Een toolkit voor de omzetting van koolwaterstoffen inschakelen in waterige milieus

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Een duurzame auto regelen van bacterieel systeem voor de sanering van olieverontreinigingen werd ontworpen met behulp van standaard verwisselbare DNA delen (BioBricks). Een aangelegde

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Dit werk voert een toolkit die de omzetting van alkanen in staat stelt door Escherichia coli en presenteert een proof of principle van de toepasbaarheid. De toolkit bestaat uit meerdere standaard verwisselbare onderdelen (BioBricks) 9 aanpakken van de omzetting van alkanen, regulatie van genexpressie en overleving in toxische koolwaterstof-rijke omgevingen.

Een drie-stap route voor alkaan afbraak werd in E. coli de omzetting van middellange-en lange-keten alkanen hun respectieve alkanolen, alkanalen en uiteindelijk alkaanzuren-zuren toestaat. Zij werden omgezet via het natieve β-oxidatie pathway. De oxidatie van middellange-keten alkanen (C5-C13) en cycloalkanen (C5-C8), vier genen (alkB2, rubA3, rubA4 en Rubb) van het alkaan hydroxylase systeem Gordonia sp vergemakkelijken. TF6 8,21 werden getransformeerd in E. coli. Voor de omzetting vanlangketenige alkanen (C15-C36), werd het gen van Lada Geobacillus thermodenitrificans uitgevoerd. Voor de vereiste verdere stappen van het afbraakproces, werden ADH en ALDH (afkomstig van G. thermodenitrificans) geïntroduceerd 10,11. De activiteit werd gemeten door rustende cel assays. Voor elke oxidatieve stap, werd de enzymactiviteit waargenomen.

Om het proces te optimaliseren, werd de expressie geïnduceerd onder enige laag glucose omstandigheden: een substraat gereguleerde promoter, pCaiF, gebruikt. pCaiF aanwezig in E. coli K12 en de expressie van de genen betrokken bij de afbraak van niet-glucose koolstofbronnen.

Het laatste deel van de toolkit - targeting overleving - werd uitgevoerd met behulp van oplosmiddel tolerantie genen, PhPFDα en β, beiden uit Pyrococcus horikoshii OT3. Organische oplosmiddelen kunnen induceren cel stress en verminderde overlevingskansen door negatief affecting eiwit vouwen. Zoals chaperones, PhPFDα en β verbeteren eiwit vouwproces bijvoorbeeld in de aanwezigheid van alkanen. De expressie van deze genen geleid tot een verbeterde koolwaterstof tolerantie aangetoond door een verhoogde groeisnelheid (tot 50%) in de aanwezigheid van 10% n-hexaan in het kweekmedium waargenomen.

Samenvattend, de resultaten aan dat de E. toolkit kan coli te zetten en koolwaterstoffen tolereren in waterige omgevingen. Als zodanig is het is een eerste stap op weg naar een duurzame oplossing voor de olie-sanering met behulp van een synthetische biologie aanpak.

Protocol

1. BioBrick Vergadering

  1. BioBricks van de griffie van Standard Biological onderdelen worden geleverd door iGEM hoofdkwartier. In nieuw BioBrick van bestaande BioBricks construeren verteren de donor BioBrick (tot 1,0 ug) met de enzymen EcoRI en Spel voor het positioneren van de donor deel stroomafwaarts van de acceptor deel. Digest met XbaI en PstI voor het positioneren van de donor deel stroomopwaarts van het acceptor gedeelte. Voeg een derde geschikte restrictie-enzym dat knipt in de ruggengraat van de donor. Voer de digesties in een totaal volume van 20-25 ml met de juiste buffer, volgens de leverancier (eindconcentratie 1x). Gebruik 5 eenheden / ug DNA voor restrictie-enzymen.
  2. Digereren van het acceptor BioBrick met ofwel EcoRI en Xbal en Spel en PstI.
  3. Incubeer de vertering gedurende (ten minste) een uur bij 37 ° C. Inactiveren de restrictie-endonucleasen door warmte, incubatie bij 80 ° C gedurende 10 min en kort centrifuge.
  4. Ligeren van het gedigereerde BioBrickdelen (donor en acceptor) samen. Aangezien XbaI en Spel genereren compatibel DNA-uiteinden, wordt een gemengde site gecreëerd die niet kunnen worden gesneden met een restrictie-enzym resulteert in een nieuwe gecombineerde 'BioBrick dat geflankeerd door de vier standaard restrictieplaatsen. In het ligatiemengsel de uiteindelijke DNA concentratie bij voorkeur ~ 100 ng / ul. Voer de ligatiereactie in een totaal volume van 10-15 ml met T4 ligatiebuffer (eindconcentratie 1x) en T4 ligase (1 eenheid / ug DNA).
  5. Incubeer het ligatiemengsel bij 16 ° C gedurende ten minste 3 uur.
  6. Voer transformatie reactie met circa de helft van het ligatiemengsel.
  7. Bevestig de BioBrick juist te zijn met sequencing.
  8. In nieuw te bouwen uit BioBrick gesynthetiseerd DNA, wijzigen de genen voor synthese voor optimale expressie in E. coli via de website JCat gereedschap ( http://www.jcat.de/ ). Verdere wijzigingen in overeenstemming met de vereisten van de B ioBrick standaard. Deze normalisatie impliceert dat elke BioBrick bestaat uit een DNA-sequentie van belang voorafgegaan door een prefix en gevolgd door een suffix. De prefix en suffix zijn sequenties die vooraf restrictieplaatsen, die afwezig zijn in de resterende plasmide volgorde bevatten. Deze standaard restrictieplaatsen maken het mogelijk om wisselen en flexibel uit te breiden de BioBrick inzetstukken 9. Het voorvoegsel en achtervoegsel hebben de volgende sequenties:
Naam Volgorde Commentaar
Voorvoegsel 5 'GAATTCGCGGCCGCTTCTAG3'
5 'GAATTCGCGGCCGCTTCTAGAG 3' Als het volgende deel is een coderende sequentie of een deel dat begint met "ATG"
Achtervoegsel 5 'TACTAGTAGCGGCCGCTGCAG 3'
ove_title "> 2. Alkane Conversie Resting Cell Assay, in vivo

Deze test werd uitgevoerd op basis van de methode beschreven door Fujii et al.. (2004).

  1. Cultuur E. coli cellen die het alkaan Hydroxylase systeem ( BBa_K398014 ) en cellen die een lege vector ( BBa_J13002 ) in 5 ml LB medium met geschikte antibiotica nacht.
  2. Breng 500 pi van de overnacht cultuur in 50 ml vers LB (met antibiotica) en incubeer de cel totdat troebelheid bereikt OD (optische dichtheid) van 0,3 bij 600 nm.
  3. Centrifugeer gedurende 10 min bij 4.000 tpm en resuspendeer de pellet in 5 ml 0,1 M fosfaatbuffer (pH 7,4).
  4. Centrifugeer opnieuw gedurende 10 min bij 4.000 tpm en resuspendeer de pellet in 5 ml 0,1 M fosfaatbuffer nu met E2 zouten en 0,66% v / v glycerol (stikstof tekortkot medium).
  5. Meet de cel troebelheid (OD 600).
  6. Bereid cel-mengsel aliquots van 6 ml in 25 ml gesloten cap kolven en no-cell controles (E2 zouten + 0,66% v / v glycerol).
  7. Voeg 100 nmol van alkaan aan elke kolf.
  8. Incubeer het mengsel bij 37 ° C gedurende 24 uur (verkorten bij hogere verkregen).
  9. Meet de OD600 na incubatie.
  10. Pak de koolwaterstoffen in het kweekmedium door ethylacetaat en bepalen koolwaterstofconcentratie in celkweek met gaschromatografie (zie protocol 3).
  11. Bereken de afbraak per eenheid biomassa door de totale hoeveelheid van alkaan omgezet door de totale biomassa aanwezig in elke kolf (converteren OD 600 tot droog gewicht). Delen door de experimentele duur levert de afbraakactiviteit per eenheid biomassa per tijdseenheid. Het gemiddelde wordt genomen van drie individuele runs.

3. Alkaan Conversion Enzyme Assay, InVitro

Deze test werd in hoofdzaak uitgevoerd volgens de methode beschreven door Li et al.. (2008).

  1. Cultuur E. coli cellen die het gen LADA ( BBa_K398017 ) en cellen die een lege vector ( BBa_J13002 ) in 50 ml LB medium met geschikte antibiotica nacht.
  2. Breng 500 pi van de overnacht cultuur in 50 ml vers LB (met antibiotica) en incubeer de cel totdat troebelheid bereikt een optische dichtheid van 0,6 bij 600 nm.
  3. Centrifugeer 10 minuten bij 4.000 rpm (4 ° C) en resuspendeer de pellet in 5 ml 50 mM Tris buffer.
  4. Ultrasone trillingen (Cell disrupter, LA Biosystems) de cellen bij 40% inschakelduur met een vermogen controle van 4, houden van de oplossing op ijs voor de gehele duur.
  5. Centrifugeer het resulterende mengsel gedurende 5 minuten bij 4000 rpm bij 4 & deg; C om de celresten te verwijderen. Breng het supernatant naar een nieuwe ampul.
  6. Bepaal de totale eiwitconcentratie van de cel extracten van Bradford assay. Opmerking: Gebruik glazen flesjes aan de stijging van de achtergrond en / of verlies van eiwit te voorkomen.
  7. Bereid een 100 ml mengsel dat 0,1% v / v alkaan en 50 mM Tris-HCl buffer.
  8. Verwarm het mengsel bij 100 ° C gedurende 5 minuten. Opmerking: Voer deze stap alleen voor het midden-lange keten alkanen met een hoog kookpunt. (Bijvoorbeeld C 16: 287 ° C).
  9. Om een ​​optimale oplosbaarheid van het alkaan bereiken ultrasone trillingen gedurende 1 min terwijl warm totdat een homogeen, viskeus mengsel verkregen.
  10. Voeg 1 mM NADH, 1 mM FMN, 1 mM MgSO4 en 0,01 v / v Triton X-100.
  11. Bereid 6 ml porties in 25 ml gesloten cap kolven.
  12. Voeg voldoende hoeveelheden celextract (afhankelijk van Bradford assays, eindconcentratie van 5 mg eiwit / l). Bereid een no-eiwit control.
  13. Incubeer bij 60 ° C (voor optimale enzymatic activiteit) gedurende 24 uur.
  14. Pak de koolwaterstoffen in het kweekmedium door ethylacetaat en bepalen koolwaterstofconcentratie in celkweek met gaschromatografie (zie protocol 3).
  15. Bereken de afbraak per eenheid biomassa door de totale hoeveelheid van alkaan omgezet door totale eiwit toegevoegd aan elke kolf (door Bradford kalibratiekromme). Delen door verdere duur van het experiment levert de afbraakactiviteit per eenheid cellulair eiwit per tijdseenheid. Het gemiddelde wordt genomen van drie individuele runs.

4. Ethylacetaat koolwaterstoffen Extractie en concentratie metingen

  1. Alkanen worden uit de waterige oplossing door toevoegen van 2,5 ml ethylacetaat (apolaire oplosmiddelvast) tot 6 ml experimentele oplossing. Een interne standaard wordt toegevoegd aan het oplosmiddel in een concentratie van 0,1% (v / v). De norm (bijv. cyclo-decaan) varieerde, afhankelijk van het verwachte bereik van de pieken van belang.
  2. Optioneel: Voeg TritonX-100 aan het waterige mengsel en centrifugeer de monsters gedurende 10 min bij 4000 rpm om een ​​goede bi-fasisch systeem.
  3. Vortex het mengsel gedurende 5 sec (1.500 rpm) en incubeer bij kamertemperatuur totdat de twee fasen gescheiden.
  4. Verwijderen van een maximale hoeveelheid van de organische laag (boven) en droog oplosmiddel met watervrije magnesiumsulfaat.
  5. Verwijder MgSO4 door middel van filtratie (0,2 micrometer) en giet het filtraat in gaschromatograaf flesjes voor metingen, of bewaar bij -20 ° C.
  6. Bepaal de concentratie gaschromatografie met een CP-SIL 5CB kolom (lengte = 5 m). Injecteer 10 pl monster in split mode (1:10, 230 ° C). Stel de kolom gasstroom 1 ml / min (Helium). De volgende oventemperatuur programma wordt gebruikt:
    Tarief Temperatuur [° C] Tijd [min]
    0 50 7,5
    50 90 1,0
    50 110 2,0
    50 130 2,0
    50 145 2,0
    50 160 2,0
    50 170 2,0
    50 185 2,0
    50 210 2,0
    50 250 2,0
    50 320 2,0
  7. Integreren pieken en corrigeren concentraties ten opzichte van de interne standaard.

5. Alcohol / aldehyde dehydrogenase activiteit Assay

Deze test werd in hoofdzaak uitgevoerd volgens de methode beschreven door Kato et al..(2010).

  1. Cultuur E. coli cellen die het ADH ( BBa_K398018 ) of ALDH ( BBa_K398030 ) gen en cellen die een lege vector ( BBa_J13002 ) in 50 ml LB medium met geschikte antibiotica nacht.
  2. Breng 500 pi van de overnacht cultuur in 50 ml vers LB (met antibiotica) en incubeer de cel totdat troebelheid bereikt een optische dichtheid van 0,6 bij 600 nm.
  3. Centrifugeer 10 minuten bij 4000 rpm bij 4 ° C en resuspendeer de pellet in 5 ml 50 mM Tris buffer.
  4. Sonificeer de cel-oplossing bij 40% inschakelduur met een vermogen controle van de 4 (houd de oplossing op ijs tijdens de ultrasoonapparaat).
  5. Centrifugeer het resulterende mengsel gedurende 5 minuten bij 4000 rpm bij 4 ° C verwijderen van celresten.
  6. Te bepalental eiwitconcentratie van de cel extracten van Bradford assay (Opmerking: Gebruik een glazen flesje van eiwitbinding te voorkomen).
  7. Plaats een 96 well plaat met 180 ul 57 mM glycine buffer die NAD (eindconcentratie 1 mM, pH 9,5) in elk putje.
  8. Voeg 5 ul van de alcohol (aldehyde) worden getest om de putjes. Opmerking: Heat langketenige alcoholen voor het begin van de assay een vloeistof. Voor elke alcohol (aldehyde) een controle zonder substraat moet worden toegevoegd (negatieve controle). Bovendien een blanco die een mengsel van buffer en het substraat zonder celextract.
  9. Verwarm de plaat van de plaatlezer (Tecan Magellan v7.0) gedurende 15 min bij 37 ° C tot evenwicht van het systeem mogelijk.
  10. Voeg voldoende hoeveelheden celextract (afhankelijk van Bradford assays, eindconcentratie van 5 mg eiwit / l). Bereid een no-eiwit control.
  11. Meet de NADH productie met een spectrofotometer bij een golflengte van 340 nm elke 2-3 min gedurende 1 uur bij 37 ° C. </ Li>
  12. Bereken de NADH productiesnelheid van de helling van de OD (340 nm). Houd rekening met het licht weglengte en de extinctiecoëfficiënt van NADH van 6220 M -1 cm -1. Verdeel het NADH productiesnelheid van de totale hoeveelheid eiwit toegevoegd aan de dehydrogenase activiteit van de reactie in de cel extract (U / mg celeiwit geheel) expressie. Bereken het gemiddelde en de standaarddeviatie van drie onafhankelijke runs.

6. pCaiF Karakterisering

  1. Cultuur E. coli-cellen die de pCaiF-GFP construct ( BBa_K398331 ) en cellen die de promotor alleen ( BBa_K398326 ) 's nachts in 5 ml LB-medium de juiste antibiotica' s nachts.
  2. Inoculeer 5 ml M9 met 10 g / l glucose en antibiotica met 50 ul van de nachtkweek en groeien overnacht. Subcultuur 50 ul van de overnight uitgroei in 5 ml vers M9 bij 10 g / l en incubeer de cel totdat troebelheid bereikt een optische dichtheid van 0,2 bij 600 nm.
  3. Plaats een plaat met 96 putjes met 100 pl vers M9 medium met de gewenste hoeveelheid koolstofbron voor het testen in elk putje. Voer triplo uitgevoerde experimenten voor statistische evaluatie en voeg de respectieve negatieve controles (wild-type E. coli K12).
  4. Voeg 5 ul van de kweek gedurende de nacht op de informatiedrager putjes.
  5. Meet de groeicurve (OD 600) en GFP-fluorescentie (excitatie 485 nm en emissie 520) met een plaatlezer elke 10 minuten gedurende 18 uur bij 37 ° C onder constant schudden.
  6. Bereken de groeisnelheid en de specifieke GFP inhoud van de respectievelijke metingen en vergeleken met de controle. Bereken het gemiddelde en de standaardafwijking van ten minste drie onafhankelijke experimenten.

7. Tolerantie Assay

  1. CultuurE. coli expressie PhPFDα en β gen ( BBa_K398406 ) overnacht in 5 ml LB medium en de juiste antibiotica. E. coli expressie LADA gen ( BBa_K398017 ) gebruikt als negatieve controle.
  2. Subcultuur 10 ul van het overnight uitgroei in vers 5 ml LB (met antibiotica) en incubeer de cel totdat troebelheid bereikt een optische dichtheid van 0,3 tot 0,4 bij 600 nm.
  3. Verdun de culturen met vers medium tot een OD 600 van 0,1 is bereikt.
  4. Plaats een 96 well plaat met 180 ul M9 medium met de geschikte antibiotica en de juiste uiteindelijke concentratie van de giftige verbinding (bv. 0, 4, 8, 10% n-hexaan) in drievoud. Omdat alkaan-water mengsels kan leiden tot tweefase systemen is het essentieel om toepasselijke controles op de plaat (bijvoorbeeld dAllerlei mensen melden stammen en de respectieve blanco experimenten).
  5. Voeg 20 ul van de cultuur (controle) in de putjes.
  6. Meet de biomassaconcentratie (OD 600) met een plaatlezer elke 10 min gedurende 24 uur bij 37 ° C onder constant schudden.
  7. Bereken de groei van de respectievelijke metingen voor de verschillende concentraties en middel te vergelijken met de negatieve controle. Bereken het gemiddelde en de standaardafwijking van ten minste drie onafhankelijke runs.

8. Homoloog Interactie Mapping

  1. De applicatie HIM is ontwikkeld om eiwit queries uit te voeren op een PostgreSQL server waarop de STRING-database (gratis voor academisch gebruik) 20. De homoloog interactie mapping applicatie identificeert interagerende eiwitten in de oorspronkelijke gastheer organisme met behulp van de STRING-database. De sequenties van de respectieve genen interactie worden gebruikt in een BLAST zoekopdracht homologe genen in het doelorganisme vinden. Cytoscape 4 https://github.com/jcnossen/InteractionHomologMapping.
  2. Om een mapping uit te voeren, (1) Voer de BioBrick ID en de applicatie zal automatisch downloaden van de deel sequence data van de griffie van Standard Biological Parts 9, of (2) enter (plakken) de sequence data in de applicatie.
  3. Gebruik de STRING Database website om de STRING eiwit-ID voor de ingevoerde aminozuursequentie te vinden.
  4. Een eiwit met hoge homologie wordt bepaald met BLAST. Vervolgens geeft de toepassing elke bekende interagerende proteïne in het bronorganisme en zoekt homologen in het gastheerorganisme (bijv. E. coli).
  5. Uitvoer die voortvloeit vermeende interactie lijst om tekst of Cytoscape.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

De BioBrick principe wordt gebruikt om een ​​chassis voor de afbraak van alkanen bouwen en een bewijs van principe voor de afzonderlijke componenten van de toolkit verkregen. Verschillende assays voorgesteld om de in vivo en in vitro activiteit van alkaan afbrekende enzymen route. De gepresenteerde werk toont succes een aantal methoden die kunnen worden gebruikt om enzymactiviteiten en expressie in het gastheerorganisme E. bepalen coli na implementatie van geschikte BioBricks. Verder wordt aangetoond dat de BioBrick beginsel kan worden gebruikt om een ​​organisme dat eiwitten die nodig zijn voor de afbraak van alkanen drukt ontwerp zorgt een reguleringssysteem dat deze enzymen produceert slechts wanneer noodzakelijk en verhoogt de tolerantie van de gastheer organisme in aanwezigheid van koolwaterstoffen . Zodra verder ontwikkeld, dit chassis kan worden gebruikt voor de biologische afbraak van residuale olie, bijvoorbeeld in oliezanden tailing water of voor de behandelingvan afvalwater van de olie-industrie.

Met betrekking tot de afbraak alkaan, werden assays uitgevoerd voor de karakterisering van de enzymen betrokken bij de eerste stap van afbraak alkaan (AH-systeem en Lada). Er werd aangetoond dat een E. coli-stam die de AH-systeem van Gordonia sp. TF6 kon octaan omgezet in vivo. Deze bevinding is in overeenstemming met de resultaten van Fujii et. al.. 8, waarbij biotransformatie van n-alkanen met E. coli expressie de minimale component genen van de AH-systeem bereikt. De omzetting activiteit werd gemeten door een vergelijkende studie (wildtype versus mutant) na een bepaalde tijd. Voor een volledige karakterisering aanvullende onderzoek worden uitgevoerd op de activiteit van de AH-systeem de tijd en de kinetiek van het systeem.

Voor de omzetting van alkanen met lange keten (C 15-C 36), de Lada gen van Geobacillus thermodenitrificans geïmplementeerd. De enzymactiviteit werd getest in vitro met hexadecaan als lange keten koolwaterstof bron. Deze gemodificeerde E. coli stam vertoonde een verhoogde enzymactiviteit in vergelijking met de controle stam, waaruit de recombinant eiwit Lada maakt de omzetting van hexadecaan door E. coli. Naast de eigenschap van het omzetten van alkanen tot alkanolen, E. coli stammen werden ontwikkeld met een verbeterde werkwijze voor de afbraak alcoholen en aldehyden door de uitvoering van ADH en ALDH genen respectievelijk. De enzymactiviteit in celextracten werd getest in vitro door het meten van de productie van NADH uit NAD +. De E. coli stam die ADH vertoonden een tweevoudige toename in alcohol dehydrogenase activiteit vergeleken met het wildtype activiteit. Vergelijking met de controle stam, de expressie van ALDH eiwit verhoogde de dodecanal dehydrogenase activiteit in E. coli celL Extracten drievoudige. Aangezien deze assays duidelijk aangetoond van enzymactiviteit in vitro kan worden gespeculeerd dat de getransformeerde E. coli stammen hebben verhoogde activiteit in vivo ook.

Om de mogelijkheid van host-geïnduceerde expressie (bijvoorbeeld: non-afhankelijkheid van chemicaliën en inductie lage druk tijdens de groei) onderzoeken, werd de afbraakroute expressie gebracht onder de controle van de promoter pCaiF. Deze promotor activeert genexpressie als het glucose laag zijn, bijvoorbeeld. aan het einde van een batch groeifase. Als een proof of principle, werd deze promotor getest via de productie van GFP onder verschil glucose regimes. Er werd aangetoond dat de pCaiF-GFP E. getransformeerde coli produceerde meer GFP tijdens stationair (glucose-beperkt) fase dan in de exponentiële fase (hoge glucosespiegels). In de aanwezigheid van een secundaire koolstofbron (bijv.. Laurinezuur), de GFP productie daalde again door de afbraak van de secundaire koolstof-bron.

Het experiment toonde aan dat deze promoter kan effectief worden gebruikt om katabole verschuivingen van glucose naar nieuwe omzettingsroutes toestaat. Dit laat toe om een ​​grote hoeveelheid organismen snel groeien in rijk medium voor de afbraak route wordt geactiveerd. Wij stellen voor om de pCaiF promotor gebruiken stroomopwaarts de Alks transcriptionele regulator. In Pseudomonas putida, ALKS herkent C 5-C 10 n-alkanen als effectoren. Vervolgens hoge ALKS-alkaan complex activeren PalkB promoter resulteert in de expressie van het alkBFGHJKL operon dat codeert voor eiwitten die betrokken zijn bij de omzetting van n-alkanen tot vetzuren 19.

Sensing en conversie van koolwaterstoffen is niet genoeg voor de cel om levensvatbaar zijn. Het verhogen koolwaterstof in het milieu de groei van wild type E. coli wordt geremd door de aanwezigheid van hydrowaterstoffen in het membraan en in de cel, welk eiwit misfolding kan veroorzaken. P. horikoshii prefoldin een chaperone helpen de correcte vouwing van eiwitten in de aanwezigheid van alkanen 17. HIM gebruikt, werd voorspeld dat dit eiwit interactie met homoloog E. coli chaperone eiwitten suggereert dat overexpressie van prefoldin in E. coli kunnen verbeteren oplosmiddel tolerantie. Met de BioBrick BBa_K398406 (bestaande uit phPFDα en phPFDβ genen), de overlevingskansen van E. coli in aanwezigheid van alkanen werd verbeterd tot 50%. HIM is een geschikt instrument om potentiële functionele homologen te selecteren.

Gezien de gereedschapset als geheel kan worden geconcludeerd dat een eerste stap in de constructie van een chassis voor zuivering van koolwaterstoffen in waterige omgevingen. Dit is een kleine, autonome, zelf-replicerende en relatively goedkope methode. De resultaten werden vooral verworven door middel van enzymbepalingen en schud flash culturen en moeten dus worden gevalideerd op een grotere schaal. Verder onderzoek naar dit systeem moeten gericht zijn op de koppeling van de verschillende enzymen, die hier zijn getoond afzonderlijk werken om de beoogde systeem voor koolwaterstof afbraak genereren. Verder kan toevoeging van alternatieve routes voor de afbraak van andere verontreinigingen het gebruik van dit chassis alleen verbreden voorbij de zuivering van koolwaterstoffen naar een breder spectrum van verontreinigingen en eventueel de toepassing van product routes kan dit systeem ook te gebruiken voor de productie van waardevolle chemicaliën. Onze resultaten benadrukken de geschiktheid van de samenstel BioBricks strategie synthetische biologie nieuwe organismen die kan omgaan met olieverontreiniging en kan bovendien nuttig zijn om een ​​grote verscheidenheid van andere toepassingen te ontwikkelen construeren.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Geen belangenconflicten verklaard.

Acknowledgments

De experimenten uitgevoerd in deze video-artikel zijn ontwikkeld voor de international Genetically Engineered Machine competitie 9. De auteurs danken iGEM teamleden Lucas Bergwerff, Pieter TM van Boheemen, Jelmer Cnossen, Hugo F. Cueto Rojas en Ramon van der Valk voor de hulp bij het onderzoek. Wij danken Han de Winde, Stefan de Kok en Esengül Yıldırım voor nuttige discussies en het plaatsen van dit onderzoek. Dit werk werd ondersteund door de TU Delft Universiteit afdeling Biotechnologie, De Delftse Bioinformatics lab, TU Delft afdeling Bionanoscience, Oil Sands Leadership Initiative (OSLI), StuD studentenuitzendbureau, Nederland Genomics Initiative, Kluyver Centre, Nederlandse Biotechnologische Vereniging (Stichting Biotechnologie Nederland) , DSM, Geneart, Greiner Bio-One en Genencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics