Un juego de herramientas para la conversión de hidrocarburos en ambientes acuosos

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Un auto sostenible sistema de regulación de las bacterias para la remediación de contaminaciones de aceite ha sido diseñado utilizando piezas estándar de ADN intercambiables (BioBricks). Una ingeniería

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Este trabajo expone un conjunto de herramientas que permite la conversión de alcanos por Escherichia coli y presenta una prueba de principio de su aplicabilidad. El juego de herramientas se compone de varias piezas estándar intercambiables (BioBricks) 9 abordan la conversión de alcanos, la regulación de la expresión génica y la supervivencia en tóxicos ambientes ricos en hidrocarburos.

Una vía de tres pasos para la degradación de alcano se llevó a cabo en E. coli para permitir la conversión de alcanos a medio y largo de cadena a sus respectivos alcanoles, alcanales y, finalmente, ácidos alcanoicos. Este último se metaboliza a través de la nativo β-oxidación vía. Para facilitar la oxidación de alcanos de cadena media-(C5-C13) y cicloalcanos (C5-C8), cuatro genes (alkB2, rubA3, rubA4 y Rubb) del sistema hidroxilasa alcano de Gordonia sp. TF6 8,21 se transformaron en E. coli. Para la conversión de losalcanos de cadena larga (C15-C36), el gen Lada de Geobacillus thermodenitrificans fue implementado. Para conocer los pasos necesarios adicionales del proceso de degradación, ADH y ALDH (procedente de thermodenitrificans G.) se introdujeron 10,11. La actividad se midió mediante ensayos de células en reposo. Para cada etapa oxidativa, la actividad enzimática se observó.

Para optimizar la eficacia del proceso, la expresión fue inducida sólo bajo condiciones bajas de glucosa: un promotor regulado sustrato, pCaiF, se utilizó. pCaiF está presente en E. coli K12 y regula la expresión de los genes implicados en la degradación de fuentes de carbono distintas a la glucosa.

La última parte del conjunto de instrumentos - focalización supervivencia - se implementó el uso de genes de tolerancia, solventes PhPFDα y β, ambos de Pyrococcus horikoshii OT3. Disolventes orgánicos pueden inducir estrés celular y la disminución de la supervivencia de forma negativa affecting plegamiento de proteínas. Como chaperones, PhPFDα y β mejorar el proceso de plegamiento de proteínas por ejemplo en virtud de la presencia de alcanos. La expresión de estos genes condujeron a una tolerancia mejorada de hidrocarburos se muestra por una tasa de crecimiento mayor (hasta 50%) en la presencia de 10% de n-hexano en el medio de cultivo se observaron.

En resumen, los resultados indican que el kit de herramientas permite E. coli para convertir y tolerar hidrocarburos en ambientes acuosos. Como tal, representa un primer paso hacia una solución sostenible para la recuperación de petróleo mediante un enfoque de la biología sintética.

Protocol

1. BioBrick Asamblea

  1. BioBricks del Registro de partes biológicas estándar son proporcionados por la sede iGEM. Para construir un nuevo BioBrick de BioBricks existentes, digerir el donante BioBrick (hasta 1,0 g) con las enzimas EcoRI y SpeI para el posicionamiento de las partes aguas abajo de los donantes de la parte aceptor. Se digiere con XbaI y PstI para posicionar la parte donante aguas arriba de la parte aceptor. Añadir una tercera enzima de restricción apropiada que corta en la columna vertebral de la donante. Realizar las digestiones en un volumen total de 20-25 ml con el tampón apropiado, de acuerdo con el proveedor (concentración final 1x). Usar 5 unidades / g de ADN para las enzimas de restricción.
  2. Se digiere el aceptor BioBrick ya sea con EcoRI y XbaI o SpeI y PstI.
  3. Incubar las digestiones para (al menos) una hora a 37 ° C. Inactivar las endonucleasas de restricción por el calor, la incubación a 80 ° C durante 10 min y se centrifuga en breve.
  4. Se liga el BioBrick digeridopartes (donante y aceptor) juntos. Dado que XbaI y SpeI generar extremos compatibles de ADN, un sitio mixto se crea que no se puede cortar con cualquier enzima de restricción que resulta en una nueva "combinado" que BioBrick flanqueado por los sitios de restricción estándar 4. En la mezcla de ligación a la concentración final de ADN es preferiblemente ~ 100 ng / l. Realizar la reacción de ligación en un volumen total de 10-15 ml con el tampón de ligación T4 (concentración final 1x) y la T4 ligasa (1 unidad / g de ADN).
  5. Incubar la mezcla de ligación a 16 ° C durante al menos 3 h.
  6. Realizar reacción de transformación con medio circa de la mezcla de ligadura.
  7. Confirme la BioBrick ser correcta con la secuenciación.
  8. Para construir un nuevo BioBrick de ADN sintetizado, modificar los genes para la síntesis para la expresión óptima en E. coli por medio de la herramienta de la página web JCat ( http://www.jcat.de/ ). Realizar modificaciones adicionales de acuerdo con los requisitos de la B ioBrick estándar. Esta normalización implica que cada BioBrick se compone de una secuencia de ADN de interés precedido por un prefijo y seguido de un sufijo. El prefijo y el sufijo son secuencias que contienen sitios de restricción predefinidos, que están ausentes en la secuencia del plásmido restante. Estos sitios de restricción estándar hacen posible el intercambio y extender los insertos BioBrick flexible 9. El prefijo y sufijo tienen las siguientes secuencias:
Nombre Secuencia Comentario
Prefijo 5 'GAATTCGCGGCCGCTTCTAG3'
5 'GAATTCGCGGCCGCTTCTAGAG 3' Si la siguiente parte es una secuencia de codificación o cualquier parte que comienza con "ATG"
Sufijo 5 'TACTAGTAGCGGCCGCTGCAG 3'
ove_title "> 2. Alkane Análisis de Conversión célula en reposo, En Vivo

Este ensayo se realizó según el método descrito por Fujii et al. (2004).

  1. Cultura E. células de E. coli que expresan el sistema hidroxilasa alcano ( BBa_K398014 ) y las que contienen un vector vacío ( BBa_J13002 ) en 5 ml de medio LB con los antibióticos apropiados durante la noche.
  2. Transferir 500 l de cultivo de una noche en 50 ml de LB fresco (con antibióticos) y se incuba hasta que la turbidez celular alcanzó una DO (densidad óptica) de 0,3 a 600 nm.
  3. Centrifugar durante 10 min a 4.000 rpm y resuspender el sedimento en 5 ml de tampón fosfato 0,1 M (pH 7,4).
  4. Se centrifuga de nuevo durante 10 min a 4.000 rpm y resuspender el sedimento en 5 ml de tampón de fosfato 0,1 M que contiene ahora sales E2 y 0,66% v / v de glicerol (nitrógeno-deficienmedio t).
  5. Medir la turbiedad de células (OD 600).
  6. Preparar la mezcla de células de alícuotas de 6 ml en matraces de 25 ml de vidrio cerrado de la tapa y no de células controles (sales de E2 + 0,66% v / v de glicerol).
  7. Añadir 100 nmol de alcano a cada matraz.
  8. Incubar las mezclas a 37 ° C durante 24 hr (acortar cuando se obtienen tasas más altas).
  9. Mida la OD 600 después de incubación.
  10. Extraer los hidrocarburos en los medios de cultivo por acetato de etilo y determinar la concentración de hidrocarburos en cultivo celular por cromatografía de gases (véase el protocolo 3).
  11. Calcular la degradación por unidad de biomasa dividiendo la cantidad total de alcano convertido por la biomasa total presente en cada matraz (OD 600 convertir a peso seco). Dividiendo el resultado por la duración experimental produce la actividad de degradación por unidad de biomasa por unidad de tiempo. El promedio se toma de tres carreras individuales.

3. Alkane Conversion Ensayo enzimático, EnVitro

Este ensayo se realizó esencialmente según el método descrito por Li et al. (2008).

  1. Cultura E. células de E. coli que expresan el gen LADA ( BBa_K398017 ) y las células que llevan un vector vacío ( BBa_J13002 ) en 50 ml de medio LB con los antibióticos apropiados durante la noche.
  2. Transferir 500 l de cultivo de una noche en 50 ml de LB fresco (con antibióticos) y se incuba hasta que la turbidez celular alcanzó una densidad óptica de 0,6 a 600 nm.
  3. Centrifugar 10 minutos a 4.000 rpm (4 ° C) y resuspender el sedimento en 5 ml de 50 mM de tampón Tris.
  4. Baño de ultrasonidos (disruptor celular, LA Biosystems) las células en ciclo de trabajo de 40% con un control de salida de 4, mantener la solución en hielo durante toda la duración.
  5. Centrifugar la mezcla resultante durante 5 min a 4.000 rpm a 4 y dpor ejemplo, C para eliminar los restos celulares. Transferir el sobrenadante a un vial nuevo.
  6. Determinar la concentración de proteína total de los extractos celulares mediante ensayo de Bradford. Nota: Usar frascos de vidrio para evitar el aumento de fondo y / o la pérdida de proteína.
  7. Preparar una mezcla de 100 ml que contiene 0,1% v / v alcano y 50 mM de tampón Tris-HCl.
  8. Calentar la mezcla a 100 ° C durante 5 min. Nota: Realice este paso sólo para alcanos de cadena media de duración con alto punto de ebullición. (Por ejemplo, C 16: 287 ° C).
  9. Para conseguir una solubilidad óptima del alcano, sonicar durante 1 min mientras está todavía caliente hasta obtener una mezcla homogénea y viscosa se obtiene.
  10. Añadir 1 mM de NADH, 1 mM FMN, 1 mM MgSO 4 y 0,01 v / v Triton X-100.
  11. Preparar alícuotas de 6 ml en 25 ml cerrado la tapa frascos.
  12. Añadir una cantidad adecuada de extracto de células (depende de ensayos de Bradford, concentración final de 5 mg de proteína / l). Preparar un control sin proteína.
  13. Incubar a 60 ° C (para el correo óptimanzymatic actividad) durante 24 horas.
  14. Extraer los hidrocarburos en los medios de cultivo por acetato de etilo y determinar la concentración de hidrocarburos en cultivo celular por cromatografía de gases (véase el protocolo 3).
  15. Calcular la degradación por unidad de biomasa dividiendo la cantidad total de alcano convertido por proteína total a cada matraz (por Bradford curva de calibración). Además dividir por duración del experimento se obtiene la actividad de degradación por unidad de proteína celular por unidad de tiempo. El promedio se toma de tres carreras individuales.

4. Acetato de etilo de extracción de hidrocarburos y Medidas de concentración

  1. Alcanos se extrae de la solución acuosa mediante la adición de 2,5 ml de acetato de etilo (apolar solvant) a 6 ml de solución experimental. Un patrón interno se añade al disolvente en una concentración de 0,1% (v / v). El estándar (por ejemplo, ciclo-decan) varió en función de la gama prevista de los picos de interés.
  2. Opcional: Añadir TritonX-100 a la mezcla acuosa y centrifugar las muestras durante 10 min a 4.000 rpm con el fin de obtener un adecuado sistema bifásico.
  3. Vórtice de la mezcla durante 5 seg (1.500 rpm) y se incuba a temperatura ambiente hasta que las dos fases separadas.
  4. Eliminar una cantidad máxima de la capa orgánica (superior) y secar el solvente usando sulfato de magnesio anhidro.
  5. Retire MgSO 4 por filtración (0,2 m) y transferir el filtrado en viales de cromatografía de gases para mediciones o almacenar a -20 ° C.
  6. Determinar la concentración por cromatografía de gases utilizando una columna de CP-SIL 5CB (longitud = 5 m). Inyectar 10 ul de muestra en modo de división (1:10, 230 ° C). Establecer el flujo de gases en columna a 1 ml / min (helio). El programa de temperatura del horno se utiliza la siguiente:
    Velocidad Temperatura [° C] Tiempo [min]
    0 50 7,5
    50 90 1,0
    50 110 2,0
    50 130 2,0
    50 145 2,0
    50 160 2,0
    50 170 2,0
    50 185 2,0
    50 210 2,0
    50 250 2,0
    50 320 2,0
  7. Integrar los picos y corregir las concentraciones con respecto al patrón interno.

5. Alcohol / aldehído deshidrogenasa Ensayo de actividad

Este ensayo se realizó esencialmente según el método descrito por Kato et al.(2010).

  1. Cultura E. células de E. coli que expresan la ADH ( BBa_K398018 ) o ALDH ( BBa_K398030 ) de genes y las células que llevan un vector vacío ( BBa_J13002 ) en 50 ml de medio LB con los antibióticos apropiados durante la noche.
  2. Transferir 500 l de cultivo de una noche en 50 ml de LB fresco (con antibióticos) y se incuba hasta que la turbidez celular alcanzó una densidad óptica de 0,6 a 600 nm.
  3. Centrifugar 10 minutos a 4.000 rpm a 4 ° C y resuspender el sedimento en 5 ml de 50 mM de tampón Tris.
  4. Someter a ultrasonidos la solución de células en ciclo de trabajo del 40% con un control de salida de 4 (mantener la solución en hielo durante la sonicación).
  5. Centrifugar la mezcla resultante durante 5 min a 4.000 rpm a 4 ° C para eliminar los restos celulares.
  6. Determinar la queTal concentración de proteína de los extractos celulares mediante ensayo de Bradford (Nota: use un vial de vidrio para prevenir la proteína de unión).
  7. Cargar una placa de 96 pocillos con 180 l 57 mM de glicina tampón que contenía NAD (concentración final 1 mM, pH 9,5) en cada pocillo.
  8. Añadir 5 l de alcohol (aldehído) a ensayar a los pocillos. Nota: alcoholes de cadena larga de calor antes del comienzo del ensayo de tener un líquido. Para cada alcohol (aldehído) un control sin sustrato debe ser añadido (control negativo). Además, preparar un blanco que contiene una mezcla de tampón y sustrato sin el extracto celular.
  9. Precalentar la placa del lector de placas (Tecan Magellan v7.0) durante 15 min a 37 ° C para permitir el equilibrio del sistema.
  10. Añadir una cantidad adecuada de extracto de células (depende de ensayos de Bradford, concentración final de 5 mg de proteína / l). Preparar un control sin proteína.
  11. Medir la producción de NADH usando un espectrofotómetro a una longitud de onda de 340 nm cada 2-3 min durante 1 hora a 37 ° C. </ Li>
  12. Cálculo de la tasa de producción de NADH a partir de la pendiente de la OD (340 nm). Tener en cuenta la longitud de la trayectoria de la luz y el coeficiente de extinción de la NADH de 6220 M -1 cm -1. Divide la tasa de producción de NADH por la cantidad total de proteína añadida para expresar la actividad de la deshidrogenasa de reacción en el extracto celular (U / mg de proteína celular total). Calcular la media y la desviación estándar de tres carreras independientes.

6. Caracterización pCaiF

  1. Cultura E. células de E. coli que expresan el constructo pCaiF-GFP ( BBa_K398331 ) y las células que llevan el promotor solo ( BBa_K398326 ) durante la noche en 5 ml de medio LB durante la noche los antibióticos apropiados.
  2. Inocular 5 ml M9 que contenía 10 g / l de glucosa y los antibióticos con 50 l de cultivo de una noche y crecer durante la noche. Subculture 50 l de la noche a la mañana excrecencia en 5 ml de M9 fresco g with10 / l y se incuba hasta que la turbidez celular alcanzó una densidad óptica de 0,2 a 600 nm.
  3. Cargar una placa de 96 pocillos con 100 l de medio M9 fresco que contiene la cantidad deseada de fuente de carbono para la prueba en cada pocillo. Lleve a cabo tres experimentos para la evaluación estadística y añadir los respectivos controles negativos (tipo salvaje E. coli K12).
  4. Añadir 5 l de cultivo de una noche a los pocillos que contienen medio.
  5. Medir la curva de crecimiento (OD 600) y la fluorescencia de GFP (485 nm de excitación y de emisión de 520) usando un lector de placa de cada 10 minutos durante 18 horas a 37 ° C con agitación constante.
  6. Cálculo de la tasa de crecimiento y el contenido de GFP específica de las respectivas mediciones y comparar con el control. Calcular la media y la desviación estándar de al menos tres experimentos independientes.

7. Ensayo Tolerancia

  1. CulturaE. coli que expresan genes PhPFDα y β ( BBa_K398406 ) durante la noche en 5 ml de medio LB y los antibióticos adecuados. E. coli que expresan LADA gen ( BBa_K398017 ) se utilizó como control negativo.
  2. Subculture 10 l de la noche a la mañana en consecuencia fresco 5 ml de LB (con antibióticos) y se incuba hasta que la turbidez celular alcanzó una densidad óptica de 0,3 a 0,4 a 600 nm.
  3. Diluir los cultivos con medio fresco hasta una OD 600 de 0,1 se alcanza.
  4. Cargar una placa de 96 pocillos con 180 l medio M9 que contiene los antibióticos apropiados y la concentración final adecuada del compuesto tóxico (por ejemplo, 0, 4, 8, 10% de n-hexano) por triplicado. Dado que el agua alcano-mezclas podría conducir a sistemas de dos fases es esencial tener controles apropiados en la placa (por ejemplo, dcepas ifferent y los experimentos en blanco respectivos).
  5. Añadir 20 l de la cultura (control) en los pocillos.
  6. Medir la concentración de biomasa (OD 600) usando un lector de placas cada 10 minutos durante 24 horas a 37 ° C con agitación constante.
  7. Calcular las tasas de crecimiento de las mediciones respectivas para las diferentes concentraciones de agente y comparar con el control negativo. Calcular la media y la desviación estándar de al menos tres carreras independientes.

8. Homólogo Mapping Interacción

  1. El HIM aplicación fue desarrollada para realizar consultas de proteínas en un servidor PostgreSQL ejecuta la base de datos STRING (gratuito para uso académico) 20. La interacción homólogo aplicación de mapeo identifica las proteínas que interactúan en el organismo huésped original utilizando la base de datos STRING. Las secuencias de los genes respectivos que interaccionan se utiliza en una búsqueda BLAST para encontrar genes homólogos en el organismo objetivo. Cytoscape 4 https://github.com/jcnossen/InteractionHomologMapping.
  2. Para realizar un mapeo, (1) introducir el ID BioBrick y la aplicación se descargará automáticamente los datos de la secuencia parcial del Registro de partes biológicas estándar de 9, o (2) Intro (pegar) la secuencia de datos de la aplicación.
  3. Utilizar el sitio web de base de datos STRING para encontrar el ID de proteína STRING para la secuencia de ácido amino entrado.
  4. Una proteína con alta homología se determina usando BLAST. Posteriormente, la aplicación enumera cada proteína de interacción conocida en el organismo fuente y búsquedas de homólogos en el organismo huésped (por ejemplo, E. coli).
  5. Exportar lista resultante interacción putativo de texto o Cytoscape.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

El principio BioBrick se utiliza para construir un chasis para la degradación de alcanos y una prueba de principio para los componentes individuales de la caja de herramientas se obtuvo. Se proponen varios ensayos para medir la in vivo e in vitro de la actividad de enzimas de la ruta de degradación de alcanos. El trabajo presentado con éxito demuestra un número de métodos que pueden utilizarse para determinar la actividad enzimática y la expresión en el organismo huésped E. coli después de la implementación de BioBricks adecuados. Además, se demuestra que el principio BioBrick se puede utilizar para diseñar un organismo que expresa las proteínas necesarias para la degradación de alcanos, proporciona un sistema de regulación que produce estas enzimas sólo cuando sea necesario y aumenta la tolerancia del organismo huésped en la presencia de hidrocarburos . Una vez más desarrollado, este chasis puede ser utilizada para la degradación biológica de aceite residual, por ejemplo, en las arenas bituminosas de colas aguas, o para el tratamientode aguas residuales de la industria petrolera.

Con respecto a la degradación de alcano, se realizaron ensayos para la caracterización de las enzimas implicadas en la primera etapa de la degradación de alcano (AH-sistema y Lada). Se demostró que una E. coli cepa que lleva el AH-sistema de Gordonia sp. TF6 era capaz de convertir octano in vivo. Esta conclusión está de acuerdo con los resultados de Fujii et. al. 8, donde la biotransformación de los n-alcanos utilizando E. coli que expresan los genes de los componentes mínimos del AH-sistema se logró. La actividad de conversión se midió mediante un estudio comparativo (wildtype vs mutante) después de un tiempo dado. Para una caracterización completa, estudios adicionales han de realizarse sobre la actividad de la AH-sistema con el tiempo y la cinética del sistema.

Para la conversión de alcanos de cadena larga (C 15-C 36), el gen de LADA Geobathermodenitrificans cillus fue implementado. La actividad enzimática se ensayó in vitro usando hexadecano como fuente de hidrocarburos de cadena larga. Esta modificación E. coli cepa mostró una actividad enzimática aumentada en comparación con la cepa de control, lo que demuestra la proteína recombinante LADA permite la conversión de hexadecano por E. coli. Además de la característica de conversión de alcanos a alcanoles, E. cepas de E. coli fueron desarrollados con un proceso mejorado para la degradación de los alcoholes y aldehídos por la aplicación de ADH y ALDH genes respectivamente. La actividad de la enzima en los extractos celulares se ensayó in vitro mediante la medición de la producción de NADH a partir de NAD +. La E. cepa coli que expresa la ADH mostró un aumento de dos veces en la actividad de alcohol deshidrogenasa en comparación con la actividad de tipo salvaje. En comparación con la cepa de control, la expresión de la proteína ALDH aumentó la actividad de la deshidrogenasa dodecanal en E. coli cell extrae tres veces. Desde estos ensayos demostraron claramente mayor actividad de la enzima in vitro, se puede especular que la transformó E. cepas de E. coli tienen niveles elevados de actividad in vivo también.

Para explorar la posibilidad de anfitrión inducida por la expresión (por ejemplo: no dependencia de sustancias químicas y la carga de inducción bajo durante el crecimiento), la vía de degradación se expresó bajo el control del promotor pCaiF. Este promotor activa la expresión génica cuando los niveles de glucosa son bajos, por ejemplo. al final de una fase de crecimiento por lotes. Como prueba de principio, este promotor se probó a través de la producción de GFP bajo regímenes de glucosa diferencia. Se demostró que la pCaiF-GFP transformó E. coli produjo más GFP durante estacionaria (glucosa-limitado) fase que en la fase exponencial (niveles altos de glucosa). En presencia de una fuente de carbono secundaria (por ejemplo. Ácido láurico), la tasa de producción de GFP disminuyeron agdebido al catabolismo del carbono secundario-fuente ain.

El experimento mostró que este promotor puede ser utilizado eficazmente para permitir cambios catabólicos de la glucosa a las vías de degradación nuevos. Esto permite que crezca rápidamente una gran cantidad de organismos en medio rico antes de la vía de degradación se activa. Proponemos usar el promotor pCaiF aguas arriba del regulador transcripcional ALK. En Pseudomonas putida, ALKS reconoce C 5-C 10 n-alcanos como efectores. Posteriormente niveles altos de ALK-alcano complejo activar el promotor PalkB resulta en la expresión de las proteínas que codifican alkBFGHJKL operón que participan en la conversión de n-alcanos de ácidos grasos 19.

Detección y conversión de hidrocarburos no es suficiente para que la célula sea viable. A niveles de hidrocarburos crecientes en el medio ambiente, el crecimiento de E. tipo salvaje coli se inhibe mediante la presencia de hidrocarbonos en la membrana y en la célula, lo que puede causar un plegamiento inadecuado. P. horikoshii prefoldin es un chaperón ayudar al plegamiento correcto de la proteína en presencia de alcanos 17. Con él, se predijo que esta proteína interactúa con homólogo de E. proteínas chaperonas coli, lo que sugiere que la sobreexpresión de prefoldin en E. coli podría mejorar la tolerancia al disolvente. Con el BioBrick BBa_K398406 (que consiste en genes phPFDα y phPFDβ), la capacidad de supervivencia de E. coli en presencia de alcanos se mejoró hasta 50%. HIM es una herramienta adecuada para seleccionar los posibles homólogos funcionales.

Considerando la caja de herramientas en su conjunto, se puede concluir que proporciona un primer paso en la construcción de un chasis para la biorremediación de hidrocarburos en ambientes acuosos. Esto representa un pequeño, autónomo, auto-replicantes y relatively método barato. Los resultados fueron adquiridos principalmente a través de ensayos de enzimas y agitar culturas flash y por tanto tienen que ser validados en una escala más grande. La investigación adicional en este sistema debería centrarse en el acoplamiento de las diferentes enzimas, que han sido mostrados aquí para trabajar de forma individual con el fin de generar el sistema previsto para la degradación de los hidrocarburos. Además, la adición de métodos alternativos para la degradación de otros contaminantes podrían también ampliar el uso de este chasis más allá de la biorremediación de hidrocarburos solo a un alcance más amplio de contaminantes y, posiblemente, la implementación de las vías de productos incluso podría utilizar este sistema para la producción de productos químicos valiosos. Nuestros resultados ponen de manifiesto la idoneidad de la estrategia de montaje BioBricks en la biología sintética para construir nuevos organismos que se ocupan de la contaminación por hidrocarburos, y, además, puede ser útil para desarrollar una amplia variedad de otras aplicaciones.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

No hay conflictos de interés declarado.

Acknowledgments

Los experimentos realizados en este video-artículo fueron desarrollados para la competición internacional Genetically Engineered Machine 9. Los autores desean agradecer a los miembros del equipo iGEM Lucas Bergwerff, Pieter van TM Boheemen, Cnossen Jelmer, Hugo F. Cueto Rojas y Ramón van der Valk para la asistencia en la investigación. Agradecemos Han de Winde, Stefan de Kok y Yıldırım Esengul útil para los debates y hosting esta investigación. Este trabajo fue apoyado por la TU Delft University Departamento de Biotecnología, el Laboratorio de Bioinformática Delft, TU Delft Departamento de Bionanoscience, Oil Sands Leadership Initiative (OSLI), Stud studentenuitzendbureau, la Iniciativa de Países Bajos Genómica, Centro Kluyver, Nederlandse Vereniging Biotechnologische (Stichting Biotecnología Nederland) , DSM, Geneart, Greiner Bio-One y Genencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics