في الصعق الكهربائي من البيضة ميرنا القائم على البلازميدات في أنبوب للتطوير والعصبية تقييم نمط ظاهري من حقن مبادرة ديزرتك الصناعية في الكتاب المفتوح الاستعدادات

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

ووصف الطريقة التي التعبير الجيني في الأنبوب العصبي يمكن أن يكون downregulated بطريقة الخلية، اكتب محددة يمكن عزوها. نحن لشرح كيفية

Cite this Article

Copy Citation | Download Citations

Wilson, N. H., Stoeckli, E. T. In ovo Electroporation of miRNA-based Plasmids in the Developing Neural Tube and Assessment of Phenotypes by DiI Injection in Open-book Preparations. J. Vis. Exp. (68), e4384, doi:10.3791/4384 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

تم صواري dI1 الخلايا العصبية درس على نطاق واسع لتوضيح الآليات الكامنة والتوجيه محور عصبي خلال 1،2 التنمية. وتقع هذه الخلايا العصبية في النخاع الشوكي الظهري وإرسال محاور عصبية على طول مسارات النمطية. محاور عصبية صواري المشروع في البداية ثم بطنيا نحو عبر floorplate. بعد عبور خط الوسط، وهذه المحاور جعل منعطفا حادا منقاري والمشروع طوليا نحو الدماغ. وينظم كل من هذه الخطوات من قبل العظة من الأنشطة المنسقة جذابة ومثيرة للاشمئزاز التوجيه. التفسير الصحيح لهذه العظة هو أمر حاسم في توجيه محاور عصبية على طول الطريق من ترسيمها. وهكذا، يتم التحقيق بشكل مثالي مساهمة الفسيولوجية للجزيء خاص لتوجيه محور عصبي صواري في سياق الجنين المعيشة. وفقا لذلك، لا بد من ضربة قاضية الجينات في الجسم الحي تسيطر على وجه التحديد من أجل التمييز بعناية أنشطة التوجيه محور عصبي من الجينات التي قد تلعب متعددةالأدوار خلال التنمية.

هنا، نحن تصف طريقة لضربة قاضية التعبير الجيني في الأنبوب العصبي الدجاج بطريقة الخلية، اكتب محددة يمكن عزوها. نستخدم ناقلات بلازميد رواية 3 بإيواء الخلايا من نوع محدد المروجين / القدرة التي تدفع التعبير عن بروتين فلوري علامة، يتبعها مباشرة نسخة miR30-رني 4 (تقع داخل UTR-3'من [كدنا] ترميز البروتين الفلورسنت) ( الشكل 1). عندما electroporated في أنبوب للالعصبية النامية، هذه النواقل حصول downregulation كفاءة في التعبير الجيني والتعبير عن البروتينات علامة مشرقة الفلورسنت لتمكين تتبع مباشرة من الخلايا التي تعاني من ضربة قاضية 3. خلط مختلفة ناقلات رني قبل الصعق الكهربائي في وقت واحد يسمح للضربة قاضية من اثنين أو أكثر من الجينات في المناطق المستقلة من الحبل الشوكي. هذه التفاعلات المعقدة يسمح الخلوية والجزيئية للفحص خلال التنمية، على نحو سريع، قimple ودقيقة وغير مكلفة. بالاشتراك مع مبادرة ديزرتك الصناعية تتبع مسارات محور عصبي صواري في كتاب مفتوح التحضيرات هذا الأسلوب هو أداة مفيدة لفي الدراسات المجراة من الآليات الخلوية والجزيئية للنمو محور عصبي صواري والتوجيه. من حيث المبدأ، يمكن أن تستخدم أي مروج / محسن، مما يجعل هذه التقنية يحتمل أكثر قابلية للتطبيق على نطاق واسع لفي الدراسات المجراة من خلال وظيفة الجين التنمية 6.

هذا الفيديو يوضح أولا كيف للتعامل مع نافذة والبيض، وحقن البلازميدات الحمض النووي في الأنبوب العصبي وإجراءات الصعق الكهربائي. للتحقيق في صواري التوجيه محور عصبي، تتم إزالة الحبل الشوكي من الجنين باعتباره إعداد كتاب مفتوح، ثابتة، وحقنوا مبادرة ديزرتك الصناعية للتمكين من تتبع مسارات محور عصبي. هي التي شنت الحبل الشوكي بين coverslips وتصور باستخدام المجهر متحد البؤر.

Protocol

1. إعداد DNA البلازميد رني لإسكات الجينات الخلوية من نوع محدد

البلازميدات (الشكل 1) تم تجميعها باستخدام معيار تقنيات الاستنساخ الجزيئي، كما هو موضح سابقا بالتفصيل 3،4.

1،1 الاستنساخ في ناقلات: تصميم oligonucelotide

  1. نستخدم نفس أليغنوكليوتيد] والبروتوكولات العالمية الاستنساخ التي تم وصفها في المعلومات المقدمة مع المنتج الموجه pRFPRNAiC 4 (ARK-الجينوم).
    1. لالاستنساخ في موقع القاسي الأولى:
      5 'التمهيدي HP1:
      5'-GGCGGGGCTAGCTGGAGAAGATGCCTTCCGGAGAGGTGCTGCTGAGCG
      3 'التمهيدي HP1:
      5'-GGGTGGACGCGTAAGAGGGGAAGAAAGCTTCTAACCCCGCTATTCACCACCACTAGGCA
    2. لالاستنساخ في موقع القاسي الثاني:
      HP2 التمهيدي 5 ':
      5'-GGCGGGACGCGTGCTGTGAAGATCCGAAGATGCCTTGCGCTGGTTCCTCCGTGAGCG
      3 'HP2 التمهيدي:
    3. 5'-CGCCGCGCATGCACCAAGCAGAGCAGCCTGAAGACCAGTAGGCA
  2. نستخدم الباحث عن Genscript المستهدف لتحديد تسلسل سيرنا الهدف الجينات محددة: https://www.genscript.com/ssl-bin/app/rnai .
  3. الاشعال لاستنساخ الجين ميرنا محددة في موقع القاسي الأولى:

يتم عرض مثال لإسكات GFP أدناه.
تسلسل الهدف (22nt): 5'-GGCACAAGCTGGAGTACAACTA
GFP إلى الأمام HP1 = 59mer
تسلسل 1
GFP عكس HP1 = 58mer
تسلسل 2
هناك تسلسل المشتركة في هذه oligos التي تشكل جزءا من تسلسل ميرنا المرافقة (الدجاج محددة)، وحلقة مشتركة / تسلسل الجذعية (من miRNA30 الإنسان). وشدد على تسلسل الجين المستهدف محددة. لاحظ أن هناك AMismatch في قاعدة 5 'من حبلا إلى الأمام (كما هو موضح بالخط العريض؛ G → A في هذا المثال) لتقليد فمنها الطبيعية في miRNA30 في هذا الموقف.

  1. الاشعال لاستنساخ الجين ميرنا محددة في موقع القاسي الثاني:

يتم عرض مثال لإسكات LacZ أدناه.
تسلسل الهدف (22nt): 5'-CGCGCTGTATCGCTGGATCAAA
LacZ إلى الأمام HP2:
تسلسل 3
LacZ عكس HP2:
تسلسل 4
نلاحظ أن مرة أخرى، تم تغيير قاعدة 5 'من تسلسل الهدف في حبلا إلى الأمام (كما هو موضح بالخط العريض؛ C → A في هذا المثال) بحيث عدم التطابق تسلسل بواسطة العقاقير، ومحاكاة miRNA30.

1،2 PCR تفاعل وSubcloning

  1. وoligos الجينات المحددة هي لناإد مع oligos العالمية في رد فعل PCR لتوليد القاسي miRNA30 مثل الدجاج مع ميرنا تسلسل المرافقة.
الاستنساخ في موقع القاسي الأولى:
ميكرولتر 1 حتي 10 نانوغرام التمهيدي إلى الأمام GFP HP1
1 ميكرولتر - 100 نانوغرام 5 'التمهيدي HP1
1 ميكرولتر - 100 نانوغرام 3 'التمهيدي HP1
1 dNTPs ميكرولتر (10 ملم)
5 ميكرولتر العازلة 10X رد فعل PFU
1 ميكرولتر الحمض النووي PFU البلمرة (Promega)
39 ميكرولتر المياه PCR-الصف
OR الاستنساخ في موقع القاسي الثاني:
ميكرولتر 1 حتي 10 نانوغرام التمهيدي إلى الأمام LacZ HP2
1 ميكرولتر - 100 نانوغرام 5 'التمهيدي HP2
1 ميكرولتر - 100 نانوغرام 3 'التمهيدي HP2
1 dNTPs ميكرولتر (10 ملم)
5 ميكرولتر العازلة 10X رد فعل PFU
1 ميكرولتر الحمض النووي PFU البلمرة (Promega)
39 ميكرولتر المياه PCR-الصف

دورات:

94 ° C 94 ° C 55 ° C 72 ° C 72 ° C 4 ° C
1 دقيقة 30 ثانية 30 ثانية 1 دقيقة 9 دقائق عقد
30 دورة
  1. تنقية المنتج PCR، مع إنزيمات الهضم وتقييد subclone في ناقلات:
    1. أول موقع دبوس الشعر: استخدام NheI وMluI
    2. موقع القاسي الثانية: استخدام MluI وSphI
  2. متابعة التقنيات القياسية لتحويل الخلايا البكتيرية المختصة. لوحة الخلايا على أجار LB (التي تحتوي على أمبيسلين) والحمض النووي البلازميد الحصاد من midipreparation (مثل Nucleobond إكسترا ميدي عدة، Machery-ناجل).
  3. تعليق DNA البلازميد المركزةفي معقمة [ده 2 0 تركيز التدبير، من القياس الطيفي وتخزينها في -20 درجة C.

1،3 البلازميدات تسلسل ميرنا

تحت الظروف القياسية رد فعل التسلسل غالبا ما يفشل بسبب هيكل الثانوي قوية من دبابيس الشعر. لتحسين هذه 7:

  1. أداء رد فعل التسلسل في 10 ملي تريس، الكلورين مع EDTA ملي 0.01 (درجة الحموضة 8.0) بدلا من الماء. هذا يزيد من تحويل الحمض النووي لsupercoiled ssDNA، والتي هي أكثر قابلية للالتسلسل.
  2. إضافة خطوة تمسخ الحرارة (98 درجة مئوية، 5 دقائق) قبل التسلسل. هذا يحول DNA البلازميد supercoiled لssDNA.

2. الصعق الكهربائي

2.1 التعامل مع البيض

  1. وضع البيض في الحاضنة مجموعة إلى 38.5 ° C الرطوبة 45٪ ~ و.
  2. احتضان البيض حتى الأجنة قد وصلت إلى مرحلة من التنمية المنشودة. لدراسة توجيهات محوار الخلايا العصبية صواري، ونحن typicallذ electroporate الأجنة عندما وصلت هامبورغ وهاميلتون (HH) المرحلة 17-18 (بعد حوالي 3 أيام من الحضانة) 8. ومع ذلك، والصعق الكهربائي و الحقن تحتاج إلى القيام به قبل البروتين من الفائدة التي تراكمت لديها، ضربة قاضية لجعل كفاءة.
  3. إزالة البيض من الحاضنة ووضعها في موقف أفقي مستقر لمدة 20 دقيقة، لإعادة الجنين على رأس صفار في الجانب العلوي من البيضة. العودة البيض إلى الحاضنة خلال هذه الفترة.

2.2 إعداد الكواشف والمعدات

  1. إعداد الفوسفات مخزنة المالحة (PBS) وتعقيم بواسطة التعقيم أو تمرير حل من خلال ميكرومتر 0،2 التصفية.
  2. جعل micropipettes الزجاج عن طريق سحب الشعيرات الدموية (البنك الدقة الصكوك 1B120F-4؛ 1.2 / 0.68 OD / ID (مم)) في جهاز سحب مناسبة (مثل Narishige PC-10). قطع غيض من micropipette للحصول على قطر طرف ميكرون 5 ~ وتوصيله إلى قطعة من الأنابيب معقطر المناسبة.
  3. تحميل أقطاب البلاتين (0.5 سم طويلة) بحزم في إطار باليد، مع المسافة بين القطب من 0.5 سم. توصيل الأقطاب الكهربائية إلى مولد موجة النبض مربع (ECM BTX 830).
  4. تعيين مولد النبض مع المعلمات التالية:
    1. لالصعق الكهربائي من جانب واحد: الجهد: 25 V، عدد النبضات: 5، طول النبض: 50 ميللي ثانية، interpulse الفاصل الزمني: 1 ثانية
    2. لالصعق الكهربائي الثنائية: الجهد: 18 V، عدد النبضات: 5، طول النبض: 50 ميللي ثانية، interpulse الفاصل الزمني: 1 ثانية
  5. إعداد حقنة إبرة مع G 18، مشرط، وزجاجة من سبريتز الايثانول 70٪ والشريط.
  6. تذوب شمع البارافين في كوب على لوحة التسخين في C. ° 80

2،3 النوافذ

  1. مسح البيض باستخدام الأنسجة غارقة في الايثانول 70٪.
  2. وضع شريط من الشريط على طول المحور الطويل للبويضة.
  3. جعل اثنين من الثقوب الصغيرة في قشر البيض باستخدام مشرط، واحد فينهاية حادة من البيض والآخر في زاوية من المنطقة المراد إطارات.
  4. باستخدام حقنة، وإزالة تقريبا. 3 مل من زلال البيض من كل من إدخال الإبرة بزاوية 45 درجة في حفرة في نهاية حادة للبويضة. تجنب الإضرار صفار بعناية.
  5. قطع نافذة على قشر البيض باستخدام مقص صغير، الذي عقد أفقيا لتجنب إتلاف الجنين. إذا لزم الأمر، يمكن التحقق من موقف الجنين ووضع علامة مع قلم رصاص من خلال عقد ضوء قوي مقارنة مع نهاية حادة للبويضة. نافذة مربع الطول 1،5 حتي 2 مفيد لمعظم التطبيقات.
  6. ختم الحفرة في نهاية حادة للبويضة وأي شقوق في قشرة البيضة مع يذاب شمع البارافين، تطبيق بفرشاة.
  7. ختم الإطار باستخدام الشريط الشفاف (مثل ماجيك سكوتش).
  8. العودة إلى البويضة الحاضنة.

2،4 الصعق الكهربائي

  1. وتعد الأدوات المعقمة ومسح منطقة العمل مع الايثانول 70٪.
  2. إعداد طnjection الحل. يجب تحديد تركيز الحمض النووي المناسبة من قبل المستخدم، وسوف تختلف وفقا لمروج / محسن تستخدم لدفع التعبير. كدليل، ونحن نستخدم عادة 0،2-2،0 ميكروغرام / ميكرولتر (انظر المناقشة). في ما مجموعه 20 ميكرولتر، يجب أن تحتوي على خليط الحقن:
رني DNA البلازميد (H 2 في 0) ميكرولتر X
20X PBS 1 ميكرولتر
التريبان الأزرق 0.4٪ 2 ميكرولتر
معقمة [ده 2 0، إلى وحدة تخزين النهائي لل 20 ميكرولتر

استخدام الشفط لطيف لتحميل مزيج DNA في الزجاج microcapillary تعلق على الأنابيب.

  1. إزالة الشريط من البيض وإطارات استضافة الجنين وفقا لهامبورغ وهاملتون 8.
  2. استخدام ملقط ومقص الربيع لإزالة بعناية extraembryonic الأغشية من النصف الذيلية من الجنين. يمكن بسهولة رفع الأغشية بعيدا عن الجنين في المنطقة حيث الحق الكبرى واليسار الأوردة المحية دخول الجذع. المسيل للدموع بلطف أو قطع الأغشية وسحب منها نحو الذيل. إذا لزم الأمر، يمكن تصور الجنين أفضل عن طريق حقن محلول الحبر الهند أو الأخضر السريع بين القرص الجنيني وصفار البيض كما هو موضح في الفيديو عن طريق Boulland وزملاؤه 9.
  3. حقن محلول DNA في القناة المركزية في الأنبوب العصبي، وذلك فوق hindlimbs. التحكم في حجم الحقن عن طريق الفم. ينبغي للصبغة زرقاء تنتشر من طرف الذيل يصل إلى البطين من الدماغ النامية.
  4. إضافة بضع قطرات من PBS العقيمة على رأس الجنين.
  5. وضع الأقطاب بالتوازي مع المحور الأمامي الخلفي للجنين. تجنب لمس الجنين أو الأوعية الدموية.
  6. عقد الأقطاب ثابتة، وelectroporate.
  7. إزالة بعناية الأقطاب وشطف لهمالماء المعقم لإزالة التشويه والتحريف من البروتينات بياض البيض.
    1. لالصعق الكهربائي الثنائية، تبديل قطبية الأقطاب، إعادة الأقطاب بالتوازي مع الجنين والصعق الكهربائي و تكرار. شطف الأقطاب في الماء المعقم.
  8. التخلي عن بعض PBS معقمة أكثر على الجنين. ختم البيضة مع الشريط وإعادته إلى حاضنة حتى يتم الوصول إلى مرحلة تنموية المطلوب. الختم المناسب أمر حاسم لتجنب الجفاف للجنين.

3. الاستعدادات الحبل الشوكي

3،1 تشريح الأجنة

  1. في 26-HH25 (يوم 5 من الحضانة)، وإزالة الجنين من بويضة باستخدام ملقط أو ملعقة صغيرة. وضعه في برنامج تلفزيوني في طبق بتري المغلفة مع سيليكون (Sylgard الاستومر).
  2. إزالة الأغشية خارج الجنين ووضع الجنين على ظهرها. استقرار على لوحة تعلق من قبل من خلال العنق والذيل (باستخدام دبابيس الحشرات 0،20 ملم)، مع ليالي لطيفtretching.
    1. يمكن ان تكون ثابتة الأجنة بالكامل (على تقطيع وقت لاحق) هنا، عن طريق استبدال PBS مع بارافورمالدهيد 4٪ (PFA) وتفرخ لمدة 1 ساعة في درجة حرارة الغرفة. لجعل الكتاب المفتوح الاستعدادات، مع الاستمرار في بروتوكول الأنسجة غير المثبتة كما هو موضح أدناه.

3،2 عزل النخاع الشوكي من أجنة

  1. يعلقون عليه الأطراف، وضمان أن يتم إدراج دبابيس في زاوية بعيدا عن الجنين بحيث لا تتداخل مع تشريح. يجب أن تكون مضيئة الجنين من دون التمكن من ينظر كثافة الأنسجة في الخطوات التالية.
  2. إزالة القلب والأعضاء الداخلية باستخدام مقص الربيع وتجريف بلطف مع ملقط. ينبغي للفقرات مجزأة والحبل الشوكي تكون مرئية إذا تمت إزالة جميع الأجهزة تماما.
  3. باستخدام مقص الربيع، وجعل قطع الضحلة من خلال فقرات المغطي للنخاع الشوكي في العنق. تدوير الجنين 180 درجة وجعل اثنين قصيرةطولية يمر عبر فقرات على جانبي الحبل الشوكي، من الرقبة نحو الذيل. استخدام ملقط لرفع رفرف من فقرات بعيدا عن الحبل الشوكي والأنسجة قشر (تحتوي على جميع فقرات) في قطاع واحد نحو الذيل.
  4. تمتد برفق وإعادة دبوس الجنين من خلال الذيل والأطراف.
  5. استخدام مشرط غرامة المجهرية (مثل Grieshaber 68101) أو إبرة التنغستن لقطع السحايا المغطي للنخاع الشوكي. ابحث عن سطر، والظلام كثيفة من الأنسجة بين الأنبوب العصبي والعقد الجذرية الظهرية. ضبط زاوية الإضاءة، إذا لزم الأمر. قطع طولي بلطف على طول هذا الخط على كل جانب من الحبل الشوكي، من الرقبة إلى الذيل. يجب فصل السحايا من الحبل الشوكي نتيجة لطيف تمتد من جنين مقيد.
  6. قطع طريق الحبل الشوكي على مستوى الجناح المهد والذيلية لبرعم الطرف، ورفع الحبل الشوكي بأكملها من الجنين في واحدة منقاري السلس إلى الذيلية الحركة، وذلك باستخدام ملقط. يجب أن تبقى معزولة الحبل الشوكي منغمسين في PBS خلال هذه الخطوة. لا رفعه من الطبق.

3،3 التثبيت من الكتب المفتوحة

  1. نشر الحبل الشوكي معزولة على ملعقة وتحويلها إلى طبق بتري جديدة سيليكون مبطنة تحتوي على بارافورمالدهيد 4٪ في برنامج تلفزيوني.
  2. إنتاج إعداد مسطحة جبل من تعلق بعناية الحبل الشوكي في ستة مواقع (rostrally، بشكل إعلامي ونحو caudally على كل جانب، وذلك باستخدام دبابيس الحشرات 0،10 ملم). نحن تسمية كل إعداد من قبل 'العلم' القليل الذي لا يعرف الجنين ولكن يدل ايضا على نهاية الأمامي من إعداد كتاب مفتوح.
  3. احتضان في درجة حرارة الغرفة لمدة 30 دقيقة إلى 1 ساعة. لا ينبغي أن يكون مفتوح على الكتب ثابتة لأن هذا يقلل من كفاءة نشر مبادرة ديزرتك الصناعية 10 و يزيد الخلفية.
  4. صب بعناية قبالة PFA 4٪ واستبدالها PBS. الحفاظ على الأطباق في 4 درجات مئوية حتى جاهزة للحقن مع مبادرة ديزرتك الصناعية أو جبل.
e_step "> حقن الخلايا العصبية في مبادرة ديزرتك الصناعية 3،4 صواري

  1. مراقبة الكتب المفتوح تحت miscroscopy مضان وحدد الجانب المناسب من الكتاب المفتوح لحقن مع صلاح الغيدان.
  2. إعداد مبادرة ديزرتك الصناعية سريعة (5 ملغ / مل في الإيثانول) ويوجه إلى حل micropipette تعلق على الزجاج الأنابيب البلاستيكية. قطع نهاية micropipette ناعما قدر الإمكان للحصول على قطر الحافة الصغيرة جدا. أدخل الإبرة في طبق من PBS والتحقق من أن مبادرة ديزرتك الصناعية لا يتسرب من الإبرة. إذا كانت التسريبات مبادرة ديزرتك الصناعية، قطر إبرة كبيرة جدا. في هذه الحالة، وإعداد إبرة جديدة.
  3. إلقاء الضوء على الاستعدادات الكتاب المفتوح من أسفل. البحث عن شريط طولي أكثر كثافة من الأنسجة، وتقع على بعد نحو 1/5 من عرض من hemibook من على حافة الجانبي للإعداد. هذا يتوافق مع الهيئات خلية من الخلايا العصبية صواري، والتي توجد فقط لبطني لوحة السقف. ابتداء من الساعة واحدة من نهاية الكتاب المفتوح، أدخل الإبرة في النسيج والزجاج و، والإبرة طق سحب، نفخة في كمية صغيرة من مبادرة ديزرتك الصناعية باستخدام ماصة الفم.
  4. العمل بسرعة، مما يجعل العديد من الحقن على طول الكتاب المفتوح على فترات منتظمة من حوالي 0.5 ملم. إذا كانت إبرة يصبح انسداد، بعناية مسحها بالملقط. إذا كان تلميح يصبح كبير جدا (والتسريبات مبادرة ديزرتك الصناعية)، يستعاض عن إبرة.
  5. تسربت مبادرة ديزرتك الصناعية عند إكمال كل كتاب مفتوح، استخدم ماصة نقل لامتصاص بعيدا وتجاهل أي فائض. وعدم القيام بذلك يؤدي إلى ارتفاع الخلفية.
  6. ترك الاستعدادات لحوالي ثلاثة أيام في 4 درجات مئوية لتمكين صلاح الغيدان لالانتشار على طول محاور عصبية.

3،5 متزايدة لتصوير

  1. استخدام المحاقن مع إبرة G 18 إلى انتشار رقيقة، دون انقطاع من الحدود الشحوم فراغ (على سبيل المثال داو كورنينج # 976V) حول حواف من 24 مم × 24 مم الزجاج ساترة. إضافة عدة قطرات من PBS العقيمة لالبئر. ملاحظة قد لا تحتوي على الجلسرين المتوسطة المتصاعدة مع البروبيل غاللاتي أن تشاركmpatible مع صلاح الغيدان 11. وبالمثل، قد الشحوم فراغ من اللزوجة المنخفضة خلط مع PBS ونتيجة عالية في الخلفية.
  2. إزالة المسامير من كتاب مفتوح وتحويلها إلى قطرات PBS. تزج الكتاب المفتوح ووضعه في منتصف البئر.
  3. وضع بلطف آخر 24 مم × 24 مم ساترة على القمة، والتأكد من الكتاب المفتوح يبقى مفتوحا. إذا لزم الأمر، يمكن إزالة ساترة، وأعادت الكتاب المفتوح. اضغط بلطف حول حواف إعداد لإنشاء ختم كاملة من الشحوم. سيتم تقلص فائض PBS بها خلال هذه الخطوة. تجنب فقاعات الهواء.
  4. الحفاظ على الاستعدادات في الظلام في 4 درجات مئوية حتى جاهزة للتفتيش وثائق بواسطة المجهر الفلورسنت. وينبغي أن يتم هذا على وجه السرعة (خلال أسبوع واحد)، للتأكد من أن الاستعدادات لا تجف.

4. ممثل النتائج

الصعق الكهربائي والتعبير عن البلازميدات

تحتالشروط المذكورة أعلاه، يجب أن يكون اكتشاف بروتين فلوري بشكل واضح في نوع من الخلايا المناسبة دون الحاجة لتضخيم إضافية للإشارة من وضع العلامات الأجسام المضادة. ينبغي أن يكون فقط بروتين فلوري اكتشاف نوع من الخلايا في المنشود / س. وترد أمثلة ممثل المفتوح الكتاب الاستعدادات والمقاطع العرضية للأجنة electroporated مع البلازميدات مختلفة في الشكل 2.

الكفاءة من miRNAs الاصطناعي

يجب أولا miRNAs الاصطناعي ضد الجين رواية ذات أهمية سيتم عرضها لتحقيق الكفاءة والنوعية من آثار ضربة قاضية لهم. نجد أن β-الأكتين المروج يبني يحركها، electroporated عند 0.25 ميكروغرام / ميكرولتر، مناسبة لهذا 3. ويمكن اختبار ضربة قاضية في الجسم الحي من قبل المناعية أو التهجين في الموقع.

مبادرة ديزرتك الصناعية الوسم

استهدفت بشكل مناسب حقن الأجنة في مبادرة ديزرتك الصناعية wildtypeينبغي أن تسفر أكثر من 80٪ من مواقع الحقن مع مسارات، مثالية التوراتية كما هو موضح في الشكل 3. يجب أن الحيوان مع تقلبية الحيوانية تكون منخفضة.

الشكل 1
الشكل 1. التخطيطي المعمم من ناقلات ميرنا، معربا عن البلازميد. استخدام مختلف RNA بوليميريز المروجين الثاني / القدرة تمكن الخلايا من نوع محدد التعبير. والخلايا المصابة بالعدوى بالنقل هي التعرف عليها عن طريق التعبير عن مراسل الفلورسنت مرتبط مباشرة (داخل نسخة واحدة) إلى واحد أو اثنين miRNAs الاصطناعي، الذي هدم التعبير الجيني. نص عريض يشير إلى شعور حبلا من ميرنا الاصطناعي ضد LacZ، كما هو موضح في النص.

الشكل 2
الشكل 2. الممثل أمثلة سالحصول على بروتين فلوري و التعبير أنماط بعد الصعق الكهربائي لنواقل البلازميد المشار إليه. المقاطع العرضية والكتب المفتوحة من أجنة الدجاج HH25-26 التي تم electroporated في HH18. β-الأكتين المروج يدفع التعبير في كل مكان، Math1 محسن يدفع التعبير في الخلايا العصبية وdI1 Hoxa1 محسن يدفع التعبير على وجه التحديد في لوحة الكلمة. CN، صواري الخلايا العصبية؛ FP، لوحة الكلمة.

الشكل 3
الشكل 3. تطبيق وتحليل مواقع الحقن مبادرة ديزرتك الصناعية في الأعمال التحضيرية كتاب مفتوح. ينبغي حقن مبادرة ديزرتك الصناعية في نمط نقطي، على مقربة من الهامش الجانبي للكتاب مفتوح، وعلى الجانب electroporated (التي حددتها التعبير بروتين فلوري). بعد 3 أيام من نشرها، وينبغي صواري مسارات محور عصبي تكون قادرة على أن تكون تصور تحت المجهر الفلورسنت. سوف تنمو مسارات محور عصبي طبيعي نحو الطابق صفي وقت متأخر، عبر لوحة الطابق و من ثم استدر وتنمو rostrally. ويمكن مقارنة الظواهر الشاذة الناشئة عن طرق الجينات وصولا الى هذا المسار التوراتية. في المثال، بعض المماطلة في محاور عصبية لوحة الكلمة الخاطئة أو جعل قرارات تحول على الجانب المقابل.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

ويمكن استخدام هذه بسيطة، المستندة إلى متجه التعبير ميرنا الاصطناعي استراتيجية في التعبير الجيني الذاتية ضربة قاضية في الأنبوب العصبي الدجاج. هذه الأدوات وظيفية متعددة تقدم إسكات الجينات والتحكم الزمني وخصوصية من نوع الخلية، لتيسير الكشف عن مسارات تنموية معقدة. على وجه الخصوص، وقد أثبتنا فائدة هذه البلازميدات في التوجيه محور عصبي صواري، حيث يمكن استخدام البلازميدات إلى الجينات في الخلايا العصبية ضربة قاضية مميزة في صواري أو هدفهم وسيطة، وfloorplate 3.

وشدة وموقع التعبير بروتين فلوري المتولدة من البلازميدات، معربا عن ميرنا (وبالتالي، فإن الخلايا إسكات) تعتمد على المعايير التالية:

  1. يستخدم محسن:
    1. β-الأكتين المروج النشط بتواجد مطلق
    2. Math1 محسن نشطة فقط في الخلايا العصبية dI1 12
    3. 13
  2. تركيز البلازميد.
    إذا البلازميد تركيز مرتفع جدا، فإنه قد يتسبب ب "التسرب" من النشاط والتعبير محسن اللاحقة في الخلايا غير المرغوب فيها، في حين البلازميد القليل جدا قد يقلل من التعبير عن بروتين فلوري ومنع الخلايا من أن تكون electroporated ارجاعها. وينبغي أيضا على تركيزات عالية من البلازميدات رني يمكن تجنبها للحد من الآثار المستهدفة وتقليل فرصة غير محددة سمية الناتجة عن التشبع من مسار نشوء حيوي ميرنا الذاتية. نستخدم:
    1. β-الأكتين المروج: 0.25 ميكروغرام / ميكرولتر
    2. Math1 محسن: 0.7 ميكروغرام / ميكرولتر
    3. Hoxa1 محسن III: 0،5-1،0 ميكروغرام / ميكرولتر
  3. دقة الصعق الكهربائي.
    التعامل مع أجنة الدجاج في البيضة يتطلب المهارات اليدوية يلزم الحصول عليها من خلال التدريب. نحن وغيرناوقد نشرت سابقا نصائح استكشاف الأخطاء وإصلاحها لهذا الإجراء 14،15.

قد miRNAs عدة لا بد من اختبار قبل العثور على مرشح مناسب. يجب أن تتضمن هذه العملية تحديد من miRNAs مستقلة عدة لتأكيد النمط الظاهري المرصودة، والضوابط السلبية (مخلوط و / أو غير ذات صلة miRNAs) والانقاذ يبني 16.

يجب أن تكون ثابتة المفتوح الكتاب الاستعدادات على النحو الأمثل وحقنوا صلاح الغيدان في الموقع المناسب من أجل رؤية تفاصيل الهيكلية للتوقعات من الخلايا العصبية محواري صواري. قد يكون سبب ارتفاع الخلفية بواسطة تثبيت فترات طويلة من الكتب مفتوحة أو انسكاب للمبادرة ديزرتك الصناعية. وحقن الخلايا الموجودة في مبادرة ديزرتك الصناعية ظهريا جدا يؤدي عادة إلى نقص في التوقعات محواري المسمى نحو لوحة الكلمة. وتقع خلايا بطنيا جدا لها العديد من الإسقاطات المماثل والمقابل في خط الوسط، وبالتالي يجب تجنبها يمكن. لمبتدئRS، نوصي ممارسة المفتوح على الكتب التي اتخذت من أجنة wildtype لضمان دقة، وتحديد المواقع استنساخه من مبادرة ديزرتك الصناعية.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الإعلان عن أي تضارب في المصالح.

Acknowledgements

ويدعم عمل في مختبر ES من قبل مؤسسة العلوم الوطنية السويسرية. نود أن نشكر الدكتور فوز كونز للحصول على المساعدة مع التصوير.

Materials

Name Company Catalog Number Comments
0.5 mm glass capillaries World Precision Instruments 1B120F-4
Glass needle puller Narishige PC-10
Electroporator BTX ECM 830
Sylgard silicone elastomer World Precision Instruments SYLG184
Tungsten wire, 0.075 mm World Precision Instruments TGW0325
Insect pins, 0.20 mm Fine Science Tools 26002-20
Insect pins, 0.10 mm Fine Science Tools 26002-10
Spring scissors Fine Science Tools 15003-08
Dumont #5 forceps Fine Science Tools 11252-20
Dumont #55 forceps Fine Science Tools 11255-20
Fast DiI Molecular Probes D-7756
Fluorescent microscopes Olympus SZX12, BX51

DOWNLOAD MATERIALS LIST

References

  1. Chédotal, A. Further tales of the midline. Current Opinion in Neurobiology. 21, 68-75 (2011).
  2. Avraham, O., Hadas, Y., Vald, L., Zisman, S., Schejter, A., Visel, A., Klar, A. Transcriptional control of axonal guidance and sorting in dorsal interneurons by the Lim-HD proteins Lhx9 and Lhx1. Neural Development. 4, 21 (2009).
  3. Wilson, N. H., Stoeckli, E. T. Cell type specific, traceable gene silencing for functional gene analysis during vertebrate neural development. Nucleic Acids Research. 39, e133 (2011).
  4. Das, R. M., van Hateren, N. J., Howell, G. R., Farrell, E. R., Bangs, F. K., Porteous, V. C. A robust system for RNA interference in the chicken using a modified microRNA operon. Developmental Biology. 294, 554-563 (2006).
  5. Perrin, F. E., Stoeckli, E. T. Use of lipophilic dyes in studies of axonal pathfinding in vivo. Microscopy Research and Technique. 48, 25-31 (2000).
  6. Timmer, J., Johnson, J., Niswander, L. The use of in ovo electroporation for the rapid analysis of neural-specific murine enhancers. Genesis. 29, 123-132 (2001).
  7. Kieleczawa, J. Simple modifications of the standard DNA sequencing protocol allow for sequencing through siRNA hairpins and other repeats. Journal of Biomolecular Techniques. 16, 220-223 (2005).
  8. Hamburger, V., Hamilton, H. L. A series of normal stages in the development of the chick embryo. Journal of Morphology. 88, 49-92 (1951).
  9. Boulland, J., Halasi, G., Kasumacic, N., Glover, J. C. Xenotransplantation of Human Stem Cells into the Chicken Embryo. J. Vis. Exp. (41), e2071 (2010).
  10. Kim, B. G., Dai, H. -N., McAtee, M., Vicini, S., Bregman, B. S. Labeling of dendritic spines with the carbocyanine dye DiI for confocal microscopic imaging in lightly fixed cortical slices. Journal of Neuroscience Methods. 162, 237-243 (2007).
  11. Murphy, M. C., Fox, E. A. Anterograde tracing method using DiI to label vagal innervation of the embryonic and early postnatal mouse gastrointestinal tract. Journal of Neuroscience Methods. 163, 213-225 (2007).
  12. Helms, A. W., Abney, A. L., Ben-Arie, N., Zoghbi, H. Y., Johnson, J. E. Autoregulation and multiple enhancers control Math1 expression in the developing nervous system. Development. 127, 1185-1196 (2000).
  13. Li, X., Lufkin, T. Cre recombinase expression in the floorplate, notochord and gut epithelium in transgenic embryos driven by the Hoxa-1 enhancer III. Genesis. 26, 121-122 (2000).
  14. Mauti, O., Baeriswyl, T., Stoeckli, E. T. G. ene Silencing by Injection and Electroporation of dsRNA in Avian Embryos. Cold Spring Harbor Protocols. (2008).
  15. Krull, C. E. A primer on using in ovo electroporation to analyze gene function. Developmental Dynamics. 229, 433-439 (2004).
  16. Cullen, B. R. Enhancing and confirming the specificity of RNAi experiments. Nature Methods. 3, 677-681 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics