ייצור ומיקוד של חד-אנרגיה קוונטית נקודות

1Department of Otolaryngology, University of California, San Francisco, 2Department of Chemistry, University of California, Berkeley, 3Materials Science Division, Lawrence Berkeley National Laboratory, 4Department of Pharmaceutical Chemistry, University of California, San Francisco, 5Tetrad Graduate Program, University of California, San Francisco, 6Center for Systems and Synthetic Biology, University of California, San Francisco, 7Chemistry and Chemical Biology Graduate Program, University of California, San Francisco
* These authors contributed equally
Published 10/23/2014
0 Comments
  CITE THIS  SHARE 
Bioengineering
 

Summary

Cite this Article

Copy Citation

Seo, D., Farlow, J., Southard, K., Jun, Y. w., Gartner, Z. J. Production and Targeting of Monovalent Quantum Dots. J. Vis. Exp. (92), e52198, doi:10.3791/52198 (2014).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

הדינמיקה של מולקולות בודדות על תאי חיים תורמת לתפקוד הביולוגי שלהם. דימות פלואורסצנטי המולקולה בודדת היא שיטה פופולרית ללמוד דינמיקת מולקולה בודדת על 1,2,3 פני התא. עם זאת, יש לי בדיקות ההדמיה הנפוצות ביותר במחקרים אלה יש כמה חסרונות חשובים. לדוגמא, צבעים אורגניים קונבנציונליים וחלבוני ניאון לספק בהירות מתונה, על 10 5 -10 6 M -1 cm -1, אבל הם לא יציבים photochemically, הלבנה לאחר הפליטה של כ 10 5 -10 6 פוטונים בתנאי הדמיה לחיות תאים טיפוסיים 4,5. בניגוד לכך, חלקיקים מוליכים למחצה, נקודות קוונטיות בתדירות גבוהה נקראות (QDs), הם בהירים באופן משמעותי ויציבים יותר, עם מקדמי הכחדה בטווח של 10 -1 6 -10 7 M -1 סנטימטר ועולה על 10 7 -10 8 פוטונים הנפלטים לפני photobleaching 5. הבהירות וphotostability המשופרת של QDs מעל fluorophores האורגני מאפשרים התצפית של מולקולות בודדות במסגרת שיעורים מהירים יותר באופן משמעותי ועל הרבה יותר מסלולי 6.

למרות יתרונותיהם וזמינות מסחרית, כמה התחייבויות יישארו לסוכני הדמיה רבי עוצמה אלה. ראשית, יש להם בצורה גרועה מוגדר ולנסי מיקוד, אשר עלול לגרום לcrosslinking של מולקולות ביולוגיות ממוקדים 6. שני, בדרך כלל יש להם גודל גדול הידרודינמית (> 20 ננומטר) שמגביל את הנגישות לסביבות סלולריות צפופות מסוימות 7. שלישית, הם מוגבלים מיקוד מודולריות 7. כמה אסטרטגיות ניסו לטפל 8,9,10 בעיות אלה, אך בדרך כלל דורשות ידע וחומרים כימיים מיוחדים כדי ליישם.

כדי להתמודד עם בעיות אלה, אנו דיווחו לאחרונה על אסטרטגיה "הדרה סטרית" להכנה חד ערכי, קטן, ומודולרי QDs 11. QDs הם עטופים בפולימר יחיד DNA phosphorothioate הארוך (ptDNA). PtDNA נקשר למשטח QD דרך אינטראקציות Zn-S מרובים בין אטומי Zn משטח חשוף וקבוצות phosphorothioate של פולימר ptDNA. פולימר קשור אחד sterically ואלקטרוסטטי אינו כולל המחייב שווים נוסף של הפולימר מבלי להגדיל את הגודל הכולל של החלקיקים (כ 2 ננומטר) באופן משמעותי. כל ריאגנטים זמינים מסחרי, מוצרים נוצרים בתשואה גבוהה, והתהליך דורש רק צעדי desalting לטיהור. שכותרתו ברגע, QDs עטוף בלאגד ptDNA (mQDs) יחיד לגדילי דנ"א משלימים נושאות תחומים מיקוד (למשל, benzylguanine (BG), benzylcytosine, או alkylhalides).

הפונקציות הללו מיועדים לmQDs במיוחד כדי תגים האנזימטית כגון SNAP, CLIP & HALO הגנטי התמזגו החלבון של עניין. זהו פרוטוקול לסינתזה, מיקוד, והדמיה לחיות תאים של mQDs מיוצר על ידי הדרה סטרית.

Protocol

.1 ייצור של חד-אנרגיה קוונטית נקודות

  1. העברת שלב של QDs מאורגני לשלב מימיים
    1. לדלל 200 μl של פתרון 1 מיקרומטר של QDs שלב האורגני עם 400 μl של כלורופורם בבקבוקון זכוכית 5 מ"ל.
    2. מערבבים 400 μl של פתרון 0.3 M ברומיד tetrabutylammonium כלורופורם (TBAB) עם 36 μl של תיאול MPEG המסודר (CH 3 O (CH 2 CH 2 O) 6 C 2 H 5 SH) ולנער O / N.
    3. הוספת 800 μl של תמיסה מימית M NaOH 0.2 ולנער במשך 30 שניות. העברת שלב מתרחשת תוך דקות ספורות, מסומנות על ידי ההעברה של החלקיקים הצבעוניים לשלב המימית מעל השלב האורגני הצפוף יותר.
    4. אם החלקיקים לצבור בשלב שלישי בין השלבים מימיים ואורגניים, להגדיל את זמן דגירה עם תיאול MPEG. אם את השלב המימית נשאר ברור, QDs לא העביר שלב (ראה איור 3 א). לחלופין, להגדיל את concentמנה של תיאול MPEG בשלב 2 כדי להקל על העברת שלב עניה.
    5. לשחזר את השלב (בצבע) המימית ולאחר מכן להתרכז QDs נאסף עם טור ספין Centricon (חתוכי 30 משקל מולקולרי KDA) עד 1 מ"ל.
    6. מוסיף את פתרון QD מרוכז בעמודת Sephadex NAP10 מראש equilibrated עם 10 חיץ מ"מ טריס המכיל 30 mM NaCl (pH 8.0). Elute QDs עם 1.5 מ"ל של חיץ elution ידי זרימת כוח הכבידה.
    7. למדוד את הריכוז של QDs עם ספקטרוסקופיה קליטה ב350 ננומטר.
  2. הכנת mQDs
    1. רכישה (או לסנתז) ptDNA. פרוטוקול זה משתמש ברצף 5'-S 50 (CT) 10 (ACTG) 5 -3 '(ראה טבלה 1).
DNA רצף
5'-S 50 (CT) 10 (ACTG) 5 S S S S S S S S S S S S S S S S
S S S S S S S S S S S S S S S S S
S S S S S S S S S S S S S S S S S
CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG
5'-NH 2 - 10 (CAGT) (CT) 5 -3 " NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT
BG-DNA BG- / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT

.1 רצפי DNA שולחן המשמשים לייצור וmQDs היעד.

  1. הכן 1 מ"ל של 100 פתרון QD ננומטר ב10 חיץ מ"מ טריס המכיל 30 mM NaCl (pH 8).
  2. הוסף טיפה חכמה 500 μl של פתרון ננומטר ptDNA 100 לQDs המימית 1 דקות תוך ערבוב נמרץ. מערבבים או הנח על שייקר ל9 שעות נוספות.
    הערה: זה אמור באופן תיאורטי לייצר 1: 2 יחס של ptDNA: QD. עם זאת, stoichiometry בפועל הוא לעולם לא מושלם - בדרך כלל התוצאה קרובה יותר ל1: 1.5. על מנת לייצר 1: 1 יחס של ptDNA: QD, צפיפות לאחר ג'ל אלקטרופורזה יש צורך לכמת את היחס של נטיה ניתנה הכרכים הידועים בשימוש מעל מדויק.
  3. הסר ~ 10 μl של תערובת QD לרוץ על ג'ל agarose אנליטיים. גם להסיר ריכוז דומה של QDs unconjugated בשלב מימיים (מצעד 1.2.1).
    1. להוסיף ~ 2 μ; L של חיץ טעינת 6x Ficoll (כדי להגדיל את צפיפות פתרון) ולהפעיל שתי דגימות אלה יחד על ג'ל agarose wt 0.8% / v במאגר borate נתרן ל15 דקות ב 150 V. להקה יחידה בנתיב שליטת unconjugated הנודד קרוב ל גם, ושתי להקות במסלול עם QDs מצומדות נראים (ראה ג'לי באיור 2).
  4. לחשב את החלק היחסי QD unconjugated באמצעות העצמה היחסית של שתי להקות (ראה המשוואה בתרשים 2B). לאחר מכן, השתמש חלק שכדי לחשב את הנפח נוסף של 100 פתרון ננומטר ptDNA הנדרש כדי להתאים את מספר QDs.
  5. חזור על השלבים 1.2.3 ל1.2.5 פעם נוספת עם נפח מחושב זו או עד לקריסת QDs מצומדות ללהקה אחת על הג'ל המצביע על נטיה של כל QDs מלאה.
  6. הוספה של 10 מ"מ (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (carboxy PEG6 האלקאן תיאול) 100 μl ב10 שיתוף חיץ מ"מ טריסntaining 30 mM NaCl (pH 8) לmQDs מצומדות מיוצר לעיל, ולנער עבור 10 דקות.
    הערה: ligands PEG אלה passivate משטח QD. PEG כבר לא טוב יותר-passivate QDs, עם זאת, זה יהיה גם להגדיל את הגודל שלהם. יש פונקציונלי תיאול האלקאן הידרופובי זיקה גבוהה יותר ל QDs, במצטבר, מ PEG-תיאול משומש פחות הידרופובי להעברת שלב. לכן, אינו מאפשר בשלב זה כדי להמשיך זמן רב מדי או ptDNA יוחלף על ידי-PEG-תיאול האלקאן. לאחר דגירה דקות ~ 30V, חלק משמעותי של DNA יהיה נעקרו מQDs (איור 3 ב).
  7. כדי להסיר PEG-תיאול האלקאן עודף, להוסיף 0.5 מ"ל של פתרון QD לעמודת NAP5 Sephadex מראש equilibrated עם חיץ elution (10 חיץ מ"מ טריס המכיל 30 mM NaCl). לאסוף mQDs עם 1.0 מ"ל של חיץ elution ידי זרימת כוח הכבידה.
  8. להתרכז QDs נאסף עם טור ספין Centricon (30 KDA). אחסן mQDs אלה על 4 מעלות צלזיוס במשך חודשים. אל freeze
    הערה: אם גלולה בצבע בחלק התחתון של הצינור נראית, את הנקודות שנצברות וצפויות כבר לא שמישים.

2 הפקה של DNA מיקוד (Benzylguanine-)

  1. לייצר או לרכוש DNA-הסתיים אמין. פרוטוקול זה משתמש ברצף 5'-NH 2 - (CT) 10 - (CAGT) 5 -3 '(ראה טבלה 1). מקשר poly-CT מגדיל את נגישות לפונקציונליות הקבור עמוק בglycocalyx אבל ייתכן שלא יהיה צורך לכל היישומים. אם יש גישה לסינתיסייזר DNA, לייצר DNA-הותאם אמינו באמצעות 5 'אמינו-משנה (5' מתאים C6 אמינו-משנה).
  2. לפזר BG-N-hydroxysuccinimide (BG-NHS) בsulfoxide דימתיל היבש (DMSO) בריכוז של 10 מ"ג / מ"ל.
    הערה: BG-NHS יספוג מים מהאוויר ולהוביל להידרוליזה של NHS-אסתר תגובתי, במיוחד בממסי hydroscopic כמו DMSO וdimethylformamide (DMF). BG-NHS הוא החנות הטובה ביותרד ב -80 מעלות צלזיוס כאבקה בבקבוקון משלו בתוך יבוש מיכל המכיל משנית. חם לRT לפני פתיחת הבקבוקון. לחלופין, מייד aliquot ליחד אסתר BG-NHS לתוך ממס קוטבי יבש ולהקפיא ב -80 מעלות צלזיוס, או להגיב באופן מלא עם DNA האמין בשלב 2.2.
  3. מגיב על ידי ערבוב BG-NHS בDMSO מצעד 2.1 עם DNA-הסתיים אמין בHEPES (4 (2-Hydroxyethyl) חומצת -1-piperazineethanesulfonic) נאגר (pH 8.5) מים. בטיפוסי להגיב 20 μl של 10 מ"ג / מ"ל BG-NHS בDMSO עם 2 μl של 2 מ"מ NH 2 - (CT) 10 - (CAGT) המים deionized 5 ב58 μl בופר עם 20 μl 0.5 M HEPES pH 8.5. לבצע תגובות בצינור 1.5 מ"ל microcentrifuge. מערבבים במהירות כתגובה ממשיכה במהירות וחייבת להתחרות עם הידרוליזה NHS-אסתר.
  4. Sonicate ל5-10 דקות כדי להבטיח ערבוב יסודי. דגירה ~ שעה 1 בRT. יחס stoichiometric של BG: DNA ניתן לשנות לנהוג התגובה להשלמה.
  5. לטהר את BG-DNA מאמין-DNA unreacted ידי התהפך-שלב HPLC פועל TEAA 100 מ"מ: אצטוניטריל שיפוע (ACN) בין 8% ו95 אצטוניטריל% מעל 30 דקות. אמין-DNA unreacted יהיה elute לפני BG-DNA. לאסוף את שבר BG-DNA בצינור חרוטי.
    1. השתמש בעמודת C 18 Zorbax לטיהור oligonucleotide סטנדרטית והשיפוע הבא:
      0 → 15 דקות: 8 → 30% ACN;
      15 → 21 דקות: 30-90% ACN;
      21 → 25 דקות: 90 → 8% ACN;
      25 → 30 דקות: 8% ACN;
  6. הקפאה בחנקן נוזלי וLyophilize החלק שנאסף. Resuspend DNA במים ללא יונים. להיות זהיר במיוחד, Lyophilize עוד פעמים כדי להסיר TEAA השיורי. TEAA שיורי יכול להיות רעיל לתאים בריכוזים גבוהים יותר.
  7. Resuspend BG-DNA lyophilized במים, והקפד לשטוף את הצדדים של הצינור דואר, ולדלל את ~ 25 מיקרומטר המניה. Aliquot ולאחסן ב 4 ° C.. דגימות אוחסנו ל~ 9 חודשים ללא השפלה מורגשת.

3 תאי תיוג חיים עם חד-אנרגיה קוונטית נקודות

  1. לחלופין, passivate mQDs רק לפני ניסוי הדמיה באמצעות ריאגנטים כגון קזאין (0.5%) או אלבומין בסרום שור (BSA, 1-3%).
  2. פלייט תאים המבטאים את החלבון מתויג SNAP על זכוכית -quality הקרינה השתקפות פנימית (TIRF) בסך הכל. בניסוי זה, אנו משתמשים בשורת תאי U2OS להביע קולט Notch1 מתויג SNAP ומשטחי זכוכית באיכות גבוהה.
  3. לאחר שהתאים צמודים לזכוכית (~ שעה 24), להסיר את תקשורת צמיחה, לשטוף עם PBS, ודגירת התאים ל10-30 דקות ב RT ב~ 100-150 μl של PBS או תקשורת סלולארי המכילה ~ 1 מיקרומטר BG- DNA מצעד 2.6 לעיל.
  4. לאחר הדגרה עם BG, לשטוף בזהירות את התאים עם PBS או תקשורת סלולארי. דגירה התאים ל~ דקות 5-10 עם הmQDs דואר מיוצר בצעד 1.2.9 (ופסיבציה אופציונלית בשלב 3.1).
  5. לחלופין, לשטוף את mQDs מאוגד ולהחזיר את התאים לחיץ / מדיה מתאימה גם להדמיה ולתרבות. לתאים שהיו להיות צילמו במצב TIRF, לשטוף את שלב סופי היה לעתים קרובות מיותר כmQDs מאוגד בפתרון מתפזר במהירות כה רב בהשוואה לmQDs כבול כמו להיות בלתי ניתן לגילוי בזמן הניתוח.

.4 מיקרוסקופית וניתוח

  1. תמונת התאים באמצעות מיקרוסקופ TIRF.
    הערה: ההיקף חייב להיות עירור להפרדה ומסנני פליטה, או קוביית מסנן QD המותאם אישית. QDs נרגש הטובים ביותר עם לייזר נמוך אורך גל (405 או 488 ננומטר). יש לי QDs בקוטר שונה באורכי גל פליטה אופייניים, בדרך כלל קשור בשינוי של סטוק גדולה.
  2. בגלל הבהירות של mQDs, לאסוף תמונות במסגרת חליפין גבוהות בTIRF תוך הדמיה צד הבסיס של תא חי.
    הערה: לחלופין, דינמיקת מולקולה בודדת יכולה להיות folloנישא במטוסי מוקד אחרים באמצעות מיקרוסקופ confocal הדיסק מסתובב. תוכנת מעקב חלקיק יחיד אוטומטי היא בדרך כלל מוצלחת במעקב מדויק אחר mQDs הבהיר וphotostable.

Representative Results

העברת השלב של QDs מאורגני לשלב מימיים היא קריטית לייצור mQDs, אבל יכולה להיות גם condition- וQD-ספציפי. העברת שלב בסעיף 1.1 אמורה להופיע נקייה כמו שני הבקבוקונים הראשונים באיור 3. אם העברה מופיעה יותר כמו 3 בקבוקון, אז צריך לנסות שוב עם תנאים שונים.

ברגע שQDs מצופה בDNA באופן שלילי הטעון הם צריכים להעביר על ג'ל בנפרד מQDs העטוף שאינו. באמצעות aliquot של QDs עטיפה כביקורת, שנייה, להקה מהר יותר-נודדת אמורה להופיע על תוספת של ptDNA, כפי שניתן לראות בג'ל הראשון באיור 2. היווצרות מלאה של mQDs באה לידי ביטוי באובדן של הלהקה הנייחת, וקריסתה לתוך הפס הנייד כפי שניתן לראות בג'ל האחרון באיור 2. אם aliquot של מוצר mQD שלך נודד כלהקה יחידה להפרדה מQDs העטיפה, אז mQDs שלך הם חד ערכי וr eady לשמש בצעדים נוספים.

תיוג תא צריך להיות ספציפי ליעד של הבחירה שלך וצריך להיות תלוי ברמות ביטוי חלבון וריכוז mQD. אופטימיזציה אמפירית של שני ריכוז mQD ופסיבציה mQD נדרשה לעתים קרובות עבור כל יישום נתון. איור 4 מדגים את התיוג של תאי U2OS להביע קולט Notch מתויג SNAP עם mQDs נע בריכוז מ0.5 ננומטר ל10 ננומטר.

איור 1
איור 1 מודולרי מיקוד של mQDs. MQDs להכליא ssDNA פונקציונליות על ידי מולקולות מיקוד שונות. Benzylguanine צמוד mQDs מטרות DNA לSNAP מתויגים חלבוני היתוך. שינויים '5 אחרים ורצפי DNA יאפשרו המיקוד של mQDs למגוון של מולקולות ביולוגיות אחרות."Target =" /files/ftp_upload/52198/52198fig1highres.jpg _blank "> לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2 תכנית לייצור mQDs. () QDs אורגני-השלב מועבר לשלב המימית על ידי טיפול עם תיאול MPEG וTBAB, עטוף בptDNA, ופסיבציה עם תיאול האלקאן PEG6 carboxy. נציג תמונות TEM הן QD545 האורגני, QD585, וQD605, בהתאמה. (ב) שיטה לקביעה אמפירית ההרכב של אינטראקציה בין QDs וptDNA בשלב שני לעיל. stoichiometries QD וptDNA מאומת באופן אמפירי על ידי צפיפות כזו שstoichiometry התגובה הסופי הוא 1: 1 (QD: ptDNA). המספר הראשוני של שומות של ptDNA מוכפל בשיעור של QD: mQD, והותאם על ידי af הנפח בפועל נטיית ter להניב מספר השומות הנדרשות כדי להשיג 1:. 1 נטיה אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
3 פרטי איור ניסיוני לייצור mQDs. () תמונות נציג מוצלח וכושלות העברת שלב. QDs צריך מבחינה ויזואלית להעביר בין השלב האורגני הצפוף והשלב מימיים פחות הצפוף. ההפרדה פאזות שלמה מציינת העברת עניים. יכול להיות מוחלף (B) ptDNA על ידי-PEG-תיאול האלקאן. נתונים ג'ל נכונים הוא נציג של תגובה שבו חלק משמעותי של ptDNA נעקרו מQDs בשל-פסיבציה מעל."Target =" es.jpg _blank "> לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 4
איור 4 התיוג SNAP-מתויג חלבונים בתאים חיים. (א) סכמטי המדגים את הביטוי, קובץ מצורף וסימון של קולט SNAP-מתויג עם mQD ממוקד BG. תיוג נציג של תאים לבטא SNAP-Notch-mCherry לבנות בריכוזים mQD שונים (B). mQDs פסיבציה עם PEG12 colocalize עם mCherry המציין תיוג ספציפי. צפיפויות תיוג נמוכות (<0.5 ננומטר) הן בדרך כלל עדיפות למעקב אחר חלקיקים בודדים. סרגל קנה מידה הוא 10 מיקרומטר. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

Discussion

המודולריות של עיצוב mQD מאפשרת מידה מוגברת של גמישות ניסיונית. לדוגמא, מגוון של mQDs ניתן להכין במהירות בצבעים ייחודיים המאפשרים להדמיה בו זמנית של מספר רב של מטרות. רצף מיקוד ssDNA יכול לכוון mQDs לחלבונים, סוכרים 12, שומנים ומשטחים 13. מספר התגים האנזימטית זמין עם reactivities מאונך, המאפשר מטרות מרובות להיות צילמו בו זמנית עם mQDs הממוקד באופן דיפרנציאלי. בנוסף למיקוד עם תג SNAP, תיוג של חלבוני יעד עם mQDs שימוש בתג CLIP, תג HALO, וחלבוני biotinylated היה גם מוצלח. פרוטוקול זה מדגים את התיוג הספציפי של קולט משטח על תאי חיים עם mQDs אלה, אבל הפרוטוקול יכול בקלות להיות מותאם למספר הקשרים השונים.

תובנה מתודולוגיים המשמעותית בייצור mQDs עם ולנסי מוגדרים היא ש~ 50 phosphorothioate צמודבסיסים נדרשים לעטוף QDs (ובכך למנוע את שתי מולקולות מלהיקשר בו זמנית). -פולי רצף S 50 reproducibly ויציבות כרוך 605 QDs ננומטר מחי טכנולוגיות. למרות שמוצר זה הופסק, אסטרטגית ההדרה סטרית היא להכליל למוצרים דומים מיצרנים אחרים שיש בגדלים שונים, צורות, תכונות ספקטרליות.

היעילות והיציבות של QDs העטוף ptDNA תלויה באופן קריטי על הכימיה של פני השטח והמבנה של QDs. לכן, ההצלחה של פרוטוקול תהיה תלויה במבנה המקור וכימי המסחרי של QDs. למטרות פרוטוקול זה, שלוש נקודות עיקריות של הבדל קיים בין מקורות שונים מסחריים של QDs: הבדל בתנאים דרושים להעברת שלב; הבדל בכח של עקירה ראשונית מחייבת PEG-תיאול ליגנד, אולי פוגע בptDNA; והבדל בסך של ליבת CdSe חשופה, אשר יכול leמודעה למרווה של QD על ידי תנאי העברת שלב תיאול MPEG.

החל בפרסום, QDs עם המבנה הטוב ביותר לייצור של mQDs הוא 4-10 QDs CdSe ננומטר / ליבת ZnS / פגז שנרכש מחי טכנולוגיות עם ספקטרום פליטה ב545, 585, 605 & 625 ננומטר (איור 2 א). QDs מבוסס על הניסוח "Vivid" (545, 605, וכו ') להרוות על תוספת של תיאול MPEG ואינם מתאימים ליישום זה. QDs מאולדריץ והאוקיינוס ​​ננוטק לעבוד היטב, אך דורש צעדי העברת שלב ארוך יותר וטיפול מקדים בתחמוצת trioctylphosphine. פרוטוקול זה כבר מותאם לQDs מחי טכנולוגיות.

רצף poly-phosphorothioate נהג לעטוף את QDs מסתיים עם זנב דנ"א יליד 20-mer המכיל את הרצף של (ACTG) 5 עד שגדיל מיקוד עשוי להכליא. רצף זה הוא נוח, שכן יש לא מעט על מנת מבנה משני, ויישאר hybridizעורך על 37 מעלות צלזיוס בPBS. אם יש גישה לסינתיסייזר DNA, ptDNA יכול על ידי מסונתז ולאחר מכן מטוהר על ידי כרומטוגרפיה הנוזלית ביצועים גבוהים שלב הפוך (HPLC) באמצעות טור C 8. PtDNA יהיה elute בהמשך HPLC מאשר oligonucleotides המקביל עם עמוד השדרה ילידים. אנחנו בדרך כלל לעזוב את 5 'DMT הגנת קבוצה על oligonucleotides phosphorothioate שלנו לאחר טיהור.

פסיבציה של QDs העטוף ptDNA נדרשת בדרך כלל כדי לשפר את יציבות colloidal של QDs ולהפחית את הרקע מחייב עבור יישומים הניסיוניים ביותר. הפרוטוקול עושה שימוש PEG-שכבה לpassivate QDs. Carboxy PEG תיאול האלקאן עם יחידות PEG נוסף ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H SH 23, תיאול האלקאן carboxy-PEG12) מספק מופחת באופן משמעותי רקע, אם כי את היתדות כבר שניהם גדולות יותר, ובדרך כלל יקר יותר. mQDs מצופה carboxy PEG אלקההליגנדים תיאול ne הם מאוד יציבים במאגרים פיסיולוגיים כגון Salines פוספט שנאגרו ותקשורת ותרבות. אחסון לטווח ארוך (> 8 חודשים) של mQDs על 4 מעלות צלזיוס לא הראה צבירה משמעותית או ניתוק ptDNA 11. בהתאם לניסוי, פסיבציה PEG של QDs לבד לא תמיד מספיק להפחית הלא ספציפית מחייבת של mQDs. דוגרים שני תאים וmQDs בופר פוספט (PBS) המכיל BSA 3% עבור 20 דקות לפני השימוש מפחית באופן משמעותי שאינו ספציפי מחייב את תאים, למרות שזה מגדיל את הרדיוס הידרודינמית לכאורה של mQDs על ידי ~ 50%. פסיבציה עם קזאין 0.5% מפחיתה את הלא ספציפי מחייב עוד יותר אבל זה מגדיל את הגודל הנראית לעין ליותר מBSA במידה רבה יותר.

סוף '5 של גדיל DNA משלים לmQDs יכול להיות שונה כדי לאפשר מיקוד של מספר המולקולות הביולוגיים שונות. ישנן מספר טכניקות שהוקמו לרשות לשנות קוולנטית חלבונים, lipids וסוכרים עם דנ"א יחיד שנתקע (ssDNA). כל עוד ssDNA מוצג extracellularly, הוא נגיש לmQDs המסיס. mQDs עם הרצפים מעל מהירות יהיה להכליא עם גדיל DNA משלים בתנאי תרבית תאים. Spacer 10-20x ליזין (CT) בין ptDNA ורצף המיקוד עשוי להידרש ליעיל מיקוד כדי להגביה את הרצף מחייב מעל glycocalyx העבה והטעון שלילי של התא. לפרוטוקול זה בחרנו לייצר BG-DNA עם רצף משלים של (CAGT) 5 ששניהם הכלאה לmQDs וקוולנטית לקשר את עצמו לחלבון SNAP-תג לתיוג מהיר וספציפי. פונקציות פרוטוקול דומות גם לצימוד NHS-אסטרים אחרים לoligonucleotides-הותאם אמינו.

להדמית מולקולה בודדת, צפיפות נמוכה של תיוג נדרשת בדרך כלל כדי לפתור מולקולות בודדות. ריכוז סופי mQD של ~ 0.5 ננומטר בPBS עם סוכן passivatingהוא יעד טוב. עם זאת, דילולים גבוהים אלה לעתים הסתיימו בתחת תיוג של התאים. במקרה זה, ניתן להוסיף mQD נוסף עד צפיפות אופטימלית של תיוג הוא ציין. במקרה של Notch1 אדם מתויג SNAP, ריכוזים של> 10 ננומטר mQD מיוצרים תאי תיוג צפופים תוך 0.5 ננומטר mQD הביא את הקובץ המצורף של ~ 20 mQDs על פני השטח הבסיסיים של תא מטרה (ראה איור 4). תא תיוג עם mQDs היה תלוי במידה רבה של confluency של תאים מצופים. מדי תאים ומחוברות לא לתייג במשטחים הבסיסיים שלהם.

לסיכום, שיטה פשוטה ליצירה חד ערכי וQDs מודולרית תואר. mQDs אלה למצוא שירות במגוון רחב של יישומי הדמיה תא חיים, כפי שהודגם על ידי ההדמיה קולט Notch על תאי U2OS חיים. תחולתו של mQDs אינה מוגבלת למקרה הספציפי הזה, אבל יכולה באופן פוטנציאלי להיות מורחב למטרות סלולריות אחרות כגון חלבונים אחרים, חומצות גרעין, ואנזימים.

Acknowledgements

מימון הניתן על ידי משרד ההגנה האמריקאי W81XWH-1023/10/1 (ZJG), GM081879 P50 מענק ממרכז קליפורניה בסן פרנסיסקו למערכות וביולוגיה סינתטית (ZJG), NIH 5R21EB015088-02 (YJ) וNIH 1R21EB018044 (ZJG & YJ). DS נתמכה על ידי מענק מחקר פוסט דוקטורט משמעתי האדם Frontier Science Program Cross-.

Materials

Name Company Catalog Number Comments
mQD Production
Phosphorothioate DNA:
(A*)x50-(ACTG)x5 IDT Most DNA Synthesis companies
Quantum Dots:
QDots 525, 585, 605 & 625 Invitrogen Q21791MP (545), Q21711MP (585), Q21701MP (605) Custom QD synthesis for QD625.
QD610 Ocean Nanotech QSP-610-10 
QD 610 lamda Aldrich 731854
Chloroform, 99.8% ACROS 67-66-3
Tetrabutylammonium bromide, 98.0% Sigma-Aldrich 426288
mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95% Polypure 11156-0695
HSC11EG6CO2H  [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H] ProChimia TH 003-m11.n6-0.1
Boric Acid, 99.5% Sigma-Aldrich B0394
Sodium Hydroxide, 99.0% ACROS S/4845
Sodium Chloride, 98% Sigma-Aldrich 310166
Agarose LE U.S. Biotech Sources G02PD-125
Ethanol Sigma-Aldrich 459828
BG-DNA Production
Amine DNA:
(CAGT)5-NH2 IDT N/A Most DNA Synthesis companies
(CAGT)5(T)40-NH2 IDT N/A Most DNA Synthesis companies
NHS-GLA-Benzylguanine New England Biosciences S9151
DMSO Sigma-Aldrich D8428
HEPES Buffer Sigma-Aldrich 83264
NAP5 Column GE Healthcare 17-0853-01
C18 Column
Acetonitrile
Mammalian Cell Culture & Imaging
Cell line expressing SNAP-tagged protein New England Biosciences E9100S
McCoys 5A UCSF Cell Culture Facility Specific to U2OS culture
Fetal Bovine Serum UCSF Cell Culture Facility Specific to U2OS culture
PBS UCSF Cell Culture Facility
Nunc Lab-tek II Chambered Coverglass Thermo-Fischer Scientific 155409
Matriplate 96-well plate Brooks Life Science Systems MGB096-1-2-LG-L
BSA
5% Alkali-soluble Casein EMD Millipore 70955 Not all caseins are the same
(Optional) DNA Synthesis Reagents
5’ Amine modifier C6 Glen Research Oct-06
dA-Thiophosphoramidite Glen Research 10-700
Analysis Software
FIJI http://valelab.ucsf.edu/~schindelin/
RyTrack.pro http://sun.iwu.edu/~gspaldin/rytrack.html
Tracker http://www.gartnerlab.ucsf.edu/more/software

DOWNLOAD MATERIALS LIST

References

  1. Sako, Y., Minoghchi, S., Yanagida, T. Single-molecule imaging of EGFR signaling on the surface of living cells. Nature Cell Biology. 2, (3), 168-172 (2000).
  2. Luo, W., He, K., Xia, T., Fang, X. Single-molecule monitoring in living cells by use of fluorescence microscopy. Analytical and Bioanalytical Chemistry. 405, (1), 43-49 (2013).
  3. Chung, I., et al. Spatial control of EGF receptor activation by reversible dimerization on living cells. Nature. 464, (7289), 783-787 (2010).
  4. Fernández-Suárez, M., Ting, A. Fluorescent probes for super-resolution imaging in living cells. Nature Reviews Molecular Cell Biology. 9, (12), 929-943 (2008).
  5. Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy. The Journal of Physical Chemistry B. 105, (35), 8281-8284 (2001).
  6. Pinaud, F., Clarke, S., Sittner, A., Dahan, M. Probing cellular events, one quantum dot at a time. Nature Methods. 7, (4), 275-285 (2010).
  7. Michalet, X., et al. Quantum dots for live cells, in vivo imaging, and diagnostics. Science. 307, (5709), 538-544 (2005).
  8. Howarth, M., et al. Monovalent, reduced-size quantum dots for imaging receptors on living cells. Nature Methods. 5, (5), 397-399 (2008).
  9. Iyer, G., et al. Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging. Bioconjugate Chemistry. 22, (6), 1006-1011 (2011).
  10. Tikhomirov, G., et al. DNA-based programming of quantum dot valency, self-assembly and luminescence. Nature Nanotechnology. 6, (8), 485-490 (2011).
  11. Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. Formation of targeted monovalent quantum dots by steric exclusion. Nature Methods. 10, (12), 1203-1205 (2013).
  12. Gartner, Z. J., Bertozzi, C. R. Programmed assembly of 3-dimensional microtissues with defined cellular connectivity. Proceeding of the National Academy of Sciences USA. 106, (12), 4606-4610 (2009).
  13. Selden, N. S., et al. Chemically programmed cell adhesion with membrane-anchored oligonucleotides. Journal of the American Chemical Society. 134, (2), 765-768 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats