En Toolkit å aktivere hydrokarbonomdanning i vandige miljøer

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

En bærekraftig auto regulere bakteriell system for utbedring av oljeforurensninger designet ved hjelp av standard utskiftbare DNA deler (BioBricks). En konstruert

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Dette arbeidet legger frem en verktøykasse som gjør det mulig konvertering av alkaner av Escherichia coli og presenterer et bevis på prinsippet om anvendelse sin. Verktøysettet består av flere standard utskiftbare deler (BioBricks) 9 adressering konvertering av alkaner, regulering av genuttrykk og overlevelse i giftige hydrokarbon-rike miljøer.

En tre-trinns vei for alkan degradering ble implementert i E. coli å aktivere konvertering av middels og lang kjede alkaner til sine respektive alkanoler, alkanals og til slutt alkan-syrer. Sistnevnte ble metaboliseres via den innebygde β-oksidasjon veien. Å lette oksidasjonen av middels kjede alkaner (C5-C13) og sykloalkaner (C5-C8), fire gener (alkB2, rubA3, rubA4 og Rubb) av alkanet hydroksylase systemet fra Gordonia sp. TF6 8,21 ble forvandlet til E. coli. For konvertering avlangkjedede alkaner (C15-C36) ble LADA genet fra Geobacillus thermodenitrificans implementert. For de nødvendige ytterligere trinn for nedbrytning prosessen ble ADH og ALDH (som stammer fra G. thermodenitrificans) innført 10,11. Aktiviteten ble målt ved hvilende celle-analyser. For hvert oksidativ trinn ble enzymaktivitet observert.

Å optimalisere prosessen effektivitet, ble uttrykket bare indusert under lave glukose forhold: et substrat-regulert promotor, pCaiF, ble benyttet. pCaiF er tilstede i E. coli K12 og regulerer ekspresjon av gener som er involvert i nedbrytning av ikke-glukose karbonkilder.

Den siste delen av verktøysettet - targeting overlevelse - ble gjennomført ved hjelp av løsemidler toleranse gener, PhPFDα og β, både fra Pyrococcus horikoshii OT3. Organiske løsemidler kan indusere stress i cellene og redusert overlevelsesevne ved negativt affecting protein folding. Som anstand, PhPFDα og β forbedre proteinfolding prosessen f. eks under tilstedeværelsen av alkaner. Uttrykket av disse genene førte til en forbedret hydrokarbon toleranse vist ved en økt veksthastighet (opptil 50%) i nærværet av 10% n-heksan i dyrkningsmediet ble observert.

Oppsummering, tyder resultatene på at verktøysettet gjør E. coli å konvertere og tolerere hydrokarboner i vandige miljøer. Som sådan representerer den et første skritt mot en bærekraftig løsning for olje-utbedring ved hjelp av en syntetisk biologi tilnærming.

Protocol

1. BioBrick Assembly

  1. BioBricks fra registeret av standard biologiske deler er levert av iGEM hovedkvarter. Å konstruere en ny BioBrick fra eksisterende BioBricks, fordøye donor BioBrick (opptil 1,0 mikrogram) med enzymene EcoRI og SpeI for posisjonering donor del nedstrøms akseptor delen. Fordøye med XbaI og PstI for å posisjonere donor delen oppstrøms akseptor delen. Legge til en tredje hensiktsmessig restriksjonsenzym som kutter i ryggraden av donor. Gjennomfør digestions i et totalt volum på 20 til 25 ml med den passende buffer, i henhold til leverandøren (sluttkonsentrasjon 1x). Bruke 5 enheter / ug DNA for restriksjonsenzymer.
  2. Fordøye akseptor BioBrick med enten EcoRI og XbaI eller SpeI og PstI.
  3. Inkuber digestions for (minst) en time ved 37 ° C. Inaktivere restriksjonsendonukleaser av varme, inkubering ved 80 ° C i 10 min og sentrifuger kort tid.
  4. Ligere fordøyd BioBrickdeler (donor og akseptor) sammen. Siden XbaI og SpeI generere kompatible DNA ender, er en blandet nettsted opprettet som ikke kan kuttes med enhver restriksjonsenzym resulterer i en ny "kombinert 'BioBrick som flankert av 4 standard restriksjonsseter. I ligeringsblandingen den endelige DNA-konsentrasjon er fortrinnsvis ~ 100 ng / ul. Utfør ligeringsreaksjonen i et totalt volum på 10 til 15 ml med den T4 ligation buffer (sluttkonsentrasjon 1x) og T4 ligase (1 enhet / ug DNA).
  5. Inkuber ligeringsblandingen ved 16 ° C i minst 3 timer.
  6. Utfør transformasjon reaksjon med ca halvparten av ligation blanding.
  7. Bekreft BioBrick å være korrekt med sekvensering.
  8. Å bygge en ny BioBrick fra syntetiserte DNA, endre gener for syntese for optimal uttrykk i E. coli ved hjelp av JCat nettsiden verktøyet ( http://www.jcat.de/ ). Gjøre ytterligere endringer i samsvar med kravene i B ioBrick standard. Denne standardisering innebærer at hver BioBrick består av en DNA-sekvens av interesse innledes med et prefiks og etterfulgt av et suffiks. Den prefiks og suffiks er sekvenser som inneholder forhåndsdefinerte restriksjonsseter, som er fraværende i den gjenværende plasmid sekvens. Disse standard restriksjonsseter gjør det mulig å utveksle og forlenge BioBrick innstikk fleksibelt 9. Prefikset og suffiks har følgende sekvenser:
Navn Sekvens Kommentar
Prefiks 5 'GAATTCGCGGCCGCTTCTAG3'
5 'GAATTCGCGGCCGCTTCTAGAG 3' Hvis følgende delen er en kodende sekvens eller en del som starter med "ATG"
Suffiks 5 'TACTAGTAGCGGCCGCTGCAG 3'
ove_title "> 2. alkan Conversion Resting Cell Assay, In Vivo

Denne analysen ble utført basert på fremgangsmåten beskrevet av Fujii et al. (2004).

  1. Kultur E. coli-celler som uttrykker alkanet hydroksylase systemet ( BBa_K398014 ) og celler som bærer en tom vektor ( BBa_J13002 ) i 5 ml LB-medium med egnede antibiotika over natten.
  2. Overfør 500 ul av den over natten kultur inn 50 ml frisk LB (med antibiotika) og inkuber til cellen turbiditet nådde en OD (optisk tetthet) på 0,3 ved 600 nm.
  3. Sentrifuger i 10 minutter ved 4000 rpm og resuspender pelleten i 5 ml 0,1 M fosfatbuffer (pH 7,4).
  4. Sentrifuger igjen i 10 minutter ved 4000 rpm og resuspender pelleten i 5 ml 0,1 M fosfatbuffer som nå inneholder E2 salter og 0,66% v / v glycerol (nitrogen-deficient medium).
  5. Mål cellen turbiditet (OD 600).
  6. Forbered celle-blandingen aliquoter av 6 ml i 25 ml lukket-cap glass kolber og no-celle kontroller (E2 salter + 0,66% v / v glyserol).
  7. Tilsett 100 nmol av alkan til hver kolbe.
  8. Inkuber blandinger ved 37 ° C i 24 timer (forkorte når høyere priser blir oppnådd).
  9. Mål OD 600 etter inkubering.
  10. Ekstraher de hydrokarboner i dyrkningsmedium av etylacetat og bestemme hydrokarbon konsentrasjon i cellekultur ved gasskromatografi (se protokoll 3).
  11. Beregn nedbrytningen per enhet av biomasse ved å dividere den totale mengden av alkan konvertert av den totale biomassen stede i hver kolbe (konvertere OD 600 til tørrvekt). Dividere resultatet med den eksperimentelle varighet gir den nedbrytning aktivitet per enhet biomasse per tidsenhet. Gjennomsnittet er tatt fra tre individuelle kjøringer.

3. Alkan Conversion enzymanalysen, InVitro

Denne analysen ble utført i hovedsak i henhold til metoden beskrevet av Li et al. (2008).

  1. Kultur E. coli-celler som uttrykker LADA genet ( BBa_K398017 ) og celler som bærer en tom vektor ( BBa_J13002 ) i 50 ml LB-medium med egnede antibiotika natten.
  2. Overfør 500 ul av den over natten kultur inn 50 ml frisk LB (med antibiotika) og inkuber til cellen turbiditet nådd en optisk tetthet på 0,6 ved 600 nm.
  3. Sentrifuger 10 minutter ved 4000 rpm (4 ° C) og resuspender pelleten i 5 ml 50 mM Tris-buffer.
  4. Sonicate (Cell Disrupter, LA Biosystems) cellene ved 40% driftssyklus med en produksjon kontroll på 4, holde løsningen på isen for hele varigheten.
  5. Sentrifuger resulterende blanding i 5 min ved 4000 rpm ved 4 & df.eks, C for å fjerne celleavfall. Overfør supernatanten til et friskt hetteglass.
  6. Bestem den totale proteinkonsentrasjonen i cellen ekstrakter av Bradford-analysen. Merk: Bruk hetteglass å hindre økningen av bakgrunnen og / eller tap av protein.
  7. Forbered en 100 ml blanding inneholdende 0,1% v / v alkan og 50 mM Tris-HCl-buffer.
  8. Oppvarme blandingen ved 100 ° C i 5 min. MERK: Utfør dette trinnet for middels langkjedede alkaner med høyt kokepunkt. (F.eks C 16: 287 ° C).
  9. For å oppnå en optimal oppløselighet av alkan, sonicate i 1 min mens fremdeles varm inntil en homogen, viskøs blanding.
  10. Legg 1 mM av NADH, 1 mM FMN, 1 mM MgSo4 og 0,01 v / v Triton X-100.
  11. Forbered 6 ml aliquoter i 25 ml lukket-cap kolber.
  12. Legg tilstrekkelige mengder celleekstrakt (avhenger Bradford-analyser, sluttkonsentrasjon på 5 mg protein / l). Forbered en no-protein kontroll.
  13. Inkuber ved 60 ° C (for optimal enzymatic aktivitet) for 24 timer.
  14. Ekstraher de hydrokarboner i dyrkningsmedium av etylacetat og bestemme hydrokarbon konsentrasjon i cellekultur ved gasskromatografi (se protokoll 3).
  15. Beregn nedbrytningen per enhet av biomasse ved å dividere den totale mengden av alkan omdannes ved totalt protein tilsatt til hver kolbe (etter Bradford kalibreringskurve). Ytterligere dividere med eksperimentet varighet gir den nedbrytning aktivitet per enhet av celleprotein per tidsenhet. Gjennomsnittet er tatt fra tre individuelle kjøringer.

4. Etylacetat Hydrocarbon Utvinning og konsentrasjonsmålinger

  1. Alkaner er ekstrahert fra den vandige oppløsning ved tilsetning 2,5 ml etylacetat (apolart solvant) til 6 ml eksperimentell løsning. En intern standard tilsettes til oppløsningsmidlet i en konsentrasjon på 0,1% (v / v). Standarden (f.eks cyclo-decan) varieres avhengig forventede avstand av toppene av interesse.
  2. Valgfritt: Legg TritonX-100 til den vandige blandingen og sentrifuger prøvene i 10 minutter ved 4000 rpm for å få en skikkelig tofasepillen system.
  3. Vortex blandingen i 5 sek (1500 rpm) og inkuber ved romtemperatur inntil de to faser adskilt.
  4. Fjerne en maksimal mengde av det organiske lag (øverst) og tørke løsningsmidlet hjelp vannfritt magnesiumsulfat.
  5. Fjern MgSo4 ved filtrering (0,2 mikrometer) og overføre filtratet til gasskromatografledningen ampuller for målinger, eller oppbevares ved -20 ° C.
  6. Bestemme konsentrasjonen av gass under anvendelse av en CP-SIL 5CB kolonne (lengde = 5 m). Injiser 10 ul av prøven i delt modus (1:10, 230 ° C). Still kolonne gasstrømmen til 1 ml / min (helium). Følgende ovnstemperaturen programmet brukes:
    Sats [° C] [Min]
    0 50 7.5
    50 90 1.0
    50 110 2.0
    50 130 2.0
    50 145 2.0
    50 160 2.0
    50 170 2.0
    50 185 2.0
    50 210 2.0
    50 250 2.0
    50 320 2.0
  7. Integrere toppene og korrigere konsentrasjoner med hensyn til den indre standard.

5. Alkohol / aldehyd dehydrogenase aktivitet Assay

Denne analysen ble utført i hovedsak i henhold til metoden beskrevet av Kato et al.(2010).

  1. Kultur E. coli-celler som uttrykker ADH ( BBa_K398018 ) eller ALDH ( BBa_K398030 ) genet og celler som bærer en tom vektor ( BBa_J13002 ) i 50 ml LB-medium med egnede antibiotika over natten.
  2. Overfør 500 ul av den over natten kultur inn 50 ml frisk LB (med antibiotika) og inkuber til cellen turbiditet nådd en optisk tetthet på 0,6 ved 600 nm.
  3. Sentrifuger 10 minutter ved 4000 rpm ved 4 ° C og resuspender pelleten i 5 ml 50 mM Tris-buffer.
  4. Sonicate cellen oppløsningen ved 40% driftssyklus med en effektstyring av 4 (holde løsningen på is sonikering).
  5. Sentrifuger resulterende blanding i 5 minutter ved 4000 rpm ved 4 ° C for å fjerne celleavfall.
  6. Bestem tiltal protein konsentrasjon av cellen ekstrakter av Bradford analysen (Merk: Bruk et hetteglass for å hindre protein binding).
  7. Laste en 96 brønn plate med 180 pl 57 mM glycin buffer inneholdende NAD (sluttkonsentrasjon 1 mM, pH 9,5) i hver brønn.
  8. Tilsett 5 pl av alkoholen (aldehyd) som skal testes til brønnene. Merk: Heat langkjedede alkoholer før starten av analysen for å ha en væske. For hver alkohol (aldehyd) en kontroll uten substrat bør legges (negativ kontroll). I tillegg, forberede en tom inneholdende en blanding av buffer og substratet uten celleekstrakt.
  9. Forvarme plate av for plateavleseren (Tecan Magellan v7.0) i 15 min ved 37 ° C for å tillate ekvilibrering av systemet.
  10. Legg tilstrekkelige mengder celleekstrakt (avhenger Bradford-analyser, sluttkonsentrasjon på 5 mg protein / l). Forbered en no-protein kontroll.
  11. Måle NADH produksjon ved hjelp et spektrofotometer ved en bølgelengde på 340 nm hver 2-3 min i 1 time ved 37 ° C. </ Li>
  12. Beregn NADH produksjonsrate fra skråningen av OD (340 nm). Ta hensyn til lysvei og ekstinksjonskoeffisient av NADH av 6220 M -1 cm -1. Dele NADH produksjonsrate ved den totale mengde protein tilsatt til uttrykke aktiviteten til dehydrogenase reaksjonen i celleekstrakt (U / mg helcelle protein). Beregn middelverdien og standardavviket fra tre uavhengige kjøringer.

6. pCaiF Karakterisering

  1. Kultur E. coli-celler uttrykker pCaiF-GFP konstruere ( BBa_K398331 ) og celler som bærer arrangøren alene ( BBa_K398326 ) over natten i 5 ml LB medium de aktuelle antibiotika natten.
  2. Inokulere 5 ml M9 inneholdende 10 g / l glukose og antibiotika med 50 pl av den over natten kultur og vokse over natten. Subkultur 50 pl av overnatter utvekst inn 5 ml frisk M9 with10 g / l og inkuber til cellen turbiditet nådd en optisk tetthet på 0,2 ved 600 nm.
  3. Laste en 96 brønn plate med 100 pl frisk M9 medium inneholdende den ønskede mengde av karbon kilde for testing i hver brønn. Utfør triplikate eksperimenter for statistisk evaluering og legge de respektive negative kontroller (villtype E. coli K12).
  4. Tilsett 5 pl av den over natten kultur til mediet inneholdende brønner.
  5. Måle veksten kurven (OD 600) og GFP fluorescens (485 nm eksitasjon og 520 emisjon) ved hjelp av en plateavleser hvert 10 min i 18 timer ved 37 ° C med konstant risting.
  6. Beregn veksten og den spesifikke GFP innhold fra de respektive målinger og sammenlign med kontrollen. Beregn middelverdien og standardavviket av minst tre uavhengige eksperimenter.

7. Toleranse Assay

  1. KulturE. coli uttrykker PhPFDα og β genet ( BBa_K398406 ) over natten i 5 ml LB-medium og de ​​egnede antibiotika. E. coli uttrykker Lada genet ( BBa_K398017 ) brukes som negativ kontroll.
  2. Subkultur 10 pl overnatter utvekst i frisk 5 ml LB (med antibiotika) og inkuber til cellen turbiditet nådde en optisk densitet på 0,3 til 0,4 ved 600 nm.
  3. Fortynn kulturene med friskt medium inntil en OD 600 på 0,1 er nådd.
  4. Laste en 96 brønn plate med 180 pl M9 medium inneholdende de riktige antibiotika og riktig sluttkonsentrasjonen av giftig forbindelse (0 f.eks, 4, 8, 10% av n-heksan) i triplikat. Fordi alkan-vann blandinger kan føre til to-fase-systemer, er det viktig å ha egnede kontroller på plate (for eksempel Different stammer og de respektive tomme eksperimenter).
  5. Tilsett 20 pl av kulturen (kontroll) i brønnene.
  6. Mål biomasse konsentrasjonen (OD 600) ved hjelp av en plate-leser hvert 10 min i 24 timer ved 37 ° C med konstant risting.
  7. Beregn vekstratene fra de respektive målinger for de ulike agenten konsentrasjoner og i forhold til den negative kontrollen. Beregn middelverdien og standardavviket av minst tre uavhengige kjøringer.

8. Homolog Interaction Mapping

  1. Søknaden HIM ble utviklet for å utføre protein spørringer på en PostgreSQL server kjører STRING database (gratis for faglig bruk) 20. Den homolog interaksjon kartprogram identifiserer samvirkende proteiner i den opprinnelige vert organisme bruker STRING databasen. Sekvenser av de respektive samvirkende gener brukes i et BLAST søk for å finne homologe gener i målorganismen. Cytoscape 4 https://github.com/jcnossen/InteractionHomologMapping.
  2. Å gjennomføre en kartlegging, (1) inn i BioBrick ID og programmet vil automatisk laste ned en del sekvens data fra registeret av standard biologiske Parts 9 eller (2) Skriv (lim) sekvensen dataene i programmet.
  3. Bruk STRING Database hjemmeside for å finne STRING protein ID for den angitte aminosyresekvens.
  4. Et protein med høy homologi fastsettes ved BLAST. Deretter søknaden viser hver kjent samspill protein i kilden organisme og søker etter homologer i verten organismen (f.eks E. coli).
  5. Eksportere resulterer antatte samhandling listen til tekst eller Cytoscape.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Den BioBrick prinsippet brukes til å konstruere et chassis for nedbrytning av alkaner og et bevis prinsipp for enkeltstoffene av verktøysettet ble oppnådd. Flere analyser er foreslått å måle in vivo og in vitro aktivitet av alkan nedverdigende pathway enzymer. Den presenterte Arbeidet viser vellykket en rekke metoder som kan brukes til å bestemme på enzymaktiviteter og uttrykk i vertsorganismen E. coli etter innføringen av egnede BioBricks. Videre er det vist at BioBrick prinsippet kan brukes for å utforme en organisme som uttrykker proteiner som er nødvendige for nedbrytning av alkaner, gir en regulerende system som produserer disse enzymene bare når det er nødvendig og komplementerer toleransen til vertsorganismen i nærvær av hydrokarboner . Gang videre utviklet, kunne dette chassiset brukes for biologisk nedbrytning av gjenværende olje, f.eks i oljesand tailing farvann, eller for behandlingav avløpsvann fra oljeindustrien.

Med hensyn til alkanet degradering, ble analyser utført for karakterisering av enzymer involvert i det første trinnet i alkan nedbrytning (AH-system og Lada). Det ble demonstrert at en E. coli stamme som bærer AH-systemet Gordonia sp. TF6 var i stand til å konvertere oktan in vivo. Dette funnet er i samsvar med resultatene av Fujii et. al. 8 hvor biotransformasjon av n-alkaner med E. coli uttrykker minimal komponent gener AH-systemet ble oppnådd. Konverteringen aktivitet ble målt ved en sammenlignende studie (wildtype vs mutant) etter en gitt tid. For en full karakterisering, ytterligere studier må utføres på aktiviteten av AH-systemet over tid, og kinetikken i systemet.

For omdannelse av langkjedede alkaner (C 15-C 36), LADA genet fra Geobacillus thermodenitrificans ble gjennomført. Enzymaktiviteten ble testet in vitro ved hjelp heksadekan som langkjedede hydrokarbon kilde. Dette endret E. coli-stamme viste en økt enzymaktivitet i forhold til kontroll stamme, demonstrere rekombinant Lada proteinet muliggjør omdannelsen av heksadekan E. coli. I tillegg til egenskapen med å konvertere alkaner til alkanoler, E. coli stammer ble utviklet med en forbedret nedbrytningsprosess for alkoholer og aldehyder med gjennomføringen av ADH og ALDH gener hhv. Enzymaktiviteten i celle ekstraktene ble testet in vitro ved å måle produksjonen av NADH fra NAD +. E. coli-stamme uttrykker ADH viste en to-gangers økning i alkoholdehydrogenase aktivitet sammenlignet med villtype-aktivitet. Sammenlignet med kontroll belastning, økte uttrykket av ALDH protein dodecanal dehydrogenase aktivitet i E. coli cell trekker tre ganger. Siden disse analysene tydelig vist økte enzym aktivitet in vitro, kan det være spekulert at den transformerte E. coli stammer har forhøyede nivåer av aktivitet in vivo så vel.

Å undersøke muligheten av host-indusert ekspresjon (for eksempel: ikke-avhengighet induksjon kjemikalier og lav byrde under vekst), ble nedbrytning pathway uttrykt under kontroll av den pCaiF promotoren. Dette arrangøren aktiverer genuttrykk når blodsukkeret er lavt, f.eks. på slutten av en batch vekstfase. Som et bevis på prinsippet ble dette promoter testet via produksjon av GFP henhold forskjellen glukose regimer. Det ble demonstrert at pCaiF-GFP forvandlet E. coli produsert mer GFP under stasjonære (glukose-begrenset) fase enn i den eksponentielle fasen (høye blodsukkeret). I nærvær av en sekundær karbonkilde (f.eks. Laurinsyre), reduserte GFP produksjonsraten again grunnet katabolisme av den sekundære karbon-kilde.

Forsøket viste at dette arrangøren kan være effektivt brukes til å aktivere katabolske skifter fra glukose til nye nedbrytning veier. Dette gjør det mulig å raskt vokse en enorm mengde organismer i rike medium før nedbrytning veien er aktivert. Vi foreslår å bruke pCaiF promoter oppstrøms AlkS transcriptional regulator. I Pseudomonas putida, gjenkjenner AlkS C 5-C 10 N-alkaner som effektorer. Senere høye nivåer av AlkS-alkan komplekset aktivere PalkB promotoren resulterer i ekspresjon av de alkBFGHJKL operon som koder for proteiner involvert i omdannelsen av n-alkaner til fettsyrer 19.

Sensorer og konvertering av hydrokarboner er ikke nok for cellen å være levedyktig. I økende hydrokarbon nivåene i miljøet, veksten av villtype E. coli er hemmet gjennom tilstedeværelse av hydrokarboner i membranen og i cellen, noe som kan føre til protein misfolding. P. horikoshii prefoldin er anstand hjelpe korrekt folding av proteinet i nærvær av alkaner 17. Bruke ham, ble det spådd at dette proteinet samhandler med homolog E. coli anstand proteiner, noe som tyder på at overuttrykte prefoldin i E. coli kan forbedre løsemiddel toleranse. Med BioBrick BBa_K398406 (bestående av phPFDα og phPFDβ gener), overlevelsesevnen til E. coli i nærvær av alkaner ble forbedret opptil 50%. HIM er et egnet verktøy for å velge potensielle funksjonelle homologer.

Vurderer verktøykassen som helhet, kan det konkluderes med at det gir et første trinn i konstruksjonen av et chassis for biologisk nedbryting av hydrokarboner i vandige miljøer. Dette representerer en liten, autonome, selvreproduserende og relatively billig metode. Resultatene ble i hovedsak ervervet gjennom enzym analyser og riste flash kulturer og dermed må vurderes fortløpende i større skala. Ytterligere forskning på dette systemet bør fokusere på koblingen av de forskjellige enzymer, som har blitt vist her arbeide individuelt for å generere den tenkt system for hydrokarbon degradering. Videre kunne tilsetning av alternative veier for nedbrytning av andre forurensende samt utvide bruken av dette chassiset utover bioremediering av hydrokarboner alene til et bredere omfang av miljøgifter, og muligens gjennomføringen av produktet trasé kan selv benytte dette systemet for produksjon av verdifulle kjemikalier. Våre resultater understreke egnethet BioBricks montering strategi i syntetisk biologi å konstruere nye organismer som kan håndtere oljeforurensning, og kan i tillegg være nyttig å utvikle en rekke andre anvendelser.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Ingen interessekonflikter erklært.

Acknowledgments

Eksperimenter utført i denne video-artikkelen ble utviklet for det internasjonale genmodifisert Machine konkurranse 9. Forfatterne ønsker å takke iGEM gruppemedlemmer Luke Bergwerff, Pieter TM van Boheemen, Jelmer Cnossen, Hugo F. Cueto Rojas og Ramon van der Valk for hjelp i forskningen. Vi takker Han de Winde, Stefan de Kok og Esengül Yıldırım for personer diskusjoner og hosting denne forskningen. Dette arbeidet ble støttet av TU Delft University Institutt for bioteknologi, The Delft Bioinformatikk lab, TU Delft Institutt for Bionanoscience, Oil Sands Leadership Initiative (OSLI), stud studentenuitzendbureau, Nederland Genomics Initiative, Kluyver Centre, Nederlandse Biotechnologische Vereniging (Stichting Bioteknologi Nederland) , DSM, Geneart, Greiner Bio-One og Genencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics