Un Toolkit per permettere la conversione di idrocarburi in ambienti acquosi

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Un sistema di regolazione automatica sostenibile batterica per la bonifica di inquinamenti del petrolio è stato progettato utilizzando le normali parti di DNA intercambiabili (BioBricks). L'ingegneria

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Questo lavoro propone una serie di strumenti che consente la conversione di alcani da Escherichia coli e presenta una prova di principio della sua applicabilità. Il toolkit è costituito da più parti standard intercambiabili (BioBricks) 9 riguardanti la conversione di alcani, regolazione dell'espressione genica e della sopravvivenza in idrocarburi tossici ambienti ricchi.

A tre fasi pathway per la degradazione alcano è stato attuato in E. coli per consentire la conversione di alcani media e lunga catena ai loro rispettivi alcanoli, alkanals e infine alcanoico-acidi. Questi ultimi sono stati metabolizzati tramite il nativo di β-ossidazione percorso. Per facilitare l'ossidazione di alcani a catena media (C5-C13) e cicloalcani (C5-C8), quattro geni (alkB2, rubA3, rubA4 e Rubb) del sistema idrossilasi alcano da Gordonia sp. TF6 8,21 sono stati trasformati in E. coli. Per la conversione dialcani a catena lunga (C15-C36), il gene Lada da thermodenitrificans Geobacillus è stato attuato. Per i passaggi necessari ulteriori del processo di degradazione, ADH e ALDH (provenienti da thermodenitrificans G.) sono stati introdotti 10,11. L'attività è stata misurata mediante saggi su cellule quiescenti. Per ogni passaggio ossidativo, l'attività enzimatica è stata osservata.

Per ottimizzare l'efficienza del processo, l'espressione è indotta soltanto in condizioni di glucosio basso: un substrato regolato promotore, pCaiF, è stato utilizzato. pCaiF è presente in E. coli K12 e regola l'espressione dei geni coinvolti nella degradazione del glucosio non fonti di carbonio.

L'ultima parte del toolkit - mira sopravvivenza - è stato implementato utilizzando geni di tolleranza solventi, PhPFDα e β, sia dal Pyrococcus horikoshii OT3. Solventi organici possono indurre stress cellulare e diminuiscono la capacità di sopravvivenza di negativo affecting ripiegamento delle proteine. Come accompagnatori, PhPFDα e β migliorare il ripiegamento ad esempio processi di proteina in presenza di alcani. L'espressione di questi geni ha portato ad un miglioramento della tolleranza idrocarburo mostrato da una crescita maggiore (fino al 50%) in presenze del 10% di n-esano in mezzo di coltura sono stati osservati.

Riassumendo, i risultati indicano che il toolkit consente di E. coli da convertire e tollerare idrocarburi in ambienti acquosi. In quanto tale, rappresenta un primo passo verso una soluzione sostenibile per l'olio-bonifica utilizzando un approccio biologia sintetica.

Protocol

1. BioBrick Assemblea

  1. BioBricks della cancelleria di parti standard biologici sono forniti dalla sede centrale iGEM. Per costruire un nuovo BioBrick BioBricks esistenti, digerire il donatore BioBrick (fino a 1,0 mg) con gli enzimi EcoRI e SpeI di posizionamento dei donatori valle parte della parte accettore. Digerire con XbaI e PstI per posizionare la parte donatore monte della parte accettore. Aggiungi un enzima di restrizione terzo opportuno che interviene la spina dorsale del donatore. Eseguire le digestioni in un volume totale di 20-25 ml con il tampone appropriato, secondo il fornitore (concentrazione finale 1x). Utilizzare 5 unità / mg di DNA per gli enzimi di restrizione.
  2. Digerire l'accettore BioBrick sia con EcoRI e XbaI o SpeI e PstI.
  3. Incubare le digestioni per (almeno) uno hr a 37 ° C. Inattivare le endonucleasi di restrizione da calore, incubazione a 80 ° C per 10 min e centrifugare brevemente.
  4. Legare il BioBrick digeritoparti (donatore e accettore) insieme. Poiché XbaI e SpeI generare estremità DNA compatibili, un sito misto viene creato che non può essere tagliato con qualsiasi enzima di restrizione risultante in una nuova BioBrick 'combinato' che affiancano i quattro siti di restrizione standard. Nella miscela di ligazione del DNA concentrazione finale è preferibilmente ~ 100 ng / pl. Effettuare la reazione di ligazione in un volume totale di 10-15 ml con il tampone di ligazione T4 (concentrazione finale 1x) e ligasi T4 (1 unità / mg di DNA).
  5. Incubare la miscela di ligazione a 16 ° C per almeno 3 ore.
  6. Eseguire la reazione di trasformazione con la metà circa del mix legatura.
  7. Confermare la BioBrick corrette in sequenza.
  8. Per costruire un BioBrick nuovo DNA sintetizzato, modificare i geni per la sintesi per l'espressione ottimale in E. coli mediante lo strumento sito jcat ( http://www.jcat.de/ ). Apportare ulteriori modifiche in conformità con i requisiti del B ioBrick standard. Questa standardizzazione implica che ogni BioBrick è composto da una sequenza di DNA di interesse preceduto da un prefisso e seguito da un suffisso. Il prefisso e suffisso sono sequenze che contengono siti di restrizione predefiniti, che sono assenti nella sequenza rimanente plasmide. Questi siti di restrizione standard, rendono possibile intercambiare ed estendere gli inserti BioBrick flessibile 9. Il prefisso e suffisso sono le seguenti sequenze:
Nome Sequenza Commento
Prefisso 5 'GAATTCGCGGCCGCTTCTAG3'
5 'GAATTCGCGGCCGCTTCTAGAG 3' Se la parte che segue è una sequenza codificante o qualsiasi parte che inizia con "ATG"
Suffisso 5 'TACTAGTAGCGGCCGCTGCAG 3'
ove_title "> 2. Alkane Conversione riposo Assay cellulare, In Vivo

Questo saggio è stato eseguito secondo il metodo descritto da Fujii et al. (2004).

  1. Cultura E. coli che esprimono il sistema Alkane idrossilasi ( BBa_K398014 ) e cellule portando un vettore vuoto ( BBa_J13002 ) in 5 ml di terreno LB con antibiotici appropriati overnight.
  2. Trasferire 500 microlitri della coltura durante la notte in 50 ml di LB fresco (con antibiotico) e incubare fino alla torbidità cella raggiunta una DO (densità ottica) di 0,3 a 600 nm.
  3. Centrifugare per 10 min a 4000 rpm e risospendere il pellet in 5 ml di tampone fosfato 0,1 M (pH 7,4).
  4. Centrifugare nuovamente per 10 min a 4000 rpm e risospendere il pellet in 5 ml di tampone fosfato 0,1 M contenente sali ora E2 e 0,66% v / v glicerolo (azoto-deficienzet media).
  5. Misurare la torbidità cella (OD 600).
  6. Preparare cellule miscela aliquote da 6 ml in 25 ml chiusi con tappo a palloni di vetro e non a cellule di controllo (sali E2 + 0,66% v / v glicerolo).
  7. Aggiungere 100 nmol di alcano a ciascun contenitore.
  8. Incubare le miscele a 37 ° C per 24 ore (quando accorciare tassi più elevati sono ottenuti).
  9. Misurare la OD 600 dopo l'incubazione.
  10. Estrarre gli idrocarburi nei terreni di coltura da acetato di etile e determinare la concentrazione di idrocarburi nella coltura cellulare mediante gascromatografia (vedi protocollo 3).
  11. Calcolare la degradazione per unità di biomassa dividendo la quantità totale di alcano convertito dalla biomassa totale presente in ciascuna beuta (convertire OD 600 al peso secco). Dividendo il risultato per la durata sperimentale produce l'attività di degradazione per unità di biomassa per unità di tempo. La media è tratto da tre singole corse.

3. Alkane conversione saggio enzimatico, inVitro

Questo saggio è stato eseguito essenzialmente secondo il metodo descritto da Li et al. (2008).

  1. Cultura E. coli che esprimono il gene Lada ( BBa_K398017 ) e le cellule che trasportano un vettore vuoto ( BBa_J13002 ) in 50 ml di terreno LB con antibiotici appropriati durante la notte.
  2. Trasferire 500 microlitri della coltura durante la notte in 50 ml di LB fresco (con antibiotico) e incubare fino alla torbidità cella raggiunta una densità ottica di 0,6 a 600 nm.
  3. Centrifugare 10 min a 4000 rpm (4 ° C) e risospendere il pellet in 5 ml di 50 mM di tampone Tris.
  4. Ultrasuoni (Cella disgregatore, LA Biosystems) le cellule a duty cycle del 40% con un controllo di uscita 4, mantenere la soluzione in ghiaccio per tutta la durata.
  5. Centrifugare la miscela risultante per 5 min a 4000 rpm a 4 & deg; C per rimuovere i detriti cellulari. Trasferire il surnatante in un flacone fresco.
  6. Determinare la concentrazione di proteine ​​totali degli estratti di cellule mediante saggio Bradford. Nota: utilizzare fiale di vetro per prevenire l'aumento di sfondo e / o perdita di proteine.
  7. Preparare una miscela di 100 ml contenente 0,1% v / v alcano e 50 mM Tris-HCl.
  8. Scaldare la miscela a 100 ° C per 5 min. Nota: Eseguire questo passaggio solo per i medio-lungo alcani a catena ad alto punto di ebollizione. (Ad esempio C 16: 287 ° C).
  9. Per ottenere una solubilità ottimale del alcano, ultrasuoni per 1 min mentre è ancora caldo fino a omogenea, miscela viscosa si ottiene.
  10. Aggiungere 1 mM di NADH, 1 mM FMN, 1 mM MgSO 4 e 0,01 v / v Triton X-100.
  11. Preparare 6 aliquote ml in 25 ml chiuso con tappo a fiaschi.
  12. Aggiungi adeguate quantità di estratto cellulare (dipende dal test Bradford, la concentrazione finale di 5 mg di proteina / l). Preparare un no-proteina di controllo.
  13. Incubare a 60 ° C (per l'e ottimalenzymatic attività) per 24 ore.
  14. Estrarre gli idrocarburi nei terreni di coltura da acetato di etile e determinare la concentrazione di idrocarburi nella coltura cellulare mediante gascromatografia (vedi protocollo 3).
  15. Calcolare la degradazione per unità di biomassa dividendo la quantità totale di alcano convertito proteina totale aggiunto a ciascun contenitore (Bradford dalla curva di calibrazione). Dividere ulteriormente per durata dell'esperimento produce l'attività di degradazione per unità di proteina cellulare per unità di tempo. La media è tratto da tre singole corse.

4. Etile acetato e di estrazione di idrocarburi misure di concentrazione

  1. Alcani sono estratte dalla soluzione acquosa mediante aggiunta di 2,5 ml di acetato di etile (apolare solvant) a 6 ml soluzione sperimentale. Uno standard interno viene aggiunto al solvente ad una concentrazione di 0,1% (v / v). Lo standard (ad esempio ciclo-decano) varia a seconda del range atteso dei picchi di interesse.
  2. Opzionale: Aggiungi TritonX-100 alla miscela acquosa e centrifugare i campioni per 10 min a 4000 rpm per ottenere un adeguato sistema bifasico.
  3. Agitare la miscela per 5 sec (1500 rpm) e incubare a temperatura ambiente fino a quando le due fasi separate.
  4. Rimuovere una quantità massima dello strato organico (in alto) e asciugare il solvente utilizzando solfato di magnesio anidro.
  5. Rimuovere MgSO4 per filtrazione (0,2 micron) e trasferire il filtrato in fiale di gas cromatografo per misure, o conservare a -20 ° C.
  6. Determinare la concentrazione mediante gascromatografia usando una colonna CP-SIL 5CB (lunghezza = 5 m). Iniettare 10 ml di campione in modalità split (1:10, 230 ° C). Impostare il flusso di gas a colonna 1 ml / min (elio). Il seguente programma di temperatura del forno viene utilizzato:
    Tasso Temperatura [° C] Tempo [min]
    0 50 7,5
    50 90 1,0
    50 110 2,0
    50 130 2,0
    50 145 2,0
    50 160 2,0
    50 170 2,0
    50 185 2,0
    50 210 2,0
    50 250 2,0
    50 320 2,0
  7. Integrare picchi e correggere le concentrazioni rispetto allo standard interno.

5. L'alcol / aldeide deidrogenasi saggio di attività

Questo saggio è stato eseguito essenzialmente secondo il metodo descritto da Kato et al.(2010).

  1. Cultura E. coli che esprimono l'ADH ( BBa_K398018 ) o ALDH ( BBa_K398030 ) gene e le cellule che trasportano un vettore vuoto ( BBa_J13002 ) in 50 ml di terreno LB con antibiotici appropriati durante la notte.
  2. Trasferire 500 microlitri della coltura durante la notte in 50 ml di LB fresco (con antibiotico) e incubare fino alla torbidità cella raggiunta una densità ottica di 0,6 a 600 nm.
  3. Centrifugare 10 min a 4000 rpm a 4 ° C e risospendere il pellet in 5 ml di tampone Tris 50 mM.
  4. Sonicare la soluzione cellulare a duty cycle del 40%, con un controllo di uscita di 4 (conservare la soluzione in ghiaccio durante la sonicazione).
  5. Centrifugare la miscela risultante per 5 min a 4000 rpm a 4 ° C per rimuovere i detriti cellulari.
  6. Determinare la dila concentrazione di proteine ​​Tal degli estratti cellulari da Bradford assay (Nota: utilizzare un flacone di vetro per evitare legame con le proteine).
  7. Caricare una piastra a 96 pozzetti con 180 microlitri 57 mM tampone glicina contenente NAD (concentrazione finale 1 mM, pH 9,5) in ciascun pozzetto.
  8. Aggiungere 5 l di alcool (aldeide) da testare ai pozzetti. Nota: alcoli a catena lunga di calore prima dell'inizio del saggio per avere un liquido. Per ciascun alcole (aldeide) un controllo senza substrato dovrebbe essere aggiunto (controllo negativo). Inoltre, preparare un bianco contenente una miscela di tampone e il substrato senza estratto cellulare.
  9. Preriscaldare il piatto del lettore di piastre (Tecan Magellan v7.0) per 15 min a 37 ° C per raggiungere l'equilibrio del sistema.
  10. Aggiungi adeguate quantità di estratto cellulare (dipende dal test Bradford, la concentrazione finale di 5 mg di proteina / l). Preparare un no-proteina di controllo.
  11. Misurare la produzione di NADH mediante uno spettrofotometro a una lunghezza d'onda di 340 nm ogni 2-3 min per 1 ora a 37 ° C. </ Li>
  12. Calcolare il tasso di produzione di NADH dal versante del OD (340 nm). Prendere in considerazione la lunghezza del percorso di luce e il coefficiente di estinzione del NADH di 6220 M -1 cm -1. Dividere il tasso di produzione di NADH dalla quantità totale di proteine ​​aggiunte per esprimere l'attività della reazione deidrogenasi nel estratto cellulare (U / mg di proteina cellula intera). Calcolare la media e la deviazione standard di tre prove indipendenti.

6. pCaiF Caratterizzazione

  1. Cultura E. coli che esprimono il pCaiF-GFP costrutto ( BBa_K398331 ) e le cellule che trasportano il promotore da solo ( BBa_K398326 ) durante la notte in 5 ml di terreno LB gli antibiotici appropriati durante la notte.
  2. Inoculare 5 ml M9 contenente 10 g / l di glucosio e antibiotici con 50 microlitri della coltura durante la notte e crescere durante la notte. Subculture 50 microlitri della outgrowth overnight in 5 ml di fresca M9 con 10 g / l ed incubare fino alla torbidità cella raggiunta una densità ottica di 0,2 a 600 nm.
  3. Caricare una piastra a 96 pozzetti con 100 pl di mezzo fresco M9 contenente la quantità desiderata di fonte di carbonio per la prova in ciascun pozzetto. Effettuare esperimenti in triplo di valutazione statistica e aggiungere i rispettivi controlli negativi (wild-type E. coli K12).
  4. Aggiungere 5 l di cultura overnight ai pozzetti contenenti medi.
  5. Misurare la curva di crescita (OD 600) e GFP fluorescenza (eccitazione 485 nm e 520 di emissione) utilizzando un lettore di piastra ogni 10 min per 18 ore a 37 ° C con agitazione costante.
  6. Calcolare il tasso di crescita e il contenuto GFP specifico dalle rispettive misurazioni e confrontare al controllo. Calcolare la media e la deviazione standard di almeno tre esperimenti indipendenti.

7. Tolleranza Assay

  1. CulturaE. coli gene che esprime PhPFDα e β ( BBa_K398406 ) durante la notte in 5 ml di terreno LB e gli antibiotici appropriati. E. coli che esprimono LADA gene ( BBa_K398017 ) viene usato come controllo negativo.
  2. Subculture 10 microlitri della outgrowth overnight in fresco 5 ml di LB (con antibiotico) e incubare fino alla torbidità cella raggiunta una densità ottica da 0,3 a 0,4 a 600 nm.
  3. Diluire le culture con terreno fresco fino a quando un OD 600 di 0,1 è stato raggiunto.
  4. Caricare una piastra a 96 pozzetti con 180 microlitri mezzo M9 contenente antibiotici appropriati e la corretta concentrazione finale del composto tossico (per esempio 0, 4, 8, 10% di n-esano) in triplicato. Poiché alcano miscela acqua-potrebbe portare a due sistemi trifase è essenziale avere controlli appropriati sulla piastra (ad esempio dceppi ifferent e gli esperimenti relativi bianco).
  5. Aggiungere 20 microlitri della coltura (controllo) nei pozzetti.
  6. Misurare la concentrazione della biomassa (OD 600) utilizzando un lettore di piastra ogni 10 min per 24 ore a 37 ° C con agitazione costante.
  7. Calcolare i tassi di crescita delle rispettive misurazioni per le diverse concentrazioni di agente e confrontare con il controllo negativo. Calcolare la media e la deviazione standard di almeno tre prove indipendenti.

8. Omologo Interazione Mapping

  1. L'HIM applicazione è stata sviluppata per eseguire query di proteine ​​su un server PostgreSQL in esecuzione il database STRING (gratuito per uso accademico) 20. L'interazione applicazione omologo mappatura identifica le proteine ​​che interagiscono nell'organismo ospite originale utilizzando il database STRING. Le sequenze dei rispettivi geni interagenti sono utilizzati in una ricerca BLAST per trovare geni omologhi nell'organismo bersaglio. Cytoscape 4 https://github.com/jcnossen/InteractionHomologMapping.
  2. Per eseguire una mappatura, (1) inserire l'ID BioBrick e l'applicazione scaricherà automaticamente i dati di sequenza parte dal Registro delle parti standard biologici 9, o (2) Inserire (incolla) i dati di sequenza nell'applicazione.
  3. Utilizza il sito web di database STRING per trovare l'ID di proteine ​​STRING per la sequenza di entrata di amminoacidi.
  4. Una proteina con alta omologia è determinata utilizzando BLAST. Successivamente l'applicazione elenca ciascuna proteina interagente nota nell'organismo di origine e cerca omologhi nell'organismo ospitante (ad esempio E. coli).
  5. Esporta elenco risultante putativo interazione al testo o Cytoscape.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Il principio BioBrick viene utilizzato per costruire un telaio per la degradazione di alcani e una prova di principio per i singoli componenti del toolkit è stato ottenuto. Parecchi saggi sono proposto di misurare in vivo e in vitro di alcano pathway enzimi degradativi. Il lavoro presentato dimostra con successo un certo numero di metodi che possono essere utilizzati per determinare le attività enzimatiche e espressione nell'ospite microrganismo E. coli dopo l'implementazione di BioBricks adatti. Inoltre, è dimostrato che il principio BioBrick può essere utilizzato per progettare un organismo che esprime le proteine ​​necessarie per la degradazione di alcani, fornisce un sistema normativo che produce questi enzimi solo quando necessario e aumenta la tolleranza dell'organismo ospite in presenza di idrocarburi . Una volta ulteriormente sviluppato, questo telaio può essere utilizzato per la degradazione biologica di olio residuo, ad esempio in sabbie bituminose tailing acque, o per il trattamentodelle acque reflue dell'industria petrolifera.

Per quanto riguarda il degrado alcano, saggi sono stati eseguiti per la caratterizzazione degli enzimi coinvolti nella prima fase di degradazione alcano (AH-sistema e LADA). È stato dimostrato che un E. coli ceppo che porta la AH-sistema di Gordonia sp. TF6 era in grado di convertire ottano in vivo. Questo risultato è in accordo con i risultati di Fujii et. al. 8, dove biotrasformazione di n-alcani utilizzando E. coli che esprimono i geni componenti minimi del AH-sistema è stato raggiunto. L'attività di conversione è stata misurata da uno studio comparativo (tipo selvatico vs mutante) dopo un tempo determinato. Per una caratterizzazione completa, ulteriori studi devono essere eseguite sull'attività del AH-sistema nel tempo e la cinetica del sistema.

Per la conversione di alcani a catena lunga (C 15-C 36), il gene LADA da Geobathermodenitrificans cillus è stato attuato. L'attività enzimatica è stata testata in vitro utilizzando esadecano catena lunga come fonte di idrocarburi. Questa modifica E. coli ceppo ha mostrato un aumento di attività enzimatica rispetto al ceppo di controllo, dimostrando la proteina ricombinante Lada permette la conversione di esadecano da E. coli. Oltre alla proprietà di alcani conversione dei alcanoli, E. coli sono stati sviluppati con un processo di degradazione migliorato per gli alcoli e aldeidi per l'attuazione di ADH e geni ALDH rispettivamente. L'attività enzimatica in estratti cellulari è stato testato in vitro misurando la produzione di NADH dal NAD +. La E. coli ceppo esprimendo ADH mostrato un aumento di due volte dell'attività alcol deidrogenasi rispetto all'attività di tipo selvatico. Rispetto al ceppo di controllo, l'espressione della proteina ALDH aumentato l'attività dodecanal deidrogenasi in E. coli celL estrae tre volte. Poiché questi saggi chiaramente dimostrato aumentata attività enzimatica in vitro, si può ipotizzare che la trasformata E. coli hanno livelli elevati di attività in vivo pure.

Per esplorare la possibilità di host-indotta espressione (per esempio: non dipendenza da sostanze chimiche e gli oneri ad induzione bassa durante la crescita), la via di degradazione è stato espresso sotto il controllo del promotore pCaiF. Questo promotore attiva l'espressione genica, quando i livelli di glucosio sono bassi, ad es. al termine di una fase di crescita batch. Come prova di principio, questo promotore è stato testato attraverso la produzione di GFP sotto regimi glucosio differenza. È stato dimostrato che l'pCaiF-GFP trasformato E. coli più GFP prodotta durante stazionaria (glucosio-limitata) fase rispetto alla fase esponenziale (alti livelli di glucosio). In presenza di una fonte di carbonio secondario (ad es. Acido laurico), il tasso di produzione GFP diminuita agdovuta al catabolismo del secondario carbonio-source ain.

L'esperimento ha mostrato che questo promotore può essere efficacemente utilizzato per consentire spostamenti catabolici di glucosio a nuove vie di degradazione. Questo permette di crescere rapidamente una grande quantità di microrganismi in terreno ricco prima che la via di degradazione è attivato. Noi proponiamo di utilizzare il promotore pCaiF a monte del regolatore ALKS trascrizionale. In Pseudomonas putida, ALKS riconosce C 5-C 10 n-alcani come effettori. Successivamente livelli elevati di ALKS-alcano complesso attivano il promotore PalkB conseguente espressione delle proteine ​​alkBFGHJKL operone codifica coinvolti nella conversione delle n-alcani di acidi grassi 19.

Rilevamento e la conversione di idrocarburi non è sufficiente per la cellula di essere redditizia. A livelli crescenti di idrocarburi per l'ambiente, la crescita di tipo selvatico E. coli è inibito dalla presenza di idrocarburi nella membrana e nella cella, che possono causare misfolding. P. horikoshii prefoldin è un chaperone aiutare il corretto ripiegamento della proteina in presenza di alcani 17. Con lui, è stato previsto che questa proteina interagisce con omologo E. coli proteine ​​chaperone, suggerendo che la sovraespressione di prefoldin in E. coli può migliorare la tolleranza al solvente. Con il BioBrick BBa_K398406 (costituito da geni phPFDα e phPFDβ), le possibilità di sopravvivenza di E. coli in presenza di alcani è stata migliorata fino al 50%. LUI è uno strumento atto a selezionare potenziali omologhi funzionali.

Considerando il toolbox nel suo complesso, si può concludere che prevede una prima fase nella costruzione di un telaio per il biorisanamento di idrocarburi in ambienti acquosi. Questo rappresenta un piccolo, autonomo, auto-replicanti e relatively metodo poco costoso. I risultati sono stati principalmente acquisite tramite saggi enzimatici e agitare culture flash e quindi devono essere convalidati su scala più ampia. Ulteriori ricerche su questo sistema deve riguardare l'accoppiamento dei diversi enzimi, che hanno dimostrato qui per lavorare individualmente per generare il sistema previsto per la degradazione di idrocarburi. Inoltre, l'aggiunta di percorsi alternativi per la degradazione di altri inquinanti potrebbe anche espandere l'uso di questo telaio oltre il biorisanamento di idrocarburi alone ad un ambito più ampio di inquinanti, ed eventualmente la realizzazione di percorsi di prodotto potrebbe anche utilizzare questo sistema per la produzione di prodotti chimici di valore. I nostri risultati sottolineano l'adeguatezza della strategia di gruppo BioBricks in biologia sintetica per la costruzione di nuovi organismi che possono trattare l'inquinamento da idrocarburi, e può anche essere utile per sviluppare una vasta gamma di altre applicazioni.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Nessun conflitto di interessi dichiarati.

Acknowledgments

Gli esperimenti condotti in questo video-articolo sono stati sviluppati per il concorso internazionale macchina Genetically Engineered 9. Gli autori desiderano ringraziare i membri del team iGEM Luca Bergwerff, Pieter van TM Boheemen, Jelmer Cnossen, Hugo F. Cueto Rojas e Ramon van der Valk per l'assistenza nella ricerca. Ringraziamo Han de Winde, Stefan de Kok e Esengül Yıldırım per le discussioni utili e che ospitano questa ricerca. Questo lavoro è stato sostenuto dal TU Delft University Dipartimento di Biotecnologie, Il laboratorio di Bioinformatica Delft, TU Delft Dipartimento di Bionanoscience, Oil Sands Leadership Initiative (OSLI), Stud studentenuitzendbureau, Paesi Bassi Genomics Initiative, Kluyver Centro, Nederlandse Vereniging Biotechnologische (Stichting Biotecnologie Nederland) , DSM, Geneart, Greiner Bio-One e Genencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics