Productie en Targeting van Monovalent Quantum Dots

1Department of Otolaryngology, University of California, San Francisco, 2Department of Chemistry, University of California, Berkeley, 3Materials Science Division, Lawrence Berkeley National Laboratory, 4Department of Pharmaceutical Chemistry, University of California, San Francisco, 5Tetrad Graduate Program, University of California, San Francisco, 6Center for Systems and Synthetic Biology, University of California, San Francisco, 7Chemistry and Chemical Biology Graduate Program, University of California, San Francisco
* These authors contributed equally
Published 10/23/2014
0 Comments
  CITE THIS  SHARE 
Bioengineering
 

Summary

Cite this Article

Copy Citation

Seo, D., Farlow, J., Southard, K., Jun, Y. w., Gartner, Z. J. Production and Targeting of Monovalent Quantum Dots. J. Vis. Exp. (92), e52198, doi:10.3791/52198 (2014).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

De dynamica van enkele moleculen op levende cellen bijdraagt ​​aan hun biologische functie. Enkel molecuul fluorescentie beeldvorming is een populaire methode om enkel molecuul dynamiek op het celoppervlak 1,2,3 studeren. Echter, de meest gebruikte beeldvormende probes in deze studies enkele belangrijke nadelen. Bijvoorbeeld, conventionele organische kleurstoffen en fluorescerende eiwitten bieden een matige helderheid, ongeveer 10 5 -10 6 M -1 cm -1, maar zijn fotochemisch instabiel, bleken na de emissie van ongeveer 10 5 -10 6 fotonen onder typische live cell imaging voorwaarden 4,5. Daarentegen halfgeleider nanodeeltjes, vaak aangeduid quantum dots (QD), aanzienlijk helderder en stabieler met extinctiecoëfficiënten in het bereik van 10 -10 6 7 M -1 cm -1 en meer dan 10 7 -10 8 geëmitteerde fotonen voor photobleaching 5. De verbeterde helderheid en fotostabiliteit van QD's dan organische fluoroforen maakt de observatie van enkele moleculen tegen aanzienlijk hogere snelheden en over veel langere trajecten 6.

Ondanks hun voordelen en commerciële beschikbaarheid, hoofdelijk aansprakelijk blijven voor deze krachtige imaging agenten. Ten eerste hebben ze slecht gedefinieerde valentie gericht, hetgeen kan resulteren in verknoping gerichte biomoleculen 6. Ten tweede, ze hebben over het algemeen een grote hydrodynamische grootte (> 20 nm) dat de toegankelijkheid beperkt tot bepaalde drukke cellulaire omgevingen 7. Ten derde, zijn ze beperkt gericht modulariteit 7. Verschillende strategieën hebben geprobeerd om deze problemen 8,9,10 pakken, maar over het algemeen vereisen specifieke kennis en reagentia te implementeren.

Om deze problemen aan te pakken, meldde onlangs dat we een "Sterische Uitsluiting" strategie voor het bereiden van monovalente, klein, enmodulaire QD 11. De QD's zijn verpakt met een enkele lange phosphorothioate DNA (ptDNA) polymeer. De ptDNA bindt aan de QD oppervlak via meerdere Zn-S interacties tussen het oppervlak blootgestelde Zn atomen en fosforothioaat groepen van de ptDNA polymeer. Een enkele gebonden polymeer sterisch en elektrostatisch sluit de binding van extra middelen van het polymeer zonder aanzienlijke verhoging van het deeltje totale omvang (ongeveer 2 nm). Alle reagentia zijn commercieel verkrijgbaar, worden gevormd in hoge opbrengst, en het proces vereist enige ontzouting stappen voor zuivering. Eenmaal gelabeld, QD's omwikkeld met een enkele ptDNA (mQDs) binden aan complementaire DNA-strengen dragende targeting domeinen (bijvoorbeeld benzylguanine (BG), benzylcytosine, of alkylhalogeniden).

Deze functionaliteiten gericht de mQDs specifiek enzymatische labels zoals SNAP, CLIP & HALO die genetisch gefuseerd met het eiwit van belang. Dit is een protocol voor de synthese, Targeting, en live-cell imaging van mQDs geproduceerd door sterische uitsluiting.

Protocol

1 Productie van Monovalent Quantum Dots

  1. Fase overdracht van QD's van organische naar waterige fase
    1. Verdun 200 ui van een 1 uM oplossing van organische fase QD met 400 pl chloroform in een 5 ml glazen flesje.
    2. Meng 400 ul van een 0,3 M tetrabutylammoniumbromide (TBAB) chloroformoplossing met 36 gl zuiver mPEG thiol (CH3 O (CH2 CH2 O) 6 C 2 H 5 SH) en schud O / N.
    3. Voeg 800 ul van een 0,2 M NaOH-oplossing in water en schud gedurende 30 sec. Een fase-overgang plaatsvindt binnen enkele minuten, aangeduid door de overdracht van de gekleurde deeltjes de waterige fase boven het dichtere organische fase.
    4. Als de deeltjes aggregeren in een derde fase tussen de waterige en organische fasen, verhoog de incubatietijd met mPEG thiol. Als de waterige fase helder is, de QDs niet faseoverdrachtskatalysator (zie figuur 3A). Afwisselend, verhogen de concentrantsoen mPEG thiol in stap 2 slechte faseoverdracht verlichten.
    5. Herstel de (gekleurde) waterige fase en concentreer daarna de verzamelde QDs met een Centricon spinkolom (30 kDa molecuulgewicht cut-off) tot 1 ml.
    6. Voeg de geconcentreerde QD oplossing in een Sephadex NAP10 kolom vooraf geëquilibreerd met 10 mM Tris buffer die 30 mM NaCl (pH 8,0). Elueer de QD's met 1,5 ml elutiebuffer door zwaartekracht.
    7. Meet de concentratie van QD's met absorptie spectroscopie bij 350 nm.
  2. Bereiding van mQDs
    1. Aankoop (of synthetiseren) ptDNA. Dit protocol maakt gebruik van de sequentie 5'-S A 50 (CT) 10 (ACTG) 5 -3 '(zie tabel 1).
DNA Sequence
5'-A S 50 (CT) 10 (ACTG) 5 A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG
5'-NH 2 - (CT) 10 (CAGT) 5 -3 ' NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT
BG-DNA BG / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT

Tabel 1 DNA-sequenties gebruikt voor de productie en target mQDs.

  1. Bereid 1 ml van 100 nM QD opgelost in 10 mM Tris buffer die 30 mM NaCl (pH 8).
  2. Drop wijze 500 pi van 100 nM ptDNA oplossing aan de waterige QDs gedurende 1 min onder krachtig roeren. Roer of te plaatsen op een shaker voor een extra 9 uur.
    Opmerking: Dit zou in theorie een 1: 2 verhouding van ptDNA: QD. De werkelijke stoichiometrie nooit perfect - meestal het resultaat dichter bij 1: 1.5. Om 1 produceren: 1 verhouding ptDNA: QD, densitometrie na gelelektroforese moet de precieze verhouding van conjugatie gezien de bekende volumes bovenstaande gebruikte kwantificeren.
  3. Verwijder ~ 10 pi van de QD mengsel te draaien op een analytische agarosegel. Verwijder ook een gelijkaardige concentratie van niet-geconjugeerd QD in waterige fase (van stap 1.2.1).
    1. Voeg ~ 2 μ, L 6x Ficoll laadbuffer (om dichtheid van de oplossing te verhogen) en werking van deze twee monsters samen op een 0,8% w / v agarosegel aan natrium boraat buffer gedurende 15 minuten bij 150 V. Een enkele band in het ongeconjugeerde controlelaan migreren dichtbij het goed, en twee bands in de baan met geconjugeerde QD's worden gezien (zie gels in figuur 2B).
  4. Bereken de ongeconjugeerde QD fractie met de relatieve intensiteit van de twee banden (zie de vergelijking in Figuur 2B). Gebruik dan dat gedeelte van de extra volume van 100 nM ptDNA oplossing nodig om het aantal QDs overeenkomt berekenen.
  5. Herhaal de stappen 1.2.3 nogmaals 1.2.5 met deze berekende volume of totdat de geconjugeerde QDs instorting in een enkele band op de gel wijst op een volledige vervoeging van alle QD's.
  6. Voeg 100 ul van 10 mM (CO 2H) CH2 O (CH2 CH2 O) 6 C 11 H 23 SH (carboxy PEG6 alkaan thiol) in 10 mM Tris buffer containing 30 mM NaCl (pH 8) tot de geconjugeerde mQDs hierboven geproduceerde en schud gedurende 10 minuten.
    Opmerking: Deze PEG liganden passiveren de QD oppervlak. Een langere PEG zal beter passiveren de QDs zal echter ook hun omvang te vergroten. De hydrofobe alkaan thiol functionaliteit heeft een veel grotere affiniteit voor de QDs, in totaal, dan de minder hydrofobe PEG-thiol gebruikt voor faseoverdrachtskatalysator. Daarom is het niet mogelijk deze stap om te lang door te gaan of de ptDNA zal worden vervangen door de alkaan-PEG-thiol. Na ~ 30 min incubatie, wordt een aanzienlijk deel van DNA zijn verplaatst van de QDs (Figuur 3B).
  7. Overtollige alkaan PEG-thiol verwijderen, wordt 0,5 ml van de oplossing QD Sephadex NAP5-kolom vooraf geëquilibreerd met elutiebuffer (10 mM Tris buffer die 30 mM NaCl). Verzamel de mQDs met 1,0 ml elutiebuffer door zwaartekracht.
  8. Concentreer het verzamelde QDs met een Centricon spinkolom (30 kDa). Bewaar deze mQDs bij 4 ° C gedurende maanden. Niet frEEZE hen.
    Opmerking: Als een gekleurde pellet op de bodem van de buis gezien, zijn de stippen samengevoegd en waarschijnlijk niet meer bruikbaar.

2 Productie van Targeting (Benzylguanine-) DNA

  1. Produceren of te kopen-amine beëindigd DNA. Dit protocol maakt gebruik van de sequentie 5'-NH 2 - (CT) 10 - (CAGT) 5 -3 '(zie tabel 1). De poly-CT linker verhoogt de toegankelijkheid van functionaliteit diep begraven in de glycocalyx, maar misschien niet nodig voor alle toepassingen. Als er toegang tot een DNA synthesizer produceren met amino gemodificeerde DNA met een geschikte 5 'amino-modifier (5' amino-modifier C6).
  2. Los BG-N-hydroxysuccinimide (BG-NHS) in droog dimethylsulfoxide (DMSO) bij een concentratie van 10 mg / ml.
    Opmerking: BG-NHS zal water absorberen uit de lucht en leiden tot hydrolyse van de reactieve NHS-ester, met name in hygroscopisch oplosmiddelen zoals DMSO en dimethylformamide (DMF). BG-NHS is beste winkeld bij -80 ° C als poeder in eigen injectieflacon in een secundaire houder met droogmiddel. Warm tot kamertemperatuur vóór het openen van de flacon. Anders, onmiddellijk aliquot voor eenmalig gebruik de BG-NHS ester in een droge polair oplosmiddel en bevriezen bij -80 ° C of volledig reageren met het amine DNA in stap 2.2.
  3. React door mengen van de BG-NHS in DMSO uit stap 2.1 met amine beëindigde DNA in HEPES (4-(2-hydroxyethyl) -1-piperazineethaansulfonzuur) buffer (pH 8,5) water. In een typische reactie 20 ui 10 mg / ml BG-NHS in DMSO met 2 ui 2 mM NH 2 - (CT) 10 - (CAGT) 5 in 58 pl gedeïoniseerd water gebufferd met 20 ui 0,5 M HEPES pH 8,5. Voer reacties in een 1,5 ml microcentrifugebuis. Meng snel de reactie verloopt snel en moeten concurreren met NHS-ester hydrolyse.
  4. Ultrasone trillingen gedurende 5-10 minuten om een ​​grondige menging te garanderen. Incubeer ~ 1 uur bij kamertemperatuur. De stoichiometrische verhouding van BG: DNA kan worden gewijzigd volgens de reactie volledig te doen verlopen.
  5. Zuiver het BG-DNA van de gereageerde amine-DNA door omgekeerde fase HPLC actief een 100 mM TEAA: acetonitril (ACN) gradiënt tussen 8% en 95% acetonitril in 30 minuten. De gereageerde amine-DNA elueren voordat de BG-DNA. Verzamel de BG-DNA-fractie in een conische buis.
    1. Gebruik een Zorbax kolom voor standaard oligonucleotide zuivering en de volgende gradiënt C 18:
      0 → 15 min: 8 → 30% ACN;
      15 → 21 min: 30-90% ACN;
      21 → 25 min: 90 → 8% ACN;
      25 → 30 min: 8% ACN;
  6. Bevriezen in vloeibare stikstof en lyofiliseren de verzamelde fractie. Resuspendeer het DNA in gedeïoniseerd water. Om extra voorzichtig, lyofiliseren nog twee keer om de resterende TEAA verwijderen. Residuele TEAA kan toxisch voor cellen zijn bij hogere concentraties.
  7. Resuspendeer de gevriesdroogd BG-DNA in het water, en zorg ervoor dat de zijkanten van th wassene buis, en verdun tot ~ 25 uM voorraad. Aliquot en bewaar bij 4 ° C. Monsters werden bewaard ~ 9 maanden zonder merkbare degradatie.

3 Labeling levende cellen met Monovalent Quantum Dots

  1. Eventueel passiveren de mQDs net voor een beeldvormende experiment met reagentia zoals caseïne (0,5%) of bovine serum albumine (BSA, 1-3%).
  2. Plaat cellen die de SNAP-gelabeld eiwit op totale interne reflectie fluorescentie (TIRF) -kwaliteit glas. In dit experiment, gebruiken we een U2OS cellijn een SNAP-gelabeld Notch1 receptor en hoogwaardige glasoppervlakken.
  3. Nadat de cellen aan het glas (~ 24 uur) hebben, verwijdert groeimedia, wassen met PBS, en incubeer de cellen gedurende 10-30 minuten bij kamertemperatuur in ~ 100-150 ul PBS of celmedium bevattende ~ 1 uM BG DNA uit stap 2.6.
  4. Na incubatie met BG voorzichtig de cellen te wassen met PBS of celmedium. Incubeer de cellen voor ~ 5-10 minuten met the mQDs in stap 1.2.9 (en eventueel gepassiveerd in stap 3.1).
  5. Eventueel, was de ongebonden mQDs en terug te keren van de cellen naar een buffer / media die geschikt zijn voor zowel beeldvorming en cultuur. Voor cellen die waren af ​​te beelden in TIRF modus, een laatste wasstap was vaak niet nodig als ongebonden mQDs in oplossing verspreid zo snel in vergelijking met gebonden mQDs als niet detecteerbaar te zijn tijdens de analyse.

4 Microscopie & Analyse

  1. Beeld de cellen met een TIRF microscoop.
    Opmerking: De scope moet scheiden excitatie en emissie-filters, of een aangepaste QD filter kubus hebben. QDs zijn best opgewekt met een lage golflengte laser (405 of 488 nm). QDs van verschillende diameter hebben karakteristieke emissiegolflengte, typisch geassocieerd met shift grote Stoke's.
  2. Omwille van de helderheid van mQDs, beelden bij hoge framerates halen in TIRF terwijl de beeldvorming van de basale zijde van een levende cellen.
    Let op: U kunt enkel-molecuul dynamiek zijn Follotrouwen op andere brandpuntsvlakken met behulp van een draaiende schijf confocale microscoop. Geautomatiseerde single-deeltje tracking software is over het algemeen succesvol in het nauwkeurig volgen van de lichte en photostable mQDs.

Representative Results

De fase-overgang van de QDs uit een organische aan een waterige fase is essentieel voor de productie van mQDs, maar zowel conditie- en QD-specifiek zijn. Fase-transfer in paragraaf 1.1 moet zo schoon als de eerste twee flacons in figuur 3 weergegeven. Indien de overdracht verschijnt meer als flacon 3, dan moet men het opnieuw te proberen met verschillende omstandigheden.

Zodra de QDs bekleed met negatief geladen DNA moeten ze migreren op een gel gescheiden van de niet verpakte QD. Met een bekende hoeveelheid van onverpakt QD als controle, een tweede moet sneller migrerende band verschijnen na toevoeging van de ptDNA, zoals in de eerste gel in Figuur 2B. Volledige vorming van mQDs aangetoond voor het verlies van de immobiele band en zijn instorting in de mobiele band zoals in de laatste gel in Figuur 2B. Indien een monster van uw MQD product migreert als een enkele band te scheiden zijn van de ongeopende QD's, dan is uw mQDs zijn monovalente en r eady voor gebruik in verdere stappen.

Cel etikettering moet specifiek zijn voor het doel van uw keuze en afhankelijk van eiwit expressie niveaus en MQD concentratie moet zijn. Empirische optimalisatie van zowel MQD concentratie en MQD passiveren is vaak nodig voor een bepaalde toepassing. Figuur 4B toont de etikettering van U2OS cellen die een SNAP-gelabeld Notch receptor met mQDs met concentraties van 0,5 nM tot 10 nM.

Figuur 1
Figuur 1 Modular targeting van mQDs. MQDs hybridiseren ssDNA gefunctionaliseerd door diverse doelmoleculen. Benzylguanine gekoppelde DNA targets mQDs om fusie-eiwitten-gelabeld SNAP. 5 Andere modificaties en DNA-sequenties maken het richten van mQDs een verscheidenheid van andere biomoleculen./files/ftp_upload/52198/52198fig1highres.jpg "target =" _blank "> Klik hier om een ​​grotere versie van deze afbeelding te bekijken.

Figuur 2
Figuur 2 Regeling voor de productie van mQDs. (A) Organic-fase QD's zijn aan de waterige fase overgebracht door behandeling met mPEG thiol en TBAB, omwikkeld met ptDNA, en gepassiveerd met carboxy PEG6 alkaan thiol. Vertegenwoordiger TEM beelden zijn organische QD545, QD585 en QD605, respectievelijk. (B) Een werkwijze voor het empirisch bepalen van de stoichiometrie van de interactie tussen QD en ptDNA in stap twee hierboven. QD en ptDNA stoichiometrie empirisch geverifieerd door densitometrie zodat de uiteindelijke reactie stoichiometrie 1: 1 (QD: ptDNA). Het aanvankelijke aantal mol ptDNA wordt vermenigvuldigd met de verhouding van QD: MQD en aangepast door het werkelijke volume af ter vervoeging aan het aantal mol die nodig is om 1 te bereiken opleveren:. 1 vervoeging Klik hier om een grotere versie van deze afbeelding te bekijken.

Figuur 3
Figuur 3 Experimentele gegevens voor de productie van mQDs. (A) Vertegenwoordiger foto's van succesvolle en mislukte fase-transfer. QD's moet visueel over te brengen tussen de dichte organische fase en de minder dichte waterige fase. Onvolledige fasescheiding duidt op slechte overdracht. (B) ptDNA kan worden vervangen door het alkaan-PEG-thiol. Rechts gel data representeert een reactie waarbij een aanzienlijk deel van ptDNA zijn verplaatst van de QDs door over-passivering.es.jpg "target =" _blank "> Klik hier om een ​​grotere versie van deze afbeelding te bekijken.

Figuur 4
Figuur 4 Labeling SNAP-gemerkte eiwitten op levende cellen. (A) Schematische aantonen van de expressie, gehechtheid en de etikettering van een SNAP-getagde receptor met een BG-gerichte MQD. (B) Vertegenwoordiger labeling van cellen die een SNAP-Notch-mCherry bouwen op diverse MQD concentraties. mQDs gepassiveerd met PEG12 colocalize met mCherry aangeeft specifieke etiketteringsvoorschriften. Lagere etikettering dichtheden (<0,5 nM) zijn over het algemeen de voorkeur voor enkel deeltje tracking. Schaal bar is 10 micrometer. Klik hier om een grotere versie van deze afbeelding te bekijken.

Discussion

De modulariteit van het ontwerp MQD maakt een verhoogde mate van experimentele flexibiliteit. Bijvoorbeeld, een grote mQDs snel worden bereid in unieke kleuren waardoor gelijktijdige beeldvorming van meerdere doelen. De ssDNA targeting sequentie kan direct mQDs eiwitten, suikers 12, lipiden en oppervlakken 13. Een aantal enzymatische labels zijn verkrijgbaar met orthogonale reactiviteit, waardoor meerdere doelen tegelijk worden afgebeeld met verschillend gerichte mQDs. Naast het richten met de SNAP-tag, de etikettering van target eiwitten met mQDs behulp van de CLIP-tag, de HALO-tag, en gebiotinyleerde eiwitten was ook succesvol. Dit protocol toont de specifieke kenmerken van een oppervlak receptor op levende cellen met deze mQDs, maar het protocol kan gemakkelijk worden aangepast om een ​​aantal verschillende contexten.

De belangrijke methodologische inzicht produceren mQDs met gedefinieerde valentie is dat ~ 50 fosforothioaat-gebondenbasen moeten de QDs wrap (en dus dat twee moleculen binden tegelijkertijd). Een poly-A S 50 sequence reproduceerbaar en stabiel gebonden 605 nm QD's van Life Technologies. Hoewel dit product is niet meer leverbaar, de sterische uitsluiting strategie is generaliseerbaar naar soortgelijke producten van andere leveranciers met verschillende maten, vormen, spectrale eigenschappen.

De efficiëntie en de stabiliteit van ptDNA verpakte QD hoge mate afhankelijk van de oppervlakte chemie en de structuur van de QD's. Daarom zal het succes van een protocol afhankelijk zijn van de commerciële bron en de chemische structuur van de QD's. Voor de toepassing van dit protocol, drie belangrijke punten van verschil bestaan ​​tussen de verschillende commerciële bronnen van QD's: een verschil in de voorwaarden die nodig zijn voor fase-overdracht; een verschil in de sterkte van oorspronkelijke PEG-thiol-ligand binding, belemmeren verschuiving met ptDNA; en een verschil in de hoeveelheid van de blootgestelde CdSe kern, die kunnen leadvertentie naar het blussen van de QD door de MPEG-thiol fasetransfer voorwaarden.

Zoals van publicatie, QD's met de beste structuur voor de productie van mQDs zijn 4-10 nm CdSe / ZnS kern / schil QD's gekocht bij Life Technologies met emissie-spectra bij 545, 585, 605 en 625 nm (Figuur 2A). QDs gebaseerd op de "Vivid" formulering (545, 605, etc.) quench na toevoeging van mPEG thiol en zijn niet geschikt voor deze toepassing. QD's van Aldrich en Ocean Nanotech werken goed, maar vereisen meer fasetransfer stappen en voorbehandeling met trioctylfosfine oxide. Dit protocol is geoptimaliseerd voor QD van Life Technologies.

De poly-A sequentie fosforothioaat gebruikt om de QDs wikkelen beëindigd met een natieve 20-meer DNA staart die de sequentie van (ACTG) 5 waaraan een targeting streng kan hybridiseren. Deze sequentie is handig, omdat het weinig of geen secundaire structuur, en blijft hybridized bij 37 ° C in PBS. Als er toegang tot een DNA synthesizer kan de ptDNA door gesynthetiseerd en vervolgens gezuiverd met omkeerfase sterk scheidende vloeistofchromatografie (HPLC) met kolom C 8. De ptDNA zal later elueren op de HPLC dan vergelijkbare oligonucleotiden met een natieve backbone. We laten meestal de 5 'DMT-beschermende groep op onze fosforothioaatoligonucleotiden na zuivering.

Passivering van de ptDNA verpakte QD is meestal nodig om de colloïdale stabiliteit van QD's te verbeteren en de achtergrond bindend voor de meest experimentele toepassingen. Het protocol maakt gebruik van een PEG-laag om de QDs passiveren. Carboxy PEG alkaan thiol met extra PEG eenheden ((CO 2H) CH2-O (CH2 CH2 O) 12 C 11 H 23 SH, carboxy-PEG12 alkaan thiol) geeft significant verminderde achtergrond, hoewel de langere PEG beide groter, en algemeen duurder. mQDs gecoat met carboxy PEG alkane thiol liganden zeer stabiel in fysiologische buffers, zoals fosfaat-gebufferde zoutoplossingen en kweekmedia. Langdurige opslag (> 8 maanden) van mQDs bij 4 ° C toonde geen significante aggregatie of ptDNA onthechting 11. Afhankelijk van het experiment, PEG passivering van de QDs alleen niet altijd voldoende niet-specifieke binding te verminderen van de mQDs. Incuberen beide cellen en mQDs in met fosfaat gebufferde zoutoplossing (PBS) bevattende 3% BSA gedurende 20 min vóór gebruik aanzienlijk vermindert niet-specifieke binding aan cellen, maar het verhoogt de schijnbare hydrodynamische radius van de mQDs met ~ 50%. Passiveren met 0,5% caseïne vermindert de niet-specifieke binding verder maar het verhoogt de schijnbare grootte in grotere mate dan BSA.

Uiteinde van een DNA-streng complementair aan de mQDs The 5 'kan worden aangepast targeting van een aantal verschillende biomoleculen mogelijk. Er zijn een aantal gevestigde technieken covalent eiwitten modificeren, lipids & suikers met enkelstrengs DNA (ssDNA). Zolang de ssDNA extracellulair wordt gepresenteerd, is het toegankelijk is voor oplosbare mQDs. mQDs de bovenvermelde sequenties snel hybridiseren met hun complementaire DNA-streng onder celcultuur condities. A 10-20x poly (CT) spacer tussen de ptDNA en targeting sequentie vereist voor efficiënt richten teneinde verheffen de bindende sequentie boven de dikke en negatief geladen glycocalyx van de cel. Voor dit protocol hebben we gekozen voor een BG-DNA te produceren met een complementaire sequentie van (CAGT) 5 die zowel gehybridiseerd met de mQDs en covalent zich koppelen aan een SNAP-tag eiwitten voor een snelle en specifieke etikettering. Een soortgelijk protocol functioneert goed voor het koppelen van andere NHS-esters met amino gemodificeerde oligonucleotiden.

Voor single-molecule imaging, is een lage dichtheid van etikettering normaal nodig is om individuele moleculen te lossen. Een laatste MQD concentratie van ~ 0,5 nM in PBS met passiveringsmiddelis een goed doelwit. Echter, deze hoge verdunningen soms resulteerde in onder-labeling van de cellen. Als dit gebeurt, kan extra MQD worden toegevoegd tot een optimale dichtheid van de etikettering wordt waargenomen. Bij SNAP-gelabeld humaan Notch1 concentraties van> 10 nM MQD geproduceerd dichte labeling cellen terwijl 0,5 nM MQD resulteerde in de hechting van ~ 20 mQDs het basale oppervlak van doelwitcel (zie figuur 4B). Cel labeling met mQDs was sterk afhankelijk van de samenvloeiing van de vergulde cellen. Overdreven samenvloeiende cellen niet labelen bij hun basale oppervlakken.

Kortom, een eenvoudige methode om monovalente genereren en modulaire QD beschreven. Deze mQDs vinden nut in breed scala van live cell imaging toepassingen, zoals aangetoond door de beeldvorming van de Notch receptor op live U2OS cellen. Toepasbaarheid van mQDs is niet beperkt tot dit specifieke geval, maar kan mogelijk worden verlengd andere cellulaire doelwitten zoals andere eiwitten, nucleïnezuren en enzymen.

Acknowledgements

Financiering verstrekt door DOD W81XWH-1023/10/01 (ZJG), subsidie ​​P50 GM081879 van de UCSF Center for Systems and Synthetic Biology (ZJG), NIH 5R21EB015088-02 (YJ) en NIH 1R21EB018044 (ZJG & YJ). DS werd ondersteund door Human Frontier Science Program interdisciplinair postdoc research fellowship.

Materials

Name Company Catalog Number Comments
mQD Production
Phosphorothioate DNA:
(A*)x50-(ACTG)x5 IDT Most DNA Synthesis companies
Quantum Dots:
QDots 525, 585, 605 & 625 Invitrogen Q21791MP (545), Q21711MP (585), Q21701MP (605) Custom QD synthesis for QD625.
QD610 Ocean Nanotech QSP-610-10 
QD 610 lamda Aldrich 731854
Chloroform, 99.8% ACROS 67-66-3
Tetrabutylammonium bromide, 98.0% Sigma-Aldrich 426288
mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95% Polypure 11156-0695
HSC11EG6CO2H  [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H] ProChimia TH 003-m11.n6-0.1
Boric Acid, 99.5% Sigma-Aldrich B0394
Sodium Hydroxide, 99.0% ACROS S/4845
Sodium Chloride, 98% Sigma-Aldrich 310166
Agarose LE U.S. Biotech Sources G02PD-125
Ethanol Sigma-Aldrich 459828
BG-DNA Production
Amine DNA:
(CAGT)5-NH2 IDT N/A Most DNA Synthesis companies
(CAGT)5(T)40-NH2 IDT N/A Most DNA Synthesis companies
NHS-GLA-Benzylguanine New England Biosciences S9151
DMSO Sigma-Aldrich D8428
HEPES Buffer Sigma-Aldrich 83264
NAP5 Column GE Healthcare 17-0853-01
C18 Column
Acetonitrile
Mammalian Cell Culture & Imaging
Cell line expressing SNAP-tagged protein New England Biosciences E9100S
McCoys 5A UCSF Cell Culture Facility Specific to U2OS culture
Fetal Bovine Serum UCSF Cell Culture Facility Specific to U2OS culture
PBS UCSF Cell Culture Facility
Nunc Lab-tek II Chambered Coverglass Thermo-Fischer Scientific 155409
Matriplate 96-well plate Brooks Life Science Systems MGB096-1-2-LG-L
BSA
5% Alkali-soluble Casein EMD Millipore 70955 Not all caseins are the same
(Optional) DNA Synthesis Reagents
5’ Amine modifier C6 Glen Research Oct-06
dA-Thiophosphoramidite Glen Research 10-700
Analysis Software
FIJI http://valelab.ucsf.edu/~schindelin/
RyTrack.pro http://sun.iwu.edu/~gspaldin/rytrack.html
Tracker http://www.gartnerlab.ucsf.edu/more/software

DOWNLOAD MATERIALS LIST

References

  1. Sako, Y., Minoghchi, S., Yanagida, T. Single-molecule imaging of EGFR signaling on the surface of living cells. Nature Cell Biology. 2, (3), 168-172 (2000).
  2. Luo, W., He, K., Xia, T., Fang, X. Single-molecule monitoring in living cells by use of fluorescence microscopy. Analytical and Bioanalytical Chemistry. 405, (1), 43-49 (2013).
  3. Chung, I., et al. Spatial control of EGF receptor activation by reversible dimerization on living cells. Nature. 464, (7289), 783-787 (2010).
  4. Fernández-Suárez, M., Ting, A. Fluorescent probes for super-resolution imaging in living cells. Nature Reviews Molecular Cell Biology. 9, (12), 929-943 (2008).
  5. Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy. The Journal of Physical Chemistry B. 105, (35), 8281-8284 (2001).
  6. Pinaud, F., Clarke, S., Sittner, A., Dahan, M. Probing cellular events, one quantum dot at a time. Nature Methods. 7, (4), 275-285 (2010).
  7. Michalet, X., et al. Quantum dots for live cells, in vivo imaging, and diagnostics. Science. 307, (5709), 538-544 (2005).
  8. Howarth, M., et al. Monovalent, reduced-size quantum dots for imaging receptors on living cells. Nature Methods. 5, (5), 397-399 (2008).
  9. Iyer, G., et al. Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging. Bioconjugate Chemistry. 22, (6), 1006-1011 (2011).
  10. Tikhomirov, G., et al. DNA-based programming of quantum dot valency, self-assembly and luminescence. Nature Nanotechnology. 6, (8), 485-490 (2011).
  11. Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. Formation of targeted monovalent quantum dots by steric exclusion. Nature Methods. 10, (12), 1203-1205 (2013).
  12. Gartner, Z. J., Bertozzi, C. R. Programmed assembly of 3-dimensional microtissues with defined cellular connectivity. Proceeding of the National Academy of Sciences USA. 106, (12), 4606-4610 (2009).
  13. Selden, N. S., et al. Chemically programmed cell adhesion with membrane-anchored oligonucleotides. Journal of the American Chemical Society. 134, (2), 765-768 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats