In ovo Elektroporatie van miRNA gebaseerde Plasmiden in de ontwikkelingslanden neurale buis en Beoordeling van de fenotypes van Dil Injectie in de Open-boek Voorbereidingen

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Een methode waarmee genexpressie in de neurale buis downgereguleerd in een celtype-specifieke, traceerbare wijze beschreven. We laten zien hoe

Cite this Article

Copy Citation | Download Citations

Wilson, N. H., Stoeckli, E. T. In ovo Electroporation of miRNA-based Plasmids in the Developing Neural Tube and Assessment of Phenotypes by DiI Injection in Open-book Preparations. J. Vis. Exp. (68), e4384, doi:10.3791/4384 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Commissurale DI1 neuronen zijn uitgebreid bestudeerd om de mechanismen axon begeleiding bij ontwikkeling 1,2 helderen. Deze neuronen in de dorsale ruggenmerg en sturen hun axonen langs stereotype trajecten. Commissurale axonen in eerste instantie ventraal projecteren richting en dan over de vloerplaat. Na het oversteken van de middellijn, deze axonen maken een scherpe bocht rostrale en project lengterichting naar de hersenen. Elk van deze stappen wordt geregeld door de gecoördineerde activiteiten van aantrekkende en afstotende begeleiding cues. De juiste interpretatie van deze signalen is cruciaal voor de begeleiding van axonen langs hun afgebakende pad. Aldus wordt de fysiologische bijdrage van een bepaalde molecule te commissurale axon begeleiding voorkeur onderzocht in de context van de levende embryo. Bijgevolg moet gen knockdown in vivo nauwkeurig worden gecontroleerd om zorgvuldig onderscheid te maken axon begeleiding activiteiten van genen die kunnen spelen meerdererollen tijdens de ontwikkeling.

Hier beschrijven we een methode om knockdown genexpressie in de kip neurale buis op een celtype-specifieke, traceerbare wijze. We gebruiken novel plasmidevectoren 3 herbergen celtype-specifieke promoters / enhancers die de expressie van een fluorescerend eiwit marker rijden, direct gevolgd door een miR30-RNAi transcript 4 (binnen de 3'-UTR van het cDNA dat codeert voor het fluorescent protein) ( figuur 1). Wanneer geëlektroporeerd in het ontwikkelende neurale buis, deze vectoren efficiënt opwekken downregulatie van genexpressie en expressie helder fluorescente merker eiwitten kunnen direct traceren van de cellen ervaren knockdown 3. Het mengen van verschillende RNAi vectoren voor elektroporatie kan gelijktijdig knockdown van twee of meer genen in onafhankelijke delen van het ruggenmerg. Dit maakt complexe cellulaire en moleculaire interacties worden onderzocht tijdens de ontwikkeling, op een manier die snel, suitvoering, nauwkeurig en goedkoop. In combinatie met Dil tracing van commissurale axon trajecten in open-boek voorbereidingen 5, deze methode is een handig hulpmiddel voor in vivo studies van de cellulaire en moleculaire mechanismen van commissurale axongroei en begeleiding. In principe kan elke promoter / enhancer worden gebruikt, mogelijk waardoor de techniek breder toepasbaar voor in vivo studies van genfunctie tijdens de ontwikkeling 6.

Deze video toont eerst hoe naar en venster eieren, de injectie van DNA plasmiden in de neurale buis en de elektroporatie procedure. Om commissurale axon begeleiding te onderzoeken, wordt het ruggenmerg verwijderd van het embryo als een open boek voorbereiding, vast, en geïnjecteerd met Dil zodat axon paden te traceren. Het ruggenmerg wordt tussen dekglaasjes en gevisualiseerd met behulp van confocale microscopie.

Protocol

1. Bereiding van RNAi plasmide-DNA voor celtype-specifieke gen-silencing

Plasmiden (figuur 1) gesynthetiseerd met behulp van standaard moleculaire kloneringstechnieken, zoals eerder beschreven 3,4.

1,1 Klonen in de vectoren: oligonucelotide ontwerp

  1. We gebruiken dezelfde universele oligonucleotiden en het klonen van protocollen die worden beschreven in de productinformatie die bij de pRFPRNAiC vector 4 (ARK-Genomics).
    1. Voor klonering in de eerste hairpin site:
      5 'primer HP1:
      5'-GGCGGGGCTAGCTGGAGAAGATGCCTTCCGGAGAGGTGCTGCTGAGCG
      3 'primer HP1:
      5'-GGGTGGACGCGTAAGAGGGGAAGAAAGCTTCTAACCCCGCTATTCACCACCACTAGGCA
    2. Voor klonering in de tweede hairpin site:
      5 'primer HP2:
      5'-GGCGGGACGCGTGCTGTGAAGATCCGAAGATGCCTTGCGCTGGTTCCTCCGTGAGCG
      3 'primer HP2:
    3. 5'-CGCCGCGCATGCACCAAGCAGAGCAGCCTGAAGACCAGTAGGCA
  2. Wij gebruiken Genscript's siRNA Target Finder om gen-specifieke doelsequenties te selecteren: https://www.genscript.com/ssl-bin/app/rnai .
  3. Primers voor kloneren van een gen-specifieke miRNA in de eerste hairpin site:

Een voorbeeld voor silencing GFP wordt hieronder weergegeven.
Doelsequentie (22nt): 5'-GGCACAAGCTGGAGTACAACTA
GFP Forward HP1 = 59mer
Reeks 1
GFP Reverse HP1 = 58mer
Sequence 2
Er zijn gemeenschappelijke sequenties in deze oligos die deel uitmaken van het miRNA flankerende sequenties (kip-specifiek) en algemene loop / stem sequenties (van menselijke miRNA30). Het gen-specifieke doelsequenties zijn onderstreept. Merk op dat er am isismatch aan de 5'-base van de voorste streng (vetgedrukt; G → A in dit voorbeeld) de natuurlijke mismatch in miRNA30 bootsen op deze positie.

  1. Primers voor kloneren van een gen-specifieke miRNA in de tweede hairpin site:

Een voorbeeld voor silencing LacZ wordt hieronder weergegeven.
Doelsequentie (22nt): 5'-CGCGCTGTATCGCTGGATCAAA
LacZ Forward HP2:
Reeks 3
LacZ Reverse HP2:
Reeks 4
Merk op dat wederom de 5'-base van de doelsequentie in het voorste deel is gewijzigd (vetgedrukt; C → A in dit voorbeeld) zodat mismatches de antisense sequentie nabootsen miRNA30.

1.2 PCR reactie en Subcloning

  1. De gen-specifieke oligo zijn onsed met de universele oligo in een PCR reactie op de miRNA30 haarspeld-achtige genereren met kip miRNA flankerende sequenties.
Klonen in eerste haarspeldbocht site:
1 pi - 10 ng GFP Forward primer HP1
1 ui - 100 ng 5 'primer HP1
1 ui - 100 ng 3 'primer HP1
1 pi dNTPs (10 mM)
5 pi 10x reactiebuffer Pfu
1 pl Pfu DNA Polymerase (Promega)
39 ul PCR-Grade water
OF Klonen naar de tweede haarspeld site:
1 pi - 10 ng LacZ Forward primer HP2
1 ui - 100 ng 5 'primer HP2
1 ui - 100 ng 3 'primer HP2
1 pi dNTPs (10 mM)
5 pi 10x reactiebuffer Pfu
1 pl Pfu DNA Polymerase (Promega)
39 ul PCR-Grade water

Cycli:

94 ° C 94 ° C 55 ° C 72 ° C 72 ° C 4 ° C
1 min 30 sec 30 sec 1 min 9 min houden
30 cycli
  1. Zuiver het PCR product, verteren met restrictie-enzymen en subkloon in de vector:
    1. Eerste haarspeld site: gebruik Nhel en Mlul
    2. Tweede haarspeld site: gebruik Mlul en Sphl
  2. Volg standaard technieken voor transformatie van competente bacteriële cellen. Plaat cellen op LB agar (met ampicilline) en oogst door plasmide DNA midipreparation (bijv. Nucleobond Xtra Midi kit, Machery-Nagel).
  3. Suspend geconcentreerde plasmide DNAin steriele ddH 2 0, maatregel concentratie door spectrofotometrie en bij -20 ° C.

1,3 Sequencing miRNA plasmiden

Onder standaardomstandigheden de sequentiebepalingsreactie vaak niet door sterke secundaire structuur van de haarspelden. Om deze 7 te verbeteren:

  1. Voer sequentiereactie in 10 mM Tris-Cl met 0,01 mM EDTA (pH 8,0) in plaats van water. Dit verhoogt omzetting van supercoiled DNA ssDNA die zich beter leent voor het rangschikken.
  2. Voeg een warmte denaturatiestap (98 ° C, 5 min) voorafgaand aan de sequencing. Dit zet plasmide DNA ssDNA.

2. Elektroporatie

2,1 Ei behandeling

  1. Doe de eieren in een incubator ingesteld op 38,5 ° C en ~ 45% vochtigheid.
  2. Incubeer de eieren tot de embryo's op de gewenste ontwikkelingsstadium. Om axon begeleiding van commissurale neuronen te bestuderen, hebben we typically electroporate embryo bij het ​​bereiken van Hamburger & Hamilton (HH) stage 17-18 (na ongeveer 3 dagen incubatie) 8. Echter injectie en elektroporatie moeten worden gedaan voor het eiwit van belang heeft opgelopen, om knockdown efficiënt.
  3. Verwijder de eieren uit de incubator en ze in een stabiele horizontale positie gedurende 20 minuten voor het embryo bovenop de dooier verplaatsen aan de bovenzijde van het ei. Zet de eieren in de incubator gedurende deze periode.

2.2 Bereiding van reagentia en apparatuur

  1. Bereid fosfaat gebufferde zoutoplossing (PBS) en steriliseer autoclaaf of transport van de oplossing door een 0,2 um filter.
  2. Maken glazen micropipetten door aan capillairen (World Precision Instruments 1B120F-4, 1.2 / 0,68 OD / ID (mm)) in een geschikt trekinrichting (bijv. Narishige PC-10). Breek het topje van een micropipet een tip diameter van ~ 5 micrometer te verkrijgen en sluit deze aan op een stuk buis metde juiste diameter.
  3. Monteer het platina elektroden (0,5 cm lang) stevig in een hand-held frame, een inter-elektrode-afstand van 0,5 cm. Verbind de elektroden met een blokgolf generator (BTX ECM 830).
  4. Stel de pulsgenerator met de volgende parameters:
    1. Voor eenzijdige elektroporatie: spanning: 25 V, aantal pulsen: 5, lengte van de puls: 50 msec, interpuls interval: 1 sec
    2. Voor bilaterale elektroporatie: spanning: 18 V, aantal pulsen: 5, lengte van de puls: 50 msec, interpuls interval: 1 sec
  5. Bereid een spuit met 18 G naald, een scalpel, een spritz fles 70% ethanol en tape.
  6. Smelt paraffine in een bekerglas op een verwarmingsplaat bij 80 ° C.

2,3 Windowing

  1. Veeg de eieren met behulp van een tissue gedrenkt in 70% ethanol.
  2. Plaats een stuk tape langs de lengteas van het ei.
  3. Maak twee kleine gaatjes in de eierschaal met behulp van een scalpel, een opde stompe kant van het ei en de andere op de hoek van het gebied dat moet worden windowed.
  4. Met behulp van een spuit, moet u ca. 3 ml van elk ei eiwit door de naald onder een hoek van 45 ° in het gat aan de stompe kant van het ei. Zorg ervoor, beschadiging van de dooier.
  5. Snij een venster in de eierschaal met kleine schaar, horizontaal gehouden om te voorkomen dat de embryo. Indien nodig kan de positie van het embryo worden gecontroleerd en gemarkeerd met een potlood met een door sterk licht tegen de stompe kant van het ei. Een venster van 1,5 tot 2 cm vierkant is nuttig voor de meeste toepassingen.
  6. Dicht het gat aan de stompe kant van het ei en eventuele scheuren in de eierschaal met gesmolten paraffine, met een kwast.
  7. Sluit de venster met behulp van transparante tape (bijv. Scotch Magic).
  8. Zet de eieren in de incubator.

2,4 Elektroporatie

  1. Bereid steriel gereedschap en veeg het werkgebied met 70% ethanol.
  2. Bereid de injection oplossing. De geschikte DNA concentratie worden bepaald door de gebruiker en is afhankelijk van de enhancer / promoter gebruikt om de expressie te sturen. Als een gids, we gebruiken meestal 0,2-2.0 ug / ul (zie Discussie). In totaal 20 pl, dient de injectie mengsel bevatten:
RNAi plasmide DNA (in H 2 0) X pi
20x PBS 1 pi
0,4% trypan blauw 2 pi
steriel ddH 2 0, tot een eindvolume van 20 pi

Gebruik zachte zuigkracht aan het DNA mengsel te laden in het glas microcapillaire aan de slang.

  1. Verwijder de tape van de windowed ei en stadium de embryo volgens Hamburger en Hamilton 8.
  2. Gebruik een tang en de lente schaar om voorzichtig de extraembryonic membranen van de caudale helft van de embryo. De membranen kunnen eenvoudig worden opgetild van het embryo in het gebied waar de grote rechter en linker vitelline aders voeren de romp. Voorzichtig scheuren of knip de membranen en trek ze naar de staart. Indien gewenst kan de embryo beter gevisualiseerd door injecteren van een oplossing van India inkt of Fast Green tussen embryonale schijf en eigeel zoals in een video door Boulland en collega 9.
  3. Injecteer de DNA-oplossing in het centrale kanaal van de neurale buis, net boven de achterste ledematen. Regel het injectievolume via de mond. De blauwe kleurstof moet zich vanuit de punt van de staart tot het ventrikel van de ontwikkelende hersenen.
  4. Een paar druppels steriel PBS bovenop de embryo.
  5. De elektroden evenwijdig aan de anterior-posterior as van het embryo. Vermijd het aanraken van het embryo of de bloedvaten.
  6. Houd de elektroden stabiel, en electroporate.
  7. Verwijder voorzichtig de elektroden en spoel ze metsteriel water om gedenatureerde eiwitten te verwijderen uit het eiwit.
    1. Voor bilaterale elektroporatie, schakelt de polariteit van de elektroden, de positie van de elektroden parallel aan het embryo en herhaal de elektroporatie. Spoel de elektroden in steriel water.
  8. Drop wat meer steriel PBS op het embryo. Verzegelt het ei met tape en terug te sturen naar de incubator totdat de gewenste ontwikkelingsstadium is bereikt. Goede afdichting is cruciaal voor uitdroging van het embryo te vermijden.

3. Spinal Cord Voorbereidingen

3,1 Dissectie van embryo's

  1. Op HH25-26 (dag 5 van de incubatie), verwijder het embryo uit het ei behulp van een tang of een kleine lepel. Plaats het in PBS in een petrischaal bekleed met silicone (Sylgard elastomeer).
  2. Verwijder de extra-embryonale membranen en leg het embryo op zijn rug. Stabiliseren op de plaat door pinning het door de nek en staart (met behulp van 0,20 mm insect pinnen), met zachte stretching.
    1. Gehele embryo's (voor het snijden later) kan hier worden vastgesteld, door vervanging van de PBS met 4% paraformaldehyde (PFA) en incubatie gedurende 1 uur bij kamertemperatuur. Om open boek voorbereidingen te treffen, blijft het protocol met niet vastgelegde weefsel zoals hieronder beschreven.

3,2 Isolatie van ruggenmerg uit embryo's

  1. Pin de ledematen, zodat de pennen geplaatst onder een hoek weg van de embryo zodat ze niet interfereren met de dissectie. De embryo moet branden beneden zodat weefseldichtheid worden waargenomen in de volgende stappen.
  2. Verwijder het hart en de inwendige organen met behulp van de lente schaar en zachtjes te schrapen met een pincet. De gesegmenteerde wervels en het ruggenmerg zichtbaar moeten zijn indien alle organen volledig zijn verwijderd.
  3. Met behulp van de lente schaar, maak een ondiepe snede door de wervels bovenop het ruggenmerg in de nek. Draai het embryo 180 ° en maak twee kortelangssneden door de wervels aan weerszijden van het ruggenmerg van de nek naar de staart. Gebruik een tang om de klep van de wervels te tillen uit de buurt van het ruggenmerg en de schil van het weefsel (met alle wervels) in een strook in de richting van de staart.
  4. Voorzichtig rekken en opnieuw pin het embryo door de staart en ledematen.
  5. Gebruik een fijne microchirurgische scalpel (bijv. Grieshaber 68101) of een wolfraam naald weg te snijden de hersenvliezen bovenop het ruggenmerg. Kijk voor een donkere, dichte lijn van weefsel tussen de neurale buis en de dorsale wortel ganglia. Stel de lichtinvalshoek, indien nodig. Voorzichtig lengterichting doorgesneden langs deze lijn aan beide zijden van het ruggenmerg van de nek tot de staart. De hersenvliezen moet scheiden van het ruggenmerg door het voorzichtig rekken van de embryo vastgemaakt.
  6. Snij door het ruggenmerg op het niveau van de vleugel knop en caudaal van de ledematen, en til de hele ruggenmerg uit het embryo in een vloeiende rostraal caudale beweging met forceps. De geïsoleerde ruggenmerg worden bewaard ondergedompeld in PBS tijdens deze stap. Til het uit de schotel.

3,3 Fixatie van open-books

  1. Spreid de geïsoleerde ruggenmerg op een spatel en breng het naar een nieuwe siliconen beklede petrischaal met 4% paraformaldehyde in PBS.
  2. Produceer een flatscreen-mount voorbereiding door zorgvuldig pinning het ruggenmerg in zes posities (rostraal, mediaal en caudaal aan elke kant, met behulp van 0,10 mm insect pinnen). We labelen elk preparaat door een kleine "vlag" niet alleen worden de embryo maar ook aan het voorste uiteinde van de open boek preparaat.
  3. Incubeer bij kamertemperatuur gedurende 30 minuten tot 1 uur. Open-books mag niet te vast Dit vermindert het rendement van DiI diffusie 10 en verhoogt achtergrond.
  4. Giet uit de 4% PFA en te vervangen door PBS. Houd de gerechten bij 4 ° C tot klaar om te injecteren met Dil of mount.
e_step "> 3,4 Dil injectie in commissurale neuronen

  1. Let op de open-boeken onder fluorescentie miscroscopy en selecteer de juiste kant van de open-boek te injecteren met Dil.
  2. Bereid Fast Dil (5 mg / ml in ethanol) en zuig de oplossing in een glas micropipet aan plastic buizen. Breek het einde van de micropipet zo fijn mogelijk een zeer kleine diameter tip verkrijgen. Steek de naald in een schotel van PBS en controleer of de Dil niet lekken uit de naald. Als de Dil lekken, de naald diameter is te groot. In dat geval stelt een nieuwe naald.
  3. Verlicht de open-boek bereidingen van onderen. Zoek een dichtere lengtestreep weefsel, ongeveer 1/5 gelegen van de breedte van een hemibook van de zijrand van het preparaat. Dit komt overeen met de cellichamen van de commissurale neuronen, die zullen alleen ventraal van de dakplaat. Vanaf een uiteinde van de open boek, steek de glazen naald in het weefsel en de naald is ingetrokken, bladerdeeg in een kleine hoeveelheid van Dil met behulp van een mond pipet.
  4. Werken snel, waardoor meerdere injecties langs de lengte van de open boek met regelmatige intervallen van ongeveer 0,5 mm. Als de naald verstopt raakt, zorgvuldig verwijderen met een tang. Als de tip te groot wordt (en Dil lekken), vervang de naald.
  5. Als u elke open boek voltooid is, een overdracht pipet te gebruiken weg te zuigen en verwijder het te veel, uitgelekt Dil. Doet u dit niet zal resulteren in een hoge achtergrond.
  6. Laat de voorbereiding van ongeveer drie dagen bij 4 ° C zodat de DiI verspreiden langs de axonen.

3.5 Plaatsing voor beeldvorming

  1. Gebruik een spuit met een 18 G-naald om een dunne, ononderbroken rand van vacuüm vet (bijv. Dow Corning # 976V) verspreid over de randen van een 24 mm x 24 mm glas dekglaasje aan. Voeg enkele druppels steriel PBS tot de put. Merk op dat fixeermiddel met glycerol met n-propylgallaat niet gelijktijdig wordenmpatible met DiI 11. Evenzo kunnen vacuum vet lage viscositeit gemengd met de PBS en resulteren in hoge achtergrond.
  2. Verwijder de pennen van de open-boek en breng hem in de PBS druppel. Dompel de open boek en plaats hem in het midden van de put.
  3. Plaats voorzichtig een andere 24 mm x 24 mm dekglaasje op de top, zorg ervoor dat de open-boek open blijft. Indien nodig kan het dekglaasje worden verwijderd en de open boek verplaatst. Druk voorzichtig de randen van het preparaat op een volledige afdichting van vet te maken. Overtollige PBS wordt geperst tijdens deze stap. Vermijd luchtbellen.
  4. Houd de voorbereidingen in het donker bij 4 ° C tot klaar voor inspectie en documentatie door fluorescentie microscopie. Dit moet snel gebeuren (binnen een week), zodat de preparaten niet uitdrogen.

4. Representatieve resultaten

Elektroporatie en expressie van plasmiden

Onder dehierboven beschreven, moet duidelijk detecteerbaar fluorescent eiwit in het juiste celtype zonder extra versterking van het signaal door antilichaam labeling. Het fluorescerende eiwit alleen detecteerbaar zijn in het gewenste celtype / s. Representatieve voorbeelden van preparaten met open boek en doorsneden van embryo geëlektroporeerd met de verschillende plasmiden worden getoond in figuur 2.

Efficiëntie van kunstmatige miRNAs

Artificial miRNAs tegen een nieuw gen van interesse moet eerst gescreend op efficiëntie en specificiteit van de effecten knockdown. We vinden dat β-actine promoter aangedreven constructen geëlektroporeerd bij 0,25 ug / ul, geschikt zijn voor deze 3. Knockdown in vivo kan getest worden door immunohistochemie of in situ hybridisatie.

Dil etikettering

Goed gericht Dil injecties in wildtype embryo'szou tot meer dan 80% van injectieplaatsen bij ideale archetypische trajecten 3, zoals getoond in figuur 3. Dier tot dier variabiliteit moet laag.

Figuur 1
Figuur 1. Generalized schema van het miRNA-expressie plasmide vectoren. Het gebruik van verschillende RNA polymerase II promoters / enhancers kunnen celtype-specifieke expressie. De getransfecteerde cellen worden geïdentificeerd door de expressie van een fluorescerende reporter die direct (binnen een transcript) gekoppeld aan een of twee kunstmatige miRNAs die afbreken genexpressie. Vetgedrukte tekst geeft de sense streng van een kunstmatige miRNA tegen LacZ, zoals beschreven in de tekst.

Figuur 2
Figuur 2. Representatieve voorbeelden of fluorescent eiwit expressie verkregen na elektroporatie van de aangegeven plasmidevectoren. Doorsneden en open boeken zijn van HH25-26 kippenembryo's die werden geëlektroporeerd op HH18. β-actine promoter drijft alomtegenwoordige expressie, Math1 versterker drijft expressie in DI1 neuronen en Hoxa1 versterker drijft expressie specifiek in de vloerplaat. CN, commissurale neuron, OH, vloerplaat.

Figuur 3
Figuur 3. Toepassing en analyse van Dil injectieplaatsen in open boek preparaten. DiI worden geïnjecteerd in een patroon punctata, dichtbij de laterale rand van het open boek, het geëlektroporeerde zijde (aangeduid met fluorescent eiwit expressie). Na 3 dagen diffusie moet commissurale axon trajecten kunnen worden gevisualiseerd onder fluorescentiemicroscopie. Normaal axon trajecten zal groeien naar de vloer plaat, steek de vloerplaat en zet en groeien rostraal. Abnormale fenotypes als gevolg van gen knock down kan worden vergeleken met deze archetypische traject. In het voorbeeld een stall axons in de bodemplaat of om verkeerde beslissingen draaien aan de contralaterale zijde.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Deze eenvoudige vector-gebaseerde kunstmatige miRNA expressie strategie kan worden gebruikt om knockdown endogene genexpressie in de kip neurale buis. Deze functionele tools bieden meerdere gene silencing, tijdelijke controle en cel-type specificiteit, de interpretatie van complexe ontwikkelingstrajecten te vergemakkelijken. In het bijzonder hebben we aangetoond dat de bruikbaarheid van deze plasmiden in commissurale axon leiding, aangezien de plasmiden kunnen worden gebruikt om verschillende genen knockdown in commissurale neuronen of in hun tussentijdse doelstelling, de vloerplaat 3.

De intensiteit en plaats van fluorescerend eiwit expressie gegenereerd uit de miRNA tot expressie plasmiden (en dus tot zwijgen cellen) zal afhangen van de volgende parameters:

  1. Enhancer gebruikt:
    1. β-actine promoter is alom actief
    2. Math1 versterker is alleen actief in DI1 neuronen 12
    3. 13
  2. Concentratie van plasmide.
    Als plasmide concentratie te hoog is, kan dit "lekkage" van de enhancer activiteit en daaropvolgende expressie in ongewenste cellen, terwijl te weinig plasmide kan de expressie van het fluorescerende eiwit verminderen en voorkomen geëlektroporeerde cellen zijn traceerbaar. Hoge concentraties van RNAi plasmiden moet worden vermeden om off-target te verminderen en vermindert de kans dat niet-specifieke toxiciteit als gevolg van verzadiging van het endogene miRNA biogenese pathway. We maken gebruik van:
    1. β-actine promoter: 0,25 ug / ul
    2. Math1 enhancer: 0,7 ug / ul
    3. Hoxa1 enhancer III: 0.5-1.0 ug / ul
  3. Nauwkeurigheid van elektroporatie.
    Omgaan met kippenembryo's in ovo vereist manuele vaardigheden die moeten worden verworven door middel van training. Wij en anderenhebben eerder gepubliceerde tips voor het oplossen van deze procedure 14,15.

Verschillende miRNAs moet mogelijk worden getest voordat een geschikte kandidaat is gevonden. Dit proces moet nemen de identificatie van verschillende onafhankelijke miRNAs om een waargenomen fenotype, negatieve controles (roerei en / of niet-verwante miRNAs) en redding bouwt 16 te bevestigen.

Open-boek voorbereidingen moeten optimaal worden vastgesteld en geïnjecteerd met Dil op de juiste plaats om de structurele details van de axonale projecties van commissurale neuronen te visualiseren. Hoge achtergrond kan worden veroorzaakt door langdurige fixatie van de open-boeken of morsen van DiI. Injectie van Dil in cellen te dorsaal gelegen zal meestal resulteren in een gebrek aan bestempeld axonale projecties in de richting van de vloerplaat. Cellen te ventraal gelegen zal hebben veel ipsilaterale en contralaterale uitsteeksels aan de middellijn, en moet dus worden vermeden. Voor beginners, raden wij oefenen op open-boeken uit wildtype embryo's tot een nauwkeurige en reproduceerbare positionering van de Dil te garanderen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Geen belangenconflicten verklaard.

Acknowledgements

Werken in het lab van ES wordt ondersteund door de Zwitserse National Science Foundation. We willen graag Dr Beat Kunz bedanken voor hulp bij het filmen.

Materials

Name Company Catalog Number Comments
0.5 mm glass capillaries World Precision Instruments 1B120F-4
Glass needle puller Narishige PC-10
Electroporator BTX ECM 830
Sylgard silicone elastomer World Precision Instruments SYLG184
Tungsten wire, 0.075 mm World Precision Instruments TGW0325
Insect pins, 0.20 mm Fine Science Tools 26002-20
Insect pins, 0.10 mm Fine Science Tools 26002-10
Spring scissors Fine Science Tools 15003-08
Dumont #5 forceps Fine Science Tools 11252-20
Dumont #55 forceps Fine Science Tools 11255-20
Fast DiI Molecular Probes D-7756
Fluorescent microscopes Olympus SZX12, BX51

DOWNLOAD MATERIALS LIST

References

  1. Chédotal, A. Further tales of the midline. Current Opinion in Neurobiology. 21, 68-75 (2011).
  2. Avraham, O., Hadas, Y., Vald, L., Zisman, S., Schejter, A., Visel, A., Klar, A. Transcriptional control of axonal guidance and sorting in dorsal interneurons by the Lim-HD proteins Lhx9 and Lhx1. Neural Development. 4, 21 (2009).
  3. Wilson, N. H., Stoeckli, E. T. Cell type specific, traceable gene silencing for functional gene analysis during vertebrate neural development. Nucleic Acids Research. 39, e133 (2011).
  4. Das, R. M., van Hateren, N. J., Howell, G. R., Farrell, E. R., Bangs, F. K., Porteous, V. C. A robust system for RNA interference in the chicken using a modified microRNA operon. Developmental Biology. 294, 554-563 (2006).
  5. Perrin, F. E., Stoeckli, E. T. Use of lipophilic dyes in studies of axonal pathfinding in vivo. Microscopy Research and Technique. 48, 25-31 (2000).
  6. Timmer, J., Johnson, J., Niswander, L. The use of in ovo electroporation for the rapid analysis of neural-specific murine enhancers. Genesis. 29, 123-132 (2001).
  7. Kieleczawa, J. Simple modifications of the standard DNA sequencing protocol allow for sequencing through siRNA hairpins and other repeats. Journal of Biomolecular Techniques. 16, 220-223 (2005).
  8. Hamburger, V., Hamilton, H. L. A series of normal stages in the development of the chick embryo. Journal of Morphology. 88, 49-92 (1951).
  9. Boulland, J., Halasi, G., Kasumacic, N., Glover, J. C. Xenotransplantation of Human Stem Cells into the Chicken Embryo. J. Vis. Exp. (41), e2071 (2010).
  10. Kim, B. G., Dai, H. -N., McAtee, M., Vicini, S., Bregman, B. S. Labeling of dendritic spines with the carbocyanine dye DiI for confocal microscopic imaging in lightly fixed cortical slices. Journal of Neuroscience Methods. 162, 237-243 (2007).
  11. Murphy, M. C., Fox, E. A. Anterograde tracing method using DiI to label vagal innervation of the embryonic and early postnatal mouse gastrointestinal tract. Journal of Neuroscience Methods. 163, 213-225 (2007).
  12. Helms, A. W., Abney, A. L., Ben-Arie, N., Zoghbi, H. Y., Johnson, J. E. Autoregulation and multiple enhancers control Math1 expression in the developing nervous system. Development. 127, 1185-1196 (2000).
  13. Li, X., Lufkin, T. Cre recombinase expression in the floorplate, notochord and gut epithelium in transgenic embryos driven by the Hoxa-1 enhancer III. Genesis. 26, 121-122 (2000).
  14. Mauti, O., Baeriswyl, T., Stoeckli, E. T. G. ene Silencing by Injection and Electroporation of dsRNA in Avian Embryos. Cold Spring Harbor Protocols. (2008).
  15. Krull, C. E. A primer on using in ovo electroporation to analyze gene function. Developmental Dynamics. 229, 433-439 (2004).
  16. Cullen, B. R. Enhancing and confirming the specificity of RNAi experiments. Nature Methods. 3, 677-681 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics