Une boîte à outils pour permettre la conversion d'hydrocarbures en milieu aqueux

Bioengineering
 

Summary

Un système de régulation automatique durable bactérienne pour l'assainissement des pollutions pétrolières a été conçu en utilisant des pièces interchangeables (ADN BioBricks). Une ingénierie

Cite this Article

Copy Citation | Download Citations

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ce travail met en avant un ensemble d'outils qui permet la conversion d'alcanes par Escherichia coli et présente une preuve de principe de son applicabilité. La boîte à outils se compose de plusieurs éléments standards interchangeables (BioBricks) 9 portant sur ​​la conversion d'alcanes, la régulation de l'expression génique et la survie des toxiques riches en hydrocarbures environnements.

Un parcours en trois étapes pour la dégradation de l'alcane a été mis en œuvre dans E. coli afin de permettre la conversion d'alcanes à moyen et à longue chaîne à leurs alcanols, alcanals respectives et, finalement, des acides alcanoïque. Ces derniers ont été métabolisé par le natif de β-oxydation voie. Pour faciliter l'oxydation des alcanes à chaîne moyenne (C5-C13) et de cycloalcanes (C5-C8), quatre gènes (alkB2, rubA3, rubA4 et Rubb) du système alcane hydroxylase de Gordonia sp. TF6 8,21 ont été transformés en E. coli. Pour la conversion desalcanes à longue chaîne (C15-C36), le gène de Lada thermodenitrificans Geobacillus a été mis en œuvre. Pour les autres étapes nécessaires du processus de dégradation, l'ADH et l'ALDH (provenant de thermodenitrificans G.) ont été introduites 10,11. L'activité a été mesurée par des dosages de cellules au repos. Pour chaque étape d'oxydation, l'activité enzymatique a été observée.

Afin d'optimiser l'efficacité des processus, l'expression n'a été induite dans des conditions hypoglycémie: un promoteur régulé substrat, pCaiF, a été utilisé. pCaiF est présent dans E. coli K12 et régule l'expression des gènes impliqués dans la dégradation de la source de carbone non-glucose.

La dernière partie de la trousse à outils - le ciblage de survie - a été mis en œuvre en utilisant des gènes de tolérance solvants, PhPFDα et β, deux de Pyrococcus horikoshii OT3. Les solvants organiques peuvent induire un stress cellulaire et une diminution de la survie par négativement affectinrepliement des protéines g. Comme chaperons, PhPFDα et β améliorer le processus de repliement des protéines, par exemple en présence d'alcanes. L'expression de ces gènes conduit à une tolérance améliorée d'hydrocarbures montré un taux de croissance élevé (jusqu'à 50%) dans les présences de 10% de n-hexane dans le milieu de culture ont été observés.

En résumé, les résultats indiquent que la boîte à outils permet E. coli à convertir et à tolérer les hydrocarbures dans les milieux aqueux. En tant que tel, il constitue une première étape vers une solution durable pour le pétrole-remédiation en utilisant une approche de biologie synthétique.

Protocol

1. BioBrick Assemblée

  1. BioBricks du Registre de pièces normalisées biologiques sont fournis par le siège iGEM. Pour construire une nouvelle BioBrick de BioBricks existants, digérer le donateur (jusqu'à 1,0 mg) BioBrick par les enzymes EcoRI et Spel pour le positionnement de la partie aval des bailleurs de fonds de la part accepteur. Digestion par XbaI et PstI pour positionner le donneur de la pièce en amont de la partie accepteur. Ajouter une troisième enzyme de restriction appropriée qui coupe dans le squelette du donneur. Effectuer les digestions dans un volume total de 20-25 ml avec le tampon approprié, selon le fournisseur (concentration finale 1x). Utilisez 5 unités / mg d'ADN pour les enzymes de restriction.
  2. Digérer l'accepteur BioBrick soit avec EcoRI et XbaI ou Spel et PstI.
  3. Incuber les digestions pour (au moins) une heure à 37 ° C. Inactiver les endonucléases de restriction par la chaleur, l'incubation à 80 ° C pendant 10 min et centrifugation sous peu.
  4. Ligaturer le BioBrick digéréparties (donneur et accepteur) ensemble. Depuis Xbal et Spel générer des extrémités d'ADN compatibles, un site mixte est créé, qui ne peut pas être coupé avec une enzyme de restriction résultant en une nouvelle «combiné» BioBrick qui flanquaient par les 4 sites de restriction standard. Dans le mélange de ligature de la concentration finale en ADN est de préférence ~ 100 ng / ul. Effectuer la réaction de ligature dans un volume total de 10-15 ml avec le tampon de ligature T4 (concentration finale 1 x) et la T4 ligase (1 unité / mg d'ADN).
  5. Incuber le mélange de ligature à 16 ° C pendant au moins 3 h.
  6. Effectuer réaction de transformation de la moitié vers le mélange de ligature.
  7. Confirmez le BioBrick comme correctes pour le séquençage.
  8. Pour construire une nouvelle BioBrick de l'ADN synthétisé, de modifier les gènes de synthèse pour une expression optimale dans E. coli à l'aide de l'outil de site JCAT ( http://www.jcat.de/ ). Apporter d'autres modifications, conformément aux exigences de la B ioBrick standard. Cette standardisation implique que chaque BioBrick est composé d'une séquence d'ADN d'intérêt précédée d'un préfixe et d'un suffixe suivi. Le préfixe et le suffixe sont des séquences qui contiennent des sites de restriction prédéfinis, qui sont absents dans le reste de la séquence du plasmide. Ces sites de restriction standards permettent d'échanger et de prolonger les inserts BioBrick flexible 9. Les préfixes et suffixes ont les séquences suivantes:
Nom Séquence Commenter
Préfixe 5 'GAATTCGCGGCCGCTTCTAG3'
5 'GAATTCGCGGCCGCTTCTAGAG 3' Si la partie qui suit est une séquence codante ou toute partie qui commence par "ATG"
Suffixe 5 'TACTAGTAGCGGCCGCTGCAG 3'
ove_title "> 2. Conversion alcane cellule de dosage de repos, In Vivo

Cet essai a été effectué sur la base de la méthode décrite par Fujii et al. (2004).

  1. Culture E. coli exprimant les cellules du système alcane hydroxylase ( BBa_K398014 ) et les cellules portant un vecteur vide ( BBa_J13002 ) dans 5 ml de milieu LB avec des antibiotiques appropriés pendant la nuit.
  2. Transfert 500 pi de la culture d'une nuit dans 50 ml de LB frais (avec un antibiotique) et incuber jusqu'à ce que la turbidité des cellules a atteint une DO (densité optique) de 0,3 à 600 nm.
  3. Centrifuger pendant 10 min à 4000 rpm et remettre en suspension le culot dans 5 ml de tampon phosphate 0,1 M (pH 7,4).
  4. Centrifuger à nouveau pendant 10 min à 4000 rpm et remettre en suspension le culot dans 5 ml de tampon phosphate 0,1 M contenant des sels maintenant E2 et 0,66% v / v de glycérol (azote carencest moyen).
  5. Mesurer la turbidité cellulaire (DO 600).
  6. Préparer cellule-mélange des aliquotes de 6 ml dans des flacons de 25 ml en verre fermé d'assemblage et les contrôles non-cellulaires (E2 + 0,66 sels% v / v de glycérol).
  7. Ajouter 100 nmol d'alcane dans chaque flacon.
  8. Incuber les mélanges à 37 ° C pendant 24 heures (raccourcir lorsque des taux plus élevés sont obtenus).
  9. Mesurer la DO 600 après incubation.
  10. Extraire les hydrocarbures dans les milieux de culture par l'acétate d'éthyle et de déterminer la concentration d'hydrocarbures en culture cellulaire par chromatographie en phase gazeuse (voir le protocole 3).
  11. Calculer la dégradation par unité de biomasse en divisant la quantité totale d'alcane converti par la biomasse totale présente dans chaque fiole (OD 600 à convertir la matière sèche). En divisant le résultat par la durée expérimentale donne l'activité de dégradation par unité de biomasse par unité de temps. La moyenne est calculée à partir de trois points différents.

3. Essai alcane enzyme de conversion, enVitro

Cet essai a été réalisé essentiellement selon la méthode décrite par Li et al. (2008).

  1. Culture E. cellules de E. coli exprimant le gène de Lada ( BBa_K398017 ) et les cellules portant un vecteur vide ( BBa_J13002 ) dans 50 ml de milieu LB avec des antibiotiques appropriés pendant la nuit.
  2. Transfert 500 pi de la culture d'une nuit dans 50 ml de LB frais (avec un antibiotique) et incuber jusqu'à ce que la turbidité des cellules a atteint une densité optique de 0,6 à 600 nm.
  3. Centrifuger 10 min à 4000 rpm (4 ° C) et remettre en suspension le culot dans 5 ml de tampon Tris 50 mM.
  4. Soniquer (cellulaire perturbateur, LA Biosystems), les cellules à rapport cyclique de 40% avec une commande de sortie de 4, maintenir la solution sur de la glace pendant toute la durée.
  5. Centrifuger le mélange résultant pendant 5 min à 4000 rpm à 4 & dpar exemple, C pour éliminer les débris cellulaires. Transférer le surnageant dans un nouveau tube.
  6. Déterminer la concentration totale en protéines des extraits cellulaires par dosage de Bradford. Remarque: Utilisez des flacons en verre pour empêcher l'augmentation du fond et / ou la perte de protéines.
  7. Préparer un mélange 100 ml contenant 0,1% en volume / volume d'alcane et 50 mM de tampon Tris-HCl.
  8. Chauffer le mélange à 100 ° C pendant 5 min. Remarque: Effectuez cette étape uniquement pour les alcanes à chaîne moyenne et longue avec un point d'ébullition élevé. (Par exemple C 16: 287 ° C).
  9. Pour obtenir une solubilité optimale de l'alcane, une sonication pendant 1 min encore chaude jusqu'à ce qu'une homogène, mélange visqueux est obtenu.
  10. Ajouter 1 mM de NADH, 1 mM FMN, 1 mM de MgSO 4 et 0,01 v / v de Triton X-100.
  11. Préparez 6 ml d'aliquotes de 25 ml à bouchon fermé flacons.
  12. Ajouter une quantité suffisante d'extrait cellulaire (dépend de tests Bradford, la concentration finale de 5 mg de protéine / l). Préparer un témoin sans protéines.
  13. Incuber à 60 ° C (par e optimalenzymatic activité) pendant 24 heures.
  14. Extraire les hydrocarbures dans les milieux de culture par l'acétate d'éthyle et de déterminer la concentration d'hydrocarbures en culture cellulaire par chromatographie en phase gazeuse (voir le protocole 3).
  15. Calculer la dégradation par unité de biomasse en divisant la quantité totale d'alcane converti en protéine totale dans chaque fiole (par Bradford courbe d'étalonnage). En outre la division de la durée du test donne l'activité de dégradation par unité de protéine cellulaire par unité de temps. La moyenne est calculée à partir de trois points différents.

4. Ethyl Acetate extraction d'hydrocarbures et de concentration

  1. Alcanes sont extraits de la solution aqueuse en ajoutant 2,5 ml d'acétate d'éthyle (solvant apolaire) pour solution expérimentale 6 ml. Un étalon interne est ajouté au solvant à une concentration de 0,1% (v / v). La norme (par exemple cyclo-décane) varie en fonction de la fourchette prévue des pics d'intérêt.
  2. Facultatif: Ajouter TritonX-100 pour le mélange aqueux et centrifuger les échantillons pendant 10 min à 4000 rpm afin d'obtenir un bon système biphasique.
  3. Vortex le mélange pendant 5 sec (1,500 rpm) et incuber à température ambiante jusqu'à ce que les deux phases se séparent.
  4. Suppression d'un montant maximal de la couche organique (en haut) et sécher le solvant en utilisant du sulfate de magnésium anhydre.
  5. Retirer MgSO 4 par filtration (0,2 um) et transférer le filtrat dans des flacons chromatographe en phase gazeuse pour la mesure, ni le conserver à -20 ° C.
  6. Déterminer la concentration par chromatographie en phase gazeuse en utilisant une colonne CP-SIL 5CB (longueur = 5 m). Injecter 10 ul d'échantillon en mode split (1:10, 230 ° C). Régler le débit de gaz colonne à 1 ml / min (Hélium). Le programme du four suivant la température est utilisée:
    Taux Température [° C] Temps [min]
    0 50 7,5
    50 90 1,0
    50 110 2,0
    50 130 2,0
    50 145 2,0
    50 160 2,0
    50 170 2,0
    50 185 2,0
    50 210 2,0
    50 250 2,0
    50 320 2,0
  7. Intégrer les pics et corriger les concentrations par rapport à l'étalon interne.

5. Alcool / Test d'activité aldéhyde déshydrogénase

Cet essai a été réalisé essentiellement selon la méthode décrite par Kato et al.(2010).

  1. Culture E. cellules de E. coli exprimant l'ADH ( BBa_K398018 ) ou ALDH ( BBa_K398030 ) des gènes et des cellules portant un vecteur vide ( BBa_J13002 ) dans 50 ml de milieu LB avec des antibiotiques appropriés pendant la nuit.
  2. Transfert 500 pi de la culture d'une nuit dans 50 ml de LB frais (avec un antibiotique) et incuber jusqu'à ce que la turbidité des cellules a atteint une densité optique de 0,6 à 600 nm.
  3. Centrifuger 10 min à 4000 rpm à 4 ° C et remettre en suspension le culot dans 5 ml de tampon Tris 50 mM.
  4. Soniquer la solution de cellules au facteur de marche 40%, avec une commande de sortie de 4 (maintenir la solution sur de la glace pendant la sonication).
  5. Centrifuger le mélange résultant pendant 5 min à 4000 rpm à 4 ° C pour éliminer les débris cellulaires.
  6. Déterminer le àconcentration en protéines tal des extraits cellulaires par Bradford dosage (Remarque: utiliser un flacon en verre pour empêcher la liaison des protéines).
  7. Chargez une plaque de 96 puits avec 180 pl 57 mM tampon glycine contenant du NAD (concentration finale 1 mM, pH 9,5) dans chaque puits.
  8. Ajouter 5 ul de l'alcool (aldéhyde) à tester dans les puits. Remarque: les alcools à longue chaîne de chaleur avant le début de l'essai d'avoir un liquide. Pour chaque alcool (aldéhyde) un contrôle sans substrat doit être ajouté (témoin négatif). En outre, de préparer une ébauche qui contient un mélange de tampon et le substrat sans extrait cellulaire.
  9. Préchauffer la plaque de la plaque (Tecan Magellan v7.0) lecteur pendant 15 min à 37 ° C pour permettre l'équilibrage du système.
  10. Ajouter une quantité suffisante d'extrait cellulaire (dépend de tests Bradford, la concentration finale de 5 mg de protéine / l). Préparer un témoin sans protéines.
  11. Mesurer la production de NADH l'aide d'un spectrophotomètre à une longueur d'onde de 340 nm toutes les 2-3 minutes pendant 1 heure à 37 ° C. </ Li>
  12. Calculer le taux de production de NADH à partir de la pente de la DO (340 nm). Prendre en compte la longueur de trajet de la lumière et le coefficient d'extinction du NADH de 6220 M -1 cm -1. Diviser le rythme de production de NADH par la quantité totale de protéine ajoutée à exprimer l'activité de la déshydrogénase de réaction dans l'extrait cellulaire (U / mg de protéine de cellule entière). Calculer la moyenne et l'écart type de trois essais indépendants.

6. Caractérisation pCaiF

  1. Culture E. cellules exprimant la construction coli pCaiF-GFP ( BBa_K398331 ) et les cellules portant le promoteur seul ( BBa_K398326 ) pendant une nuit dans 5 ml de milieu LB les antibiotiques appropriés pendant la nuit.
  2. Inoculer 5 ml M9 contenant 10 g / l de glucose et les antibiotiques avec 50 ul de la culture de la nuit et du jour au lendemain se développer. Subculture 50 pl de l'excroissance du jour au lendemain dans 5 ml de frais M9 avec 10 g / l et incuber jusqu'à ce que la turbidité des cellules a atteint une densité optique de 0,2 à 600 nm.
  3. Chargez une plaque de 96 puits avec 100 ul de milieu M9 frais contenant la quantité désirée de source de carbone pour les essais dans chaque puits. Effectuer trois expériences pour l'évaluation statistique et ajoutez les contrôles respectifs négatifs (de type sauvage de E. coli K12).
  4. Ajouter 5 ul de la culture d'une nuit dans les puits milieu contenant.
  5. Mesurer la courbe de croissance (DO 600) et fluorescence de la GFP (485 nm d'excitation et 520 émissions) en utilisant un lecteur de plaque toutes les 10 minutes pendant 18 heures à 37 ° C avec une agitation constante.
  6. Calculer le taux de croissance et la teneur en GFP spécifique des mesures respectives et le comparer au contrôle. Calculer la moyenne et l'écart type d'au moins trois expériences indépendantes.

7. Essai de tolérance

  1. CultureE. coli exprimant le gène PhPFDα et β ( BBa_K398406 ) pendant une nuit dans 5 ml de milieu LB et les antibiotiques appropriés. E. coli exprimant Lada gène ( BBa_K398017 ) est utilisé comme contrôle négatif.
  2. Subculture 10 pi du jour au lendemain en conséquence frais 5 ml de LB (avec un antibiotique) et incuber jusqu'à ce que la turbidité des cellules a atteint une densité optique de 0,3 à 0,4 à 600 nm.
  3. Diluer les cultures avec du milieu frais jusqu'à une DO600 de 0,1 est atteint.
  4. Chargez une plaque de 96 puits avec 180 ul de milieu M9 contenant les antibiotiques appropriés et la concentration finale appropriée du composé toxique (par exemple, 0, 4, 8, 10% de n-hexane) en trois exemplaires. Parce que alcane mélanges d'eau et pourrait conduire à des systèmes à deux phases, il est essentiel d'avoir des contrôles appropriés sur la plaque (par exemple, différents souches et les expériences respectives en blanc).
  5. Ajouter 20 ul de la culture (contrôle) dans les puits.
  6. Mesurer la concentration de la biomasse (OD 600) en utilisant un lecteur de plaque toutes les 10 minutes pendant 24 heures à 37 ° C avec une agitation constante.
  7. Calculer les taux de croissance à partir des mesures respectives pour les différentes concentrations de l'agent et le comparer au contrôle négatif. Calculer la moyenne et l'écart type d'au moins trois essais indépendants.

8. Cartographie interaction homologue

  1. L'application a été développée pour LUI effectuer des requêtes de protéines sur un serveur PostgreSQL la base de données STRING (gratuit pour un usage académique) 20. L'application de cartographie homologue de l'interaction identifie les protéines qui interagissent dans l'organisme hôte d'origine en utilisant la base de données STRING. Les séquences des gènes respectifs interaction sont utilisés dans une recherche BLAST pour trouver des gènes homologues dans l'organisme cible. Cytoscape 4 https://github.com/jcnossen/InteractionHomologMapping.
  2. Pour effectuer une cartographie, (1) entrez l'ID BioBrick et l'application va automatiquement télécharger les données de séquence de pièces tirées du Registre des standards biologiques Pièces 9, ou (2) ENTRER (coller) les données de séquence dans l'application.
  3. Utilisez le site Web de la base de données STRING pour trouver l'ID de protéines STRING pour la séquence d'acides aminés entré.
  4. Une protéine ayant une forte homologie est déterminée en utilisant BLAST. Par la suite, l'application répertorie chaque protéine d'interaction connue dans l'organisme source et recherche des homologues dans l'organisme hôte (par exemple E. coli).
  5. Exporter découlant liste interaction putative de texte ou Cytoscape.

Discussion

Le principe BioBrick est utilisé pour construire un châssis pour la dégradation des alcanes et une preuve de principe pour les composants individuels de la boîte à outils a été obtenu. Plusieurs dosages sont proposés pour mesurer l'in vivo et in vitro l'activité des enzymes de la voie d'alcanes dégradantes. Le travail présenté démontre avec succès un certain nombre de méthodes qui peuvent être utilisées pour déterminer l'activité des enzymes et de l'expression dans l'organisme hôte E. coli après la mise en œuvre de BioBricks appropriés. Par ailleurs, il est montré que le principe BioBrick peut être utilisé pour concevoir un organisme qui exprime des protéines nécessaires à la dégradation des alcanes, propose un système de régulation qui produit ces enzymes seulement lorsque c'est nécessaire et augmente la tolérance de l'organisme hôte en présence d'hydrocarbures . Une fois développée, ce châssis peut être utilisée pour la dégradation biologique de l'huile résiduelle, par exemple, dans les eaux de décantation des sables bitumineux, ou pour le traitementdes eaux usées de l'industrie pétrolière.

En ce qui concerne la dégradation des alcanes, des essais ont été effectués pour la caractérisation des enzymes impliquées dans la première étape de la dégradation des alcanes (AH-système et Lada). Il a été démontré qu'une E. coli souche portant le AH-système de Gordonia sp. TF6 a été en mesure de convertir l'indice d'octane in vivo. Ce résultat est en accord avec les résultats de Fujii et al. al. 8, où la biotransformation des n-alcanes en utilisant E. coli exprimant les gènes composants minimales de l'AH-système a été atteint. L'activité de conversion a été mesurée par une étude comparative (type sauvage vs mutant) après un temps donné. Pour une caractérisation complète, des études complémentaires doivent être effectuées sur l'activité de l'AH-système au cours du temps et de la cinétique du système.

Pour la conversion des alcanes à longue chaîne (C 15-C 36), le gène de Lada Geobathermodenitrificans cillus a été mis en œuvre. L'activité enzymatique a été testée in vitro en utilisant comme source d'hexadécane hydrocarbure à chaîne longue. Cette modification E. coli souche a montré une activité enzymatique accrue par rapport à la souche témoin, ce qui démontre la protéine recombinante Lada permet la conversion de l'hexadécane par E. coli. Outre la propriété des alcanes de conversion à alcanols, E. coli ont été développés avec un processus de dégradation améliorée pour les alcools et aldéhydes par la mise en œuvre de l'ADH et gènes ALDH respectivement. L'activité de l'enzyme dans les extraits cellulaires a été testée in vitro par la mesure de la production de NADH à partir de NAD +. L'E. coli souche exprimant ADH a montré une augmentation de deux fois de l'activité alcool déshydrogénase par rapport à l'activité de type sauvage. Par rapport à la souche témoin, l'expression de la protéine ALDH a augmenté l'activité déshydrogénase dodécanal dans E. cel colil extrait trois fois. Étant donné que ces essais ont clairement démontré augmentation de l'activité enzymatique in vitro, on peut supposer que la transformée E. coli ont des niveaux élevés d'activité in vivo ainsi.

Pour explorer la possibilité de l'hôte induite par l'expression (par exemple: la non-dépendance sur les produits chimiques et les charges d'induction basse pendant la végétation), la voie de dégradation a été exprimé sous le contrôle du promoteur pCaiF. Ce promoteur active l'expression des gènes lorsque la glycémie est basse, par exemple. à la fin d'une phase de croissance lot. Comme une preuve de principe, ce promoteur a été testé via la production de GFP sous des régimes de glucose différence. Il a été démontré que la pCaiF-GFP transformé E. coli a produit plus GFP pendant stationnaire (limité en glucose) de phase que dans la phase exponentielle (taux de glucose élevé). En présence d'une source de carbone secondaire (p. ex. L'acide laurique), le taux de production de la GFP a diminué agdue au catabolisme du carbone-source secondaire ain.

L'expérience a montré que ce promoteur peut être utilisé efficacement pour permettre des changements cataboliques du glucose à de nouvelles voies de dégradation. Cela permet de développer rapidement une grande quantité d'organismes dans un milieu riche avant la voie de dégradation est activée. Nous proposons d'utiliser le promoteur pCaiF amont du régulateur transcriptionnel AlkS. Dans Pseudomonas putida, AlkS reconnaît en C 5-C 10 n-alcanes comme effecteurs. Par la suite des niveaux élevés de AlkS-alcane complexe activer le promoteur PalkB résultant en l'expression de l'opéron codant pour les protéines alkBFGHJKL impliqués dans la conversion des n-alcanes en acides gras 19.

Détection et la conversion des hydrocarbures n'est pas suffisant pour que la cellule soit viable. À des niveaux croissants d'hydrocarbures dans l'environnement, la croissance de type sauvage E. coli est inhibée par la présence d'hydroatomes de carbone dans la membrane et dans la cellule, ce qui peut causer des mauvais repliement des protéines. P. horikoshii préfoldine est un chaperon aider le repliement correct de la protéine en présence d'alcanes 17. Utilisation LUI, il était prévu que cette protéine interagit avec homologue E. protéines chaperonnes coli, ce qui suggère que la surexpression de préfoldine dans E. coli pourrait améliorer la tolérance au solvant. Avec le BioBrick BBa_K398406 (constitué des gènes phPFDα et phPFDβ), la capacité de survie de E. coli en présence des alcanes a été améliorée de 50%. HIM est un outil approprié pour sélectionner potentiels homologues fonctionnels.

Compte tenu de la boîte à outils dans son ensemble, il peut être conclu qu'il fournit une première étape dans la construction d'un châssis pour la bioremédiation d'hydrocarbures dans les milieux aqueux. Cela représente un petit, autonome, auto-réplication et relatively méthode peu coûteuse. Les résultats ont été principalement acquis par des dosages enzymatiques et secouer cultures flash et ont donc besoin d'être validés sur une plus grande échelle. Des recherches plus poussées sur ce système devrait se concentrer sur le couplage des différentes enzymes, qui ont été présentés ici de travailler individuellement afin de générer le système envisagé pour la dégradation des hydrocarbures. En outre, l'ajout de voies alternatives pour la dégradation des polluants autres pourrait ainsi étendre l'utilisation de ce châssis au-delà de la bioremédiation des hydrocarbures seule à un plus large éventail de polluants, et peut-être la mise en œuvre des voies de produits pourrait même utiliser ce système pour la production de produits chimiques précieux. Nos résultats mettent en évidence la pertinence de la stratégie d'assemblage BioBricks de la biologie synthétique pour construire de nouveaux organismes qui peuvent faire face à la pollution par hydrocarbures, et peut en outre être utile d'élaborer une grande variété d'autres applications.

Disclosures

Aucun conflit d'intérêt déclaré.

Acknowledgments

Les expériences réalisées dans cette vidéo-article ont été développés pour la compétition machine génétiquement internationale 9. Les auteurs tiennent à remercier les membres de l'équipe iGEM Luc Bergwerff, Pieter van TM Boheemen, Jelmer Cnossen, Hugo F. Rojas et Ramon Cueto van der Valk pour l'aide à la recherche. Nous remercions Han de Winde, Stefan de Kok et Esengül Yıldırım pour des discussions utiles et d'hébergement de cette recherche. Ce travail a été soutenu par le ministère de la TU Delft University of Biotechnology, Delft Le laboratoire de bioinformatique, TU Delft Département de Bionanoscience, Oil Sands Leadership Initiative (OSLI), Stud studentenuitzendbureau, Pays-Bas Initiative en génomique, Kluyver Centre, Nederlandse Vereniging Biotechnologische (Stichting Nederland Biotechnologie) , DSM, Geneart, Greiner Bio-One et Genencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics