الإنتاج واستهداف الأحادي التكافؤ الكم النقاط

1Department of Otolaryngology, University of California, San Francisco, 2Department of Chemistry, University of California, Berkeley, 3Materials Science Division, Lawrence Berkeley National Laboratory, 4Department of Pharmaceutical Chemistry, University of California, San Francisco, 5Tetrad Graduate Program, University of California, San Francisco, 6Center for Systems and Synthetic Biology, University of California, San Francisco, 7Chemistry and Chemical Biology Graduate Program, University of California, San Francisco
* These authors contributed equally
Published 10/23/2014
0 Comments
  CITE THIS  SHARE 
Bioengineering
 

Summary

Cite this Article

Copy Citation

Seo, D., Farlow, J., Southard, K., Jun, Y. w., Gartner, Z. J. Production and Targeting of Monovalent Quantum Dots. J. Vis. Exp. (92), e52198, doi:10.3791/52198 (2014).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

ديناميكية الجزيئات واحدة على الخلايا الحية تساهم في الوظيفة البيولوجية الخاصة بهم. التصوير مضان جزيء واحد هو وسيلة شعبية لدراسة ديناميكية الجزيئات واحدة على 1،2،3 سطح الخلية. ومع ذلك، فإن تحقيقات التصوير الأكثر شيوعا في هذه الدراسات لها عيوب عديدة مهمة. على سبيل المثال، والأصباغ العضوية والبروتينات الفلورية التقليدية توفر سطوع معتدل، حوالي 10 -10 5 6 M -1 سم -1، ولكن غير مستقرة ضوئيا، وتبيض بعد انبعاث حوالي 10 -10 5 6 الفوتونات في ظل ظروف التصوير الخلية الحية النموذجية 4،5. في المقابل، أشباه الموصلات النانوية، وعادة ما يطلق نقاط الكم (QDS)، هي أكثر إشراقا بكثير وأكثر استقرارا، مع معاملات الانقراض في حدود 10 -10 6 7 M -1 سم -1 وتتجاوز 10 -10 7 8 الفوتونات المنبعثة قبل photobleaching 5. تحسن السطوع وصمود من QDS على fluorophores العضوية يتيح مراقبة الجزيئات واحدة في أسرع بشكل ملحوظ معدلات الإطار وأكثر من 6 مسارات أطول بكثير.

على الرغم من مزاياها والتوافر التجاري، لا تزال عدة التزامات لهذه العوامل التصوير قوية. أولا، أنها محددة بشكل واضح استهداف التكافؤ، مما قد يؤدي في يشابك من الجزيئات الحيوية المستهدفة 6. الثانية، لديهم عادة حجم كبير الهيدروديناميكية (> 20 نانومتر) الذي يحد من إمكانية الوصول إلى بعض البيئات المزدحمة الخلوية 7. ثالثا، أنها حدت من استهداف نمطية 7. وقد حاول العديد من الاستراتيجيات لمعالجة هذه المشاكل 8،9،10، ولكن عموما تتطلب معرفة متخصصة والكواشف لتنفيذها.

لمعالجة هذه المشاكل، ونحن ذكرت مؤخرا استراتيجية "استبعاد الفراغية" لإعداد الأحادي التكافؤ، صغيرة، ووحدات QDS 11. هي ملفوفة في QDS مع DNA phosphorothioate طويلة (ptDNA) البوليمر واحد. وptDNA يربط إلى السطح QD متعددة من خلال التفاعل بين الزنك-S-تتعرض سطح ذرات الزنك والجماعات phosphorothioate من البوليمر ptDNA. بوليمر المربوطة واحد sterically وكهربية يستبعد الربط مكافئات إضافية من البوليمر دون زيادة كبيرة الحجم الكلي الجسيمات (حوالي 2 نانومتر). كلها الكواشف المتاحة تجاريا، وتشكل المنتجات عالية الغلة، وهذه العملية تتطلب سوى خطوات تحلية لتنقية. مرة واحدة المسمى، QDS ملفوفة مع ptDNA (mQDs) ربط واحد للحمض النووي مكملة تحمل تستهدف المجالات (على سبيل المثال، benzylguanine (BG)، benzylcytosine، أو alkylhalides).

هذه الوظائف تستهدف mQDs تحديدا إلى علامات الأنزيمية مثل SNAP، وCLIP HALO التي تنصهر فيها وراثيا لبروتين من الفائدة. هذا هو بروتوكول لتوليف، الاستهداف، والتصوير الخلية الحية من mQDs التي تنتجها استبعاد الفراغية.

Protocol

1. إنتاج الأحادية التكافؤ الكم النقاط

  1. نقل مرحلة من QDS العضوية إلى المرحلة المائية
    1. تمييع 200 ميكرولتر من محلول 1 ميكرومتر من QDS المرحلة العضوية مع 400 ميكرولتر من كلوروفورم في كوب 5 مل قارورة.
    2. مزيج 400 ميكرولتر من محلول 0.3 M tetrabutylammonium بروميد (TBAB) الكلوروفورم مع 36 ميكرولتر من أنيق MPEG ثيول (CH 3 O (CH 2 CH 2 O) 6 C 2 H 5 SH) ويهز O / N.
    3. إضافة 800 ميكرولتر من 0.2 M هيدروكسيد الصوديوم محلول مائي ويهز لمدة 30 ثانية. يحدث نقل المرحلة في غضون بضع دقائق، يتبين من نقل الجزيئات الملونة إلى المرحلة المائية فوق المرحلة العضوية أكثر كثافة.
    4. إذا كانت الجزيئات تتجمع في المرحلة الثالثة بين المراحل المائية والعضوية، وزيادة فترة حضانة مع ثيول MPEG. إذا بقيت المرحلة المائية واضحة، إلا أن QDS لم نقل مرحلة (انظر الشكل 3A). بالتناوب، وزيادة تناسقالتموينية من MPEG ثيول في الخطوة 2 لتخفيف الفقراء نقل المرحلة.
    5. استرداد (ملونة) المرحلة المائية ومن ثم تركيز QDS جمعها مع Centricon تدور العمود (30 كيلو دالتون الوزن الجزيئي قطع) إلى 1 مل.
    6. إضافة محلول QD تتركز في عمود باستخدام Sephadex NAP10 معايرتها قبل مع 10 ملي تريس العازلة التي تحتوي على 30 ملي كلوريد الصوديوم (الرقم الهيدروجيني 8.0). أزل QDS مع 1.5 مل من شطف العازلة من تدفق الجاذبية.
    7. قياس تركيز QDS مع امتصاص الطيفي في 350 نانومتر.
  2. إعداد mQDs
    1. شراء (أو توليف) ptDNA. يستخدم هذا البروتوكول تسلسل 5'-A S 50 (CT) 10 (ACTG) 5 -3 "(انظر الجدول 1).
DNA تسلسل
5'-A S 50 (CT) 10 (ACTG) 5 A S S A A A S S S A A A S S S A A A S S S A A A S S S A A A S S
A A S S S A A A S S S A A A S S S A A A S S S A A A S S S A A A S S
A A S S S A A A S S S A A A S S S A A A S S S A A A S S S A A A S S
CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG
5'-NH 2 - (CT) 10 (CAGT) 5 -3 " NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT
BG-DNA BG- / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT

الجدول 1. تسلسل الحمض النووي المستخدمة لإنتاج وmQDs الهدف.

  1. إعداد 1 مل من 100 نانومتر حل QD في 10 ملي تريس العازلة التي تحتوي على 30 ملي كلوريد الصوديوم (الرقم الهيدروجيني 8).
  2. إضافة قطرة من الحكمة 500 ميكرولتر من 100 نانومتر ptDNA حل للQDS مائي لمدة 1 دقيقة مع التحريك بقوة. تحريك أو وضع على شاكر ل9 ساعة إضافية.
    ملاحظة: هذا يجب أن ينتج نظريا نسبة 1: 2 من ptDNA: QD. ومع ذلك، رياضيات الكيمياء الفعلي هو الكمال أبدا - عادة ما تكون النتيجة هي أقرب إلى 1: 1.5. من أجل إنتاج نسبة 1: 1 من ptDNA: QD، بعد قياس كثافة الكهربائي للهلام ضرورية لقياس نسبة الدقيق من الاقتران نظرا لحجم المعروفة المستخدمة أعلاه.
  3. ~ إزالة 10 ميكرولتر من خليط QD لتشغيل على agarose هلام التحليلية. أيضا إزالة تركيز مماثل من QDS اللامقترن في المرحلة المائية (من الخطوة 1.2.1).
    1. إضافة ~ 2 μ؛ ل من 6X Ficoll العازلة تحميل (لزيادة كثافة الحل) وتشغيل هذه العينات اثنين معا على هلام 0.8٪ وزن / V الاغاروز في بورات الصوديوم عازلة لمدة 15 دقيقة في 150 V. فرقة واحدة في السيطرة على الممر اللامقترن المهاجرة بالقرب من البئر، وشريطين في الممر مع QDS مترافق وينظر (انظر المواد الهلامية في الشكل 2B).
  4. حساب جزء QD لا مقترن باستخدام الكثافة النسبية للعصابات اثنين (انظر المعادلة في الشكل 2B). ثم استخدام ذلك جزء لحساب الحجم الإضافي من 100 نانومتر ptDNA الحل المطلوب لتتناسب مع عدد QDS.
  5. كرر الخطوات من 1.2.3 إلى 1.2.5 مرة أخرى مع هذا الحجم المحسوب أو حتى انهيار QDS مترافق إلى فرقة واحدة على هلام تشير الاقتران الكامل لجميع QDS.
  6. إضافة 100 ميكرولتر من 10 ملي (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (كربوكسي PEG6 ثيول ألكان) في 10 ملي تريس العازلة التعاونntaining 30 مم كلوريد الصوديوم (الرقم الهيدروجيني 8) إلى mQDs مترافق المنتجة أعلاه، ويهز لمدة 10 دقيقة.
    ملاحظة: هذه بروابط PEG إيقاف فاعلية سطح QD. وهناك أطول PEG أفضل إيقاف فاعلية وQDS، ومع ذلك، فإنه سيتم أيضا زيادة حجمها. وظائف ثيول ألكان مسعور لديها تقارب أعلى بكثير لQDS، في مجموعها، من أقل مسعور PEG-ثيول تستخدم لنقل المرحلة. لذا، لا تسمح هذه الخطوة للمضي قدما طويلة جدا أو سيتم استبدال ptDNA من قبل ألكان-PEG-ثيول. ~ بعد 30 دقيقة الحضانة، سيكون قد تم تشريد جزء كبير من الحمض النووي من QDS (الشكل 3B).
  7. لإزالة الزائد ألكان PEG-ثيول، إضافة 0.5 مل من محلول QD إلى عمود باستخدام Sephadex NAP5 معايرتها قبل مع شطف العازلة (10 ملي تريس العازلة التي تحتوي على 30 ملي كلوريد الصوديوم). جمع mQDs مع 1.0 مل من شطف العازلة من تدفق الجاذبية.
  8. تركيز QDS جمعها مع عمود الدوران Centricon (30 كيلو دالتون). تخزين هذه mQDs في 4 درجة مئوية لمدة أشهر. لا الابeeze لهم.
    ملاحظة: إذا كان يعتبر بيليه الملونة في أسفل الأنبوب، وتجميع النقاط ويرجح لم تعد صالحة للاستعمال.

2. إنتاج استهداف (Benzylguanine-) DNA

  1. إنتاج أو شراء DNA منتهية أمين. يستخدم هذا البروتوكول تسلسل 5'-NH 2 - (CT) 10 - (CAGT) 5 -3 "(انظر الجدول 1). رابط بولي-CT يزيد من إمكانية الوصول إلى وظيفة في أعماق الكنان السكري ولكن قد لا تكون هناك حاجة لجميع التطبيقات. إذا كان هناك إمكانية الوصول إلى المزج الحمض النووي، وإنتاج الحمض النووي تعديل الأمينية باستخدام المناسب 5 "الأمينية معدل (5 'الأمينية معدل C6).
  2. حل BG-N-hydroxysuccinimide (BG-NHS) في الجافة ثنائي ميثيل سلفوكسيد (DMSO) بتركيز 10 ملغ / مل.
    ملاحظة: BG-NHS تمتص الماء من الجو وتؤدي إلى التحلل من رد الفعل NHS استر، لا سيما في المذيبات مثل DMSO hydroscopic وثنائي ميثيل الفورماميد (DMF). BG-NHS هو أفضل متجرد -80 ° C على شكل مسحوق في قنينة خاصة بها داخل حاوية تحتوي على المجففة الثانوي. الحارة لRT قبل فتح القارورة. بالتناوب، قسامة فورا للاستخدام الفردي استر BG-NHS في مذيب قطبي جاف وتجميد في -80 درجة مئوية، أو تتفاعل مع الحمض النووي بشكل كامل أمين في الخطوة 2.2.
  3. الرد عن طريق خلط BG-NHS في DMSO من الخطوة 2.1 مع DNA منتهية أمين في HEPES (4- (2 هيدروكسي إيثيل) حامض -1-piperazineethanesulfonic) مخزنة (الرقم الهيدروجيني 8.5) المياه. في رد فعل نموذجي 20 ميكرولتر من 10 ملغ / مل BG-NHS في DMSO مع 2 ميكرولتر من 2 ملي NH 2 - (CT) 10 - (CAGT) 5 في 58 ميكرولتر منزوع الأيونات الماء مخزنة مع 20 ميكرولتر 0.5 M HEPES الرقم الهيدروجيني 8.5. تنفيذ ردود الفعل في أنبوب microcentrifuge 1.5 مل. مزيج العائدات أسرع وقت رد الفعل سريعا ويجب أن تتنافس مع NHS استر التحلل.
  4. يصوتن لمدة 5-10 دقيقة لضمان خلط دقيق. احتضان ~ 1 ساعة على RT نسبة متكافئة من BG: الحمض النووي يمكن تغييرها لدفع رد فعل على الانتهاء.
  5. تنقية BG-DNA من غير المتفاعل أمين-DNA بواسطة عكس المرحلة HPLC تشغيل TEAA 100 ملي: أسيتونتريل (ACN) التدرج بين 8٪ و 95٪ الأسيتونيتريل أكثر من 30 دقيقة. فإن أمين-DNA غير المتفاعل أزل قبل BG-DNA. جمع جزء BG-DNA في أنبوب مخروطي.
    1. استخدام عمود C 18 Zorbax لتنقية قليل النوكليوتيد القياسية والتدرج التالية:
      0 → 15 دقيقة: 8 → 30٪ ACN.
      15 → 21 دقيقة: 30-90٪ ACN.
      21 → 25 دقيقة: 90 → 8٪ ACN.
      25 → 30 دقيقة: 8٪ ACN.
  6. تجميد في النيتروجين السائل ويجفد الأجزاء المتجمعة. Resuspend وDNA في الماء منزوع الأيونات. أن تكون أكثر حذرا، يجفد مرتين أكثر لإزالة TEAA المتبقية. TEAA المتبقية يمكن أن تكون سامة للخلايا بتركيزات أعلى.
  7. Resuspend ومجفف بالتجميد BG-DNA في الماء، مع التأكد من غسل الجانبين من عشرأنبوب الإلكترونية، وتمييع ل~ 25 ميكرومتر الأسهم. قسامة وتخزينها في 4 درجة مئوية. تم تخزين العينات ل~ 9 أشهر دون تدهور ملحوظ.

3. خلايا وصفها العيش مع الأحادي التكافؤ الكم النقاط

  1. اختياريا، إيقاف فاعلية وmQDs قبيل تجربة التصوير باستخدام الكواشف مثل الكازين (0.5٪) أو ألبومين المصل البقري (BSA، 1-3٪).
  2. لوحة الخلايا معربا عن بروتين SNAP الموسومة على مجموع مضان انعكاس الداخلي (TIRF) الزجاج ذات جودة. في هذه التجربة، ونحن نستخدم خط خلية U2OS تعبر عن مستقبل Notch1 SNAP الموسومة والواجهات الزجاجية عالية الجودة.
  3. بعد أن تعلق الخلايا على الزجاج (~ 24 ساعة)، وإزالة وسائط النمو، ويغسل مع برنامج تلفزيوني، واحتضان الخلايا لمدة 10-30 دقيقة في RT في ~ 100-150 ميكرولتر من برنامج تلفزيوني أو وسائل الإعلام الخلية التي تحتوي ~ 1 ميكرومتر BG- DNA من الخطوة 2.6 أعلاه.
  4. بعد الحضانة مع BG، وغسل بعناية الخلايا مع برنامج تلفزيوني أو وسائل الإعلام الخلية. احتضان الخلايا ل~ 5-10 دقيقة مع الmQDs الإلكترونية المنتجة في الخطوة 1.2.9 (وتخمل اختياريا في الخطوة 3.1).
  5. اختياريا، وغسل mQDs غير منضم والعودة الخلايا إلى المخزن مؤقت / وسائل الإعلام مناسب لكلا التصوير والثقافة. للخلايا التي كان من المقرر تصويرها في وضع TIRF، كانت خطوة غسل النهائية غالبا ما تكون غير ضرورية كما mQDs غير منضم في حل تنتشر بسرعة كبيرة مقارنة مع mQDs ملزمة لتكون غير قابلة للكشف خلال التحليل.

4. المجهري والتحليل

  1. صورة الخلايا باستخدام المجهر TIRF.
    ملاحظة: يجب أن يكون نطاق الإثارة والمرشحات للفصل الانبعاثات، أو مرشح مكعب QD مخصصة. QDS هي أفضل متحمس مع ليزر منخفض الطول الموجي (405 أو 488 نانومتر). QDS من القطر المختلفة لها أطوال موجية الانبعاثات المميزة، التي ترتبط عادة مع التحول إلى ستوك كبيرة ل.
  2. بسبب سطوع mQDs، وجمع الصور في إطار معدلات عالية في حين TIRF التصوير الجانب القاعدي للخلية الحية.
    ملاحظة: بدلا من ذلك، يمكن ديناميات واحدة جزيء يكون اتباعهحش في طائرات التنسيق الأخرى باستخدام المجهر الغزل القرص مبائر. آلية تتبع البرمجيات واحد الجسيمات ناجحا عموما في تتبع بدقة mQDs مشرق وصامد.

Representative Results

نقل مرحلة من مراحل QDS من العضوية إلى المرحلة المائية هو أمر حاسم لإنتاج mQDs، ولكن يمكن أن تكون على شرط وQD محددة. يجب أن تظهر في مرحلة نقل القسم 1.1 نظيفة كما أول قارورة اثنين في الشكل 3. إذا ظهر نقل أكثر مثل قنينة 3، ثم ينبغي للمرء أن المحاولة مرة أخرى مع الظروف المختلفة.

مرة واحدة والمغلفة للQDS مع الحمض النووي المشحونة سلبا عليهم الهجرة على هلام بشكل منفصل عن QDS غير الملفوفة. باستخدام قسامة من QDS ملفوف كعنصر تحكم، والثانية، يجب أن تظهر الفرقة أسرع المهاجرة عليها اضافة ptDNA، كما رأينا في هلام الأول في الشكل 2B. ويتجلى تشكيل كامل للmQDs مع فقدان الفرقة متحركة، وانهياره في الفرقة المتنقلة كما رأينا في الماضي جل في الشكل 2B. إذا قسامة من الناتج mQD الخاص بترحيل بمثابة فرقة واحدة للفصل من QDS ملفوف، ثم mQDs لديك هي أحادي التكافؤ وص إيدي لاستخدامها في اتخاذ مزيد من الخطوات.

يجب أن يكون وضع العلامات خلية معينة إلى الهدف من اختيارك ويجب أن تكون معتمدة على مستويات التعبير البروتين وتركيز mQD. وغالبا ما يتطلب التحسين التجريبية من كل من تركيز mQD وmQD التخميل لأي تطبيق معين. الشكل 4B يدل على وضع العلامات الخلايا U2OS تعبر عن مستقبلات الشق SNAP الموسومة مع mQDs تتراوح تركيز من 0.5 نانومتر إلى 10 نانومتر.

الشكل 1
الرقم 1. حدات استهداف mQDs. mQDs هجن إلى ssDNA بين functionalized من قبل مختلف الجزيئات الاستهداف. Benzylguanine المرتبطة أهداف DNA mQDs لالتقاط الموسومة البروتينات الانصهار. التعديلات الأخرى 5 'و تسلسل الحمض النووي تمكن استهداف mQDs لمجموعة متنوعة من الجزيئات الحيوية الأخرى./files/ftp_upload/52198/52198fig1highres.jpg "الهدف =" _ على بياض "> اضغط هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل 2
الرقم 2. خطة لإنتاج mQDs. يتم نقل (A) QDS المرحلة العضوية إلى المرحلة المائية عن طريق العلاج مع MPEG ثيول وTBAB، ملفوفة مع ptDNA، وتخمل مع كربوكسي PEG6 ثيول ألكان. صور الممثل TEM هي QD545 العضوية، QD585، وQD605، على التوالي. (B) وهناك طريقة لتحديد تجريبيا رياضيات الكيمياء من التفاعل بين QDS وptDNA في الخطوة الثانية أعلاه. ويتم التحقق منها QD وptDNA stoichiometries تجريبيا بواسطة قياس كثافة مثل أن رد فعل رياضيات الكيمياء النهائي هو 1: 1 (QD: ptDNA). يتم ضرب العدد الأولي مولات ptDNA من نسبة QD: mQD، وتعديلها من قبل AF الحجم الفعلي ثالثا اقتران لانتاج عدد مولات اللازمة لتحقيق 1: 1 اقتران الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الرقم 3
الرقم 3. تفاصيل التجريبية لإنتاج mQDs. (A) الصور التمثيلية للنجاح وفشل نقل المرحلة. يجب QDS نقل بصريا بين المرحلة العضوية الكثيفة والمرحلة المائية أقل الكثيفة. فصل مرحلة ناقصة يشير نقل الفقراء. (B) ptDNA يمكن الاستعاضة عن ألكان-PEG-ثيول. البيانات هلام الصحيح هو ممثل رد فعل حيث نزح جزء كبير من ptDNA من QDS بسبب الإفراط في التخميل.es.jpg "الهدف =" _ على بياض "> اضغط هنا لمشاهدة نسخة أكبر من هذا الرقم.

الرقم 4
الرقم 4. صفها البروتينات SNAP الموسومة في الخلايا الحية. (A) تخطيطي مما يدل على التعبير، مرفق ووضع العلامات على مستقبلات SNAP الموسومة مع mQD BG المستهدفة. (ب) وضع العلامات الممثل خلايا تعبر عن SNAP-الشق-mCherry بناء بتركيزات mQD المختلفة. mQDs تخمل مع PEG12 colocalize مع mCherry تشير العلامات محددة. كثافة العلامات الدنيا (<0.5 نانومتر) هي الأفضل عموما لتتبع جسيم واحد. شريط النطاق هو 10 ميكرون. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

Discussion

على نمطية للتصميم mQD يمكن زيادة درجة المرونة التجريبية. على سبيل المثال، مجموعة متنوعة من mQDs يمكن إعداد بسرعة بألوان فريدة تسمح التصوير المتزامن لأهداف متعددة. تسلسل استهداف ssDNA يمكن توجيه mQDs إلى البروتينات، والسكريات 12، والدهون والأسطح 13. وهناك عدد من العلامات الأنزيمية المتاحة مع نشاطية متعامدة، مما يسمح لأهداف متعددة في وقت واحد يمكن تصوير مع mQDs المستهدفة بشكل مختلف. وبالإضافة إلى استهداف مع العلامة SNAP، كان وسم البروتينات الهدف مع mQDs باستخدام علامة CLIP، العلامة HALO، والبروتينات المعقدة البيروكسيديز ناجحة أيضا. يوضح هذا البروتوكول وصفها محدد من المستقبلات على سطح الخلايا الحية مع هذه mQDs، ولكن يمكن بسهولة أن تتكيف بروتوكول لعدد من السياقات المختلفة.

البصيرة المنهجية الهامة في إنتاج mQDs مع تكافؤ محددة هي أن ~ المرتبطة phosphorothioate 50هناك حاجة إلى التفاف قواعد QDS (وبالتالي منع جزيئين من الملزم في وقت واحد). A-A بولي تسلسل S 50 بتكاثر ومستقر ملزمة QDS 605 نانومتر من تقنيات الحياة. على الرغم من أنه تم وقف هذا المنتج، واستراتيجية الإقصاء الفراغية هي تعميم لمنتجات مماثلة من موردين آخرين جود مختلف الأحجام والأشكال، والخصائص الطيفية.

كفاءة واستقرار QDS ptDNA الملفوفة تعتمد بشكل كبير على الكيمياء السطحية وهيكل QDS. وبالتالي، فإن نجاح بروتوكول تعتمد على بنية مصدر والكيميائية التجاري للQDS. لأغراض هذا البروتوكول، وهناك ثلاث نقاط رئيسية للفرق بين مصادر تجارية مختلفة من QDS: اختلاف في الشروط اللازمة لنقل المرحلة. الفرق في قوة الأولي ملزم PEG-ثيول يجند، ربما تعوق التشريد من قبل ptDNA. واختلاف في كمية يتعرض CdSe الأساسية، والتي يمكن جنيهإعلان للتبريد من QD من قبل MPEG شروط نقل المرحلة ثيول.

والنشر، QDS مع أفضل بنية لإنتاج mQDs هي 4-10 QDS نانومتر CdSe / اغشية الأساسية / شل شراؤها من تقنيات الحياة مع أطياف الانبعاثات في 545، 585، 605 و 625 نانومتر (الشكل 2A). QDS استنادا إلى صياغة "حية" (545، 605، الخ) على إخماد إضافة MPEG ثيول وغير مناسبة لهذا التطبيق. QDS من الدريتش والمحيط تكنولوجيا النانو تعمل بشكل جيد، ولكن تتطلب خطوات نقل مرحلة أطول والمعالجة المسبقة مع أكسيد trioctylphosphine. وقد تم تحسين هذا البروتوكول لQDS من تقنيات الحياة.

يتم إنهاء تسلسل بولي-A phosphorothioate تستخدم لالتفاف QDS مع الأصلي 20 مير ذيل DNA تحتوي على تسلسل (ACTG) 5 التي تستهدف حبلا قد هجن. هذا التسلسل غير مريحة، كما أن لديها قليل من دون هيكل الثانوي، وسيظل hybridizإد عند 37 درجة مئوية في برنامج تلفزيوني. إذا كان هناك إمكانية الوصول إلى المزج الحمض النووي، يمكن للptDNA توليفها من ثم تنقيته بواسطة عكس المرحلة اللوني السائل عالي الأداء (HPLC) باستخدام عمود C 8. سوف ptDNA أزل في وقت لاحق على HPLC من أليغنوكليوتيد] تعادل مع العمود الفقري الأصلي. نحن عادة ترك 5 'DMT حماية المجموعة على أليغنوكليوتيد] phosphorothioate لدينا بعد تنقيتها.

مطلوب عادة التخميل من QDS ptDNA ملفوفة في أجل تحسين الاستقرار الغروية من QDS والحد خلفية ملزمة لمعظم التطبيقات التجريبية. يستخدم بروتوكول طبقة من PEG-إيقاف فاعلية وQDS. كربوكسي PEG ثيول ألكان مع وحدات إضافية PEG ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H 23 SH، كربوكسي-PEG12 ثيول ألكان) يوفر انخفاض كبير الخلفية، على الرغم من أن أوتاد أطول على حد سواء أكبر، وعموما أكثر تكلفة. mQDs المغلفة مع كربوكسي PEG الكابروابط ثيول شمال شرق مستقرة للغاية في مخازن الفسيولوجية مثل ملاحات الفوسفات مخزنة وسائل الإعلام والثقافة. أظهر تخزين على المدى الطويل (> 8 أشهر) من mQDs في 4 درجات مئوية أي تجميع كبير أو ptDNA مفرزة 11. تبعا للتجربة، PEG التخميل من QDS وحده لا يقلل بما فيه الكفاية دائما غير محددة وملزمة للmQDs. احتضان كل من الخلايا وmQDs في الفوسفات مخزنة المالحة (PBS) التي تحتوي على 3٪ BSA لمدة 20 دقيقة قبل استخدامها يقلل إلى حد كبير غير محددة ملزمة للخلايا، على الرغم من أنه لا يزيد نصف قطرها الهيدروديناميكية واضح من قبل mQDs ~ 50٪. التخميل مع 0.5٪ يقلل من الكازين غير محددة ملزمة أبعد من ذلك ولكن لأنه يزيد من حجم واضحا إلى حد أكبر من BSA.

5 'نهاية حبلا الحمض النووي مكملة لmQDs يمكن تعديلها لتمكين استهداف عدد من الجزيئات الحيوية المختلفة. هناك عدد من التقنيات المتاحة لتأسيس تعديل تساهميا البروتينات، لipids والسكريات مع الحمض النووي واحد الذين تقطعت بهم السبل (ssDNA). طالما يتم تقديم ssDNA خارج الخلية، فإنه يمكن الوصول إلى mQDs قابل للذوبان. سوف mQDs مع تسلسل أعلاه هجن بسرعة مع حبلا الحمض النووي التكميلي في ظل ظروف ثقافة الخلية. و10-20x بولي (CT) فاصل بين ptDNA وتسلسل استهداف قد تكون هناك حاجة لكفاءة استهداف وذلك لرفع تسلسل ملزمة فوق الكنان السكري سميكة وذات الشحنة السالبة للخلية. لهذا البروتوكول اخترنا لإنتاج DNA-BG مع سلسلة متكاملة من (CAGT) 5 من شأنها أن كلا تهجين إلى mQDs وتساهميا ربط نفسه إلى البروتين SNAP-علامة لوصفها سريع ومحدد. وظائف بروتوكول مماثلة تماما لاقتران أخرى NHS-استرات ل[أليغنوكليوتيد المعدلة الأمينية.

للتصوير جزيء واحد، وعادة ما تتطلب كثافة منخفضة من وضع العلامات لحل الجزيئات الفردية. وهناك تركيز mQD النهائي ~ 0.5 نانومتر في برنامج تلفزيوني مع وكيل تخميلهو هدف جيد. ومع ذلك، أدت هذه التخفيفات عالية أحيانا في ظل وضع العلامات من الخلايا. إذا حدث هذا، يمكن أن تضاف إضافية mQD حتى لوحظ كثافة المثلى لوضع العلامات. في حالة SNAP الموسومة Notch1 البشري، تركيزات> 10 نانومتر mQD أنتجت خلايا وضع العلامات كثيفة بينما أسفرت 0.5 نانومتر mQD في المرفق من ~ 20 mQDs على السطح القاعدي الخلايا المستهدفة (انظر الشكل 4B). كان وضع العلامات خلية مع mQDs يعتمد بشكل كبير من الخلايا confluency مطلي. مفرطة في خلايا متكدسة لا التسمية في السطوح القاعدية الخاصة بهم.

باختصار، طريقة بسيطة لتوليد أحادي التكافؤ وصفت QDS وحدات. هذه mQDs تجد فائدة في مجموعة واسعة من تطبيقات التصوير الخلية الحية، كما يتبين من تصوير مستقبلات الشق على الخلايا U2OS الحية. تطبيق mQDs لا يقتصر على هذه الحالة المحددة، ولكن يمكن تمديد يحتمل للأهداف الخلوية الأخرى مثل البروتينات الأخرى، والأحماض النووية، والإنزيمات.

Acknowledgements

التمويل المقدم من قبل وزارة الدفاع W81XWH-1023/10/01 (ZJG)، منحة GM081879 P50 من مركز UCSF للنظم والبيولوجيا الاصطناعية (ZJG)، NIH 5R21EB015088-02 (YJ)، والمعاهد الوطنية للصحة 1R21EB018044 (ZJG وYJ). وأيد DS بواسطة برنامج العلوم الحدودي الإنسان العابرة بعد الدكتوراة التخصصات الزمالة البحثية.

Materials

Name Company Catalog Number Comments
mQD Production
Phosphorothioate DNA:
(A*)x50-(ACTG)x5 IDT Most DNA Synthesis companies
Quantum Dots:
QDots 525, 585, 605 & 625 Invitrogen Q21791MP (545), Q21711MP (585), Q21701MP (605) Custom QD synthesis for QD625.
QD610 Ocean Nanotech QSP-610-10 
QD 610 lamda Aldrich 731854
Chloroform, 99.8% ACROS 67-66-3
Tetrabutylammonium bromide, 98.0% Sigma-Aldrich 426288
mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95% Polypure 11156-0695
HSC11EG6CO2H  [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H] ProChimia TH 003-m11.n6-0.1
Boric Acid, 99.5% Sigma-Aldrich B0394
Sodium Hydroxide, 99.0% ACROS S/4845
Sodium Chloride, 98% Sigma-Aldrich 310166
Agarose LE U.S. Biotech Sources G02PD-125
Ethanol Sigma-Aldrich 459828
BG-DNA Production
Amine DNA:
(CAGT)5-NH2 IDT N/A Most DNA Synthesis companies
(CAGT)5(T)40-NH2 IDT N/A Most DNA Synthesis companies
NHS-GLA-Benzylguanine New England Biosciences S9151
DMSO Sigma-Aldrich D8428
HEPES Buffer Sigma-Aldrich 83264
NAP5 Column GE Healthcare 17-0853-01
C18 Column
Acetonitrile
Mammalian Cell Culture & Imaging
Cell line expressing SNAP-tagged protein New England Biosciences E9100S
McCoys 5A UCSF Cell Culture Facility Specific to U2OS culture
Fetal Bovine Serum UCSF Cell Culture Facility Specific to U2OS culture
PBS UCSF Cell Culture Facility
Nunc Lab-tek II Chambered Coverglass Thermo-Fischer Scientific 155409
Matriplate 96-well plate Brooks Life Science Systems MGB096-1-2-LG-L
BSA
5% Alkali-soluble Casein EMD Millipore 70955 Not all caseins are the same
(Optional) DNA Synthesis Reagents
5’ Amine modifier C6 Glen Research Oct-06
dA-Thiophosphoramidite Glen Research 10-700
Analysis Software
FIJI http://valelab.ucsf.edu/~schindelin/
RyTrack.pro http://sun.iwu.edu/~gspaldin/rytrack.html
Tracker http://www.gartnerlab.ucsf.edu/more/software

DOWNLOAD MATERIALS LIST

References

  1. Sako, Y., Minoghchi, S., Yanagida, T. Single-molecule imaging of EGFR signaling on the surface of living cells. Nature Cell Biology. 2, (3), 168-172 (2000).
  2. Luo, W., He, K., Xia, T., Fang, X. Single-molecule monitoring in living cells by use of fluorescence microscopy. Analytical and Bioanalytical Chemistry. 405, (1), 43-49 (2013).
  3. Chung, I., et al. Spatial control of EGF receptor activation by reversible dimerization on living cells. Nature. 464, (7289), 783-787 (2010).
  4. Fernández-Suárez, M., Ting, A. Fluorescent probes for super-resolution imaging in living cells. Nature Reviews Molecular Cell Biology. 9, (12), 929-943 (2008).
  5. Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy. The Journal of Physical Chemistry B. 105, (35), 8281-8284 (2001).
  6. Pinaud, F., Clarke, S., Sittner, A., Dahan, M. Probing cellular events, one quantum dot at a time. Nature Methods. 7, (4), 275-285 (2010).
  7. Michalet, X., et al. Quantum dots for live cells, in vivo imaging, and diagnostics. Science. 307, (5709), 538-544 (2005).
  8. Howarth, M., et al. Monovalent, reduced-size quantum dots for imaging receptors on living cells. Nature Methods. 5, (5), 397-399 (2008).
  9. Iyer, G., et al. Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging. Bioconjugate Chemistry. 22, (6), 1006-1011 (2011).
  10. Tikhomirov, G., et al. DNA-based programming of quantum dot valency, self-assembly and luminescence. Nature Nanotechnology. 6, (8), 485-490 (2011).
  11. Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. Formation of targeted monovalent quantum dots by steric exclusion. Nature Methods. 10, (12), 1203-1205 (2013).
  12. Gartner, Z. J., Bertozzi, C. R. Programmed assembly of 3-dimensional microtissues with defined cellular connectivity. Proceeding of the National Academy of Sciences USA. 106, (12), 4606-4610 (2009).
  13. Selden, N. S., et al. Chemically programmed cell adhesion with membrane-anchored oligonucleotides. Journal of the American Chemical Society. 134, (2), 765-768 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats