с 50 мкл ночной культуры и расти в течение ночи. Субкультура 50 мкл в течение ночи результатом в 5 мл свежего M9 с 10 г / л и инкубировать до ячейки мутности достигли оптической плотности 0,2 при 600 нм.
  3. Загрузите 96-луночный планшет с 100 мкл свежей среды M9 содержащие необходимое количество источника углерода для тестирования в каждую лунку. Выполните трех экземплярах экспериментов для статистической оценки и добавить соответствующий отрицательный контроль (дикого типа E.coli К12).
  4. Добавьте 5 мкл ночной культуры в среде, содержащей скважин.
  5. Измерьте кривой роста (OD 600) и флуоресценции GFP (485 нм возбуждения излучения и 520), используя ридер каждые 10 мин в течение 18 ч при температуре 37 ° C с постоянной тряски.
  6. Рассчитать скорость роста и конкретного содержания GFP из соответствующих измерений и сравнить с управлением. Рассчитать среднее и стандартное отклонение по крайней мере трех независимых экспериментах.

7. Толерантность анализа

  1. КультураE.coli, выразив PhPFDα и β гена ( BBa_K398406 ) в течение ночи в 5 мл среды LB и соответствующие антибиотики. Е. палочки выражения Лада гена ( BBa_K398017 ) используется в качестве отрицательного контроля.
  2. Субкультура 10 мкл ночь вырост на свежий 5 мл LB (с антибиотиком) и инкубировать до ячейки мутности достигли оптической плотности от 0,3 до 0,4 при 600 нм.
  3. Развести культур со свежей среде до OD 600 в 0,1 достигнут.
  4. Загрузите 96-луночный планшет с 180 мкл среды M9 содержащей соответствующие антибиотики и надлежащего конечной концентрации токсичных соединений (например, 0, 4, 8, 10% н-гексан) в трех экземплярах. Потому что алканов смесей воды может привести к двухфазных системах, необходимо иметь соответствующие элементы управления на тарелку (например, Different штаммов и соответствующих пустых экспериментов).
  5. Добавить 20 мкл культуры (контроля) в лунки.
  6. Измерение концентрации биомассы (OD 600) использованием ридер каждые 10 мин в течение 24 ч при температуре 37 ° C с постоянной тряски.
  7. Рассчитайте темпы роста от соответствующих измерений для различных концентрациях агента и по сравнению с отрицательным контролем. Рассчитать среднее и стандартное отклонение по крайней мере трех независимых трасс.

8. Взаимодействие карт гомолога

  1. Приложение HIM была разработана для выполнения белком запросов PostgreSQL сервер баз данных STRING (бесплатно для академического использования) 20. Отображение гомолог взаимодействия приложение определяет взаимодействующих белков в оригинальной организма-хозяина, используя строку базы данных. Последовательности соответствующих генов взаимодействуют используется в доменной поиска, чтобы найти гомологичных генов в целевой организма. Cytoscape 4 https://github.com/jcnossen/InteractionHomologMapping.
  2. Чтобы выполнить отображение (1) ввести ID BioBrick и приложение будет автоматически загружать часть последовательности данных из реестра стандартной биологической части 9, или (2) Введите (паста) последовательность данных в приложении.
  3. Использование веб-сайта STRING баз данных, чтобы найти ID STRING белка для введенного аминокислотной последовательности.
  4. Белка с высокой степенью гомологии определяется с помощью BLAST. Впоследствии приложение содержит список всех известных белков, взаимодействующих в организме источников и поиска гомологов в организме хозяина (например, кишечная палочка).
  5. Экспорт в результате предполагаемого списка взаимодействия с текстом или Cytoscape.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Принцип BioBrick используется для создания шасси для деградации алканов и доказательство принципа для отдельных компонентов набора инструментальных средств было получено. Несколько анализов предлагается измерять в естественных условиях и в пробирке деятельности алкана ферменты пути. Представленная работа успешно демонстрирует ряд методов, которые могут быть использованы для определения активности ферментов и выражения в организме хозяина E. палочка после осуществления соответствующей BioBricks. Кроме того, показано, что принцип BioBrick может быть использована для разработки организма, что выражается белки, необходимые для расщепления алканов, обеспечивает система регулирования, которая производит эти ферменты только в случае необходимости и повышает толерантность организма-хозяина в присутствии углеводородов . После дальнейшего развития, это шасси могут быть использованы для биологического разложения остаточной нефти, например, в нефтяных песков хвостохранилища воды, или для лечениясточных вод от нефтяной промышленности.

Что касается деградации алкана, анализы проводили для характеристики ферментов, участвующих в первом этапе деградации алканов (AH-системы и Lada). Было показано, что E. Штамм проведения AH-системы Гордония зр. TF6 был в состоянии преобразовать октанового в естественных условиях. Эти данные согласуются с результатами Фуджи и др.. ал. 8, где биотрансформации н-алканов использованием E. палочки выражения минимальной гены компонентов AH-системы была достигнута. Преобразование активность измерялась с помощью сравнительного исследования (дикого типа против мутантов) по истечении заданного времени. Для полной характеристики, дополнительные исследования должны быть выполнены на деятельность AH-системы с течением времени и кинетики системы.

Для преобразования длинной цепи алканов (C 15-C 36), ген ЛАДА Geobacillus thermodenitrificans был реализован. Активность фермента была испытана в лабораторных использованием гексадекан как с длинной цепью углеводородных источников. Это изменение E. палочки штамма показало повышение активности ферментов по сравнению с контролем напряжения, демонстрируя рекомбинантного белка Лада обеспечивает преобразование гексадекан Е. палочки. Кроме того, в собственность преобразования алканов в спирты, E. штаммов были разработаны с улучшением процесса деградации для спиртов и альдегидов в результате осуществления АДГ и ALDH гены соответственно. Активность ферментов в клеточных экстрактах был протестирован в лабораторных измерений по производству NADH из NAD +. E. Штамм выражения ADH показали двукратное увеличение в спирте деятельности дегидрогеназы по сравнению с диким видам деятельности. По сравнению с контролем напряжения, экспрессии белка ALDH увеличилось додеканаль активности дегидрогеназы в E. палочки челл извлекает три раза. Так как эти тесты наглядно продемонстрировали увеличилась активность фермента в пробирке, можно предположить, что преобразованная E. штаммов имеют повышенные уровни активности в естественных условиях, а также.

Чтобы изучить возможность хост-индуцированной экспрессии (например: не-зависимость от индукции химических веществ и низкой нагрузки во время роста), деградация пути была выражена под контролем промотора pCaiF. Этот промотор активирует экспрессию генов, когда уровень глюкозы низкий, например. В конце фазы роста партии. В качестве доказательства принципе, это промоутер была протестирована с помощью производства GFP в режимах разница глюкозы. Было показано, что pCaiF-GFP превращается E. палочки производится более GFP при стационарном (глюкозо-ограниченные) фазы, чем в экспоненциальной фазе (высокий уровень глюкозы). При наличии дополнительного источника углерода (например,. Лауриновой кислоты), скорость GFP производство сократилось AGАйн из-за катаболизма вторичного источника углерода.

Эксперимент показал, что этот промотор может быть эффективно использован для включения катаболических сдвигов от глюкозы к новому пути деградации. Это позволяет быстро растут огромное количество организмов в богатой среде до деградации путь активируется. Мы предлагаем использовать промотор pCaiF перед ALKS транскрипционного регулятора. В Pseudomonas putida, ALKS признает C 5-C 10 н-алканов в качестве эффекторов. Впоследствии высокого уровня ALKS-алканов комплекса активации PalkB промоутером в результате чего выражение alkBFGHJKL кодирующих белки оперона участвуют в превращении н-алканов до жирных кислот 19.

Зондирования и конверсии углеводородов недостаточно для ячейки, чтобы быть жизнеспособной. При увеличении углеводородной уровней в окружающей среде, рост дикого типа E. палочки подавляется благодаря присутствию ГЭСуглей в мембране и в клетке, которая может вызвать неправильного сворачивания белка. P. horikoshii prefoldin является сопровождающим помощь правильное сворачивание белков в присутствии алканов 17. Используя его словам, это было предсказано, что этот белок взаимодействует с гомолог E. палочки сопровождающий белки, предполагая, что избыточная экспрессия в E. prefoldin палочка могла бы улучшить растворителя толерантности. С BioBrick BBa_K398406 (состоящий из phPFDα и phPFDβ генах), живучесть E. палочки в присутствии алканов был улучшен до 50%. HIM является подходящим инструментом для выбора потенциальных функциональных гомологов.

Учитывая инструментов в целом, можно сделать вывод, что она представляет собой первый шаг в строительстве шасси для биоремедиации углеводородов в водной среде. Это представляет собой небольшие, автономные, самовоспроизводящиеся и гelatively недорогой метод. Результаты в основном были приобретены через фермент анализы и пожать вспышки культур и, следовательно, должны быть подтверждены в более крупных масштабах. Дальнейшие исследования по этой системе должно быть сосредоточено на связь различных ферментов, которые были показаны здесь, чтобы работать индивидуально с целью создания системы, предусмотренные для углеводородных деградации. Кроме того, помимо альтернативных путей деградации других загрязняющих веществ может также расширить использование этого шасси за пределы биологической очистки углеводородов в покое, чтобы более широкий спектр загрязняющих веществ, и, возможно, реализация продуктов пути могли даже использовать эту систему для производства ценные химические продукты. Наши результаты подчеркивают пригодность стратегии сборки BioBricks в синтетической биологии, чтобы построить новые организмы, которые могут справиться с нефтяным загрязнением, и может дополнительно быть полезны для разработки широкого спектра других приложений.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Нет конфликта интересов объявлены.

Acknowledgments

В экспериментах, проведенных в этом видео-статьи были разработаны для международного генно-инженерных машин конкуренции 9. Авторы хотели бы поблагодарить членов ИГЕМ команды Лука Bergwerff, Питер ван TM Boheemen, Jelmer Cnossen, Hugo F. Куэто Рохас и Рамон ван дер Валк для помощь в исследованиях. Мы благодарим Хан-де-Winde, Стефан де-Кок и Эсенгул Йылдырым за полезные обсуждения и проведения этого исследования. Эта работа была поддержана TU Delft University Отдел биотехнологии, биоинформатика Delft лаборатории, TU Delft департамента Bionanoscience, Oil Sands лидерство Initiative (OSLI), Стад studentenuitzendbureau, Нидерланды Genomics инициативы, Kluyver центр, Biotechnologische Nederlandse Vereniging (Stichting биотехнологии Nederland) , DSM, Geneart, Greiner Bio-One и Genencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics