Produktion och inriktning av Monovalent Quantum Dots

1Department of Otolaryngology, University of California, San Francisco, 2Department of Chemistry, University of California, Berkeley, 3Materials Science Division, Lawrence Berkeley National Laboratory, 4Department of Pharmaceutical Chemistry, University of California, San Francisco, 5Tetrad Graduate Program, University of California, San Francisco, 6Center for Systems and Synthetic Biology, University of California, San Francisco, 7Chemistry and Chemical Biology Graduate Program, University of California, San Francisco
* These authors contributed equally
Published 10/23/2014
0 Comments
  CITE THIS  SHARE 
Bioengineering
 

Summary

Cite this Article

Copy Citation

Seo, D., Farlow, J., Southard, K., Jun, Y. w., Gartner, Z. J. Production and Targeting of Monovalent Quantum Dots. J. Vis. Exp. (92), e52198, doi:10.3791/52198 (2014).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

Dynamiken i enskilda molekyler på levande celler bidrar till deras biologiska funktion. Enda molekyl fluorescens avbildning är en populär metod för att studera enstaka molekyl dynamik på cellytan 1,2,3. Men de vanligaste avbildningssonder i dessa studier har flera viktiga nackdelar. Exempelvis konventionella organiska färgämnen och fluorescerande proteiner ger måttlig ljusstyrka, ca 10 5 -10 6 M -1 cm -1, men är fotokemiskt instabila, blekning efter utsläpp av cirka 10 5 -10 6 fotoner under typiska live-cell imaging villkor 4,5. Däremot halvledarnanopartiklar, ofta kallade kvantprickar (QDs), är betydligt ljusare och mer stabil, med extinktionskoefficienter i intervallet 10 6 -10 7 M -1 cm -1 och över 10 7 -10 8 utsända fotoner före photobleaching 5. Den förbättrade ljusstyrka och fotostabilitet av QDs över organiska fluoroforer möjliggör observation av enstaka molekyler till betydligt snabbare frame rates och över mycket längre banor 6.

Trots sina fördelar och kommersiell tillgänglighet, flera skulder kvarstår för dessa kraftfulla avbildningsmedel. För det första har de dåligt definierade inriktning valens, vilket kan resultera i tvärbindning av riktade biomolekyler 6. För det andra, de i allmänhet har en stor hydrodynamisk storlek (> 20 nm) som begränsar tillgängligheten till vissa trångt cellulära miljöer 7. För det tredje, de har begränsad inriktning modularitet 7. Flera strategier har försökt lösa dessa problem 8,9,10, men i allmänhet kräver specialiserad kunskap och reagenser att genomföra.

För att lösa dessa problem, som nyligen rapporterade vi en "Sterisk utestängning" strategi för att förbereda monovalent, små ochmodulära QDs 11. De QDs är lindade med en enda lång fosfortioat-DNA (ptDNA) polymer. Den ptDNA binder till QD ytan genom flera Zn-S interaktioner mellan ytexponerade Zn-atomer och fosfortioatbindningar grupper ptDNA polymeren. En enda bunden polymer steriskt och elektro utesluter bindning av ytterligare medel i polymeren utan att signifikant öka partikelns totala storlek (ca 2 nm). Alla reagenser är kommersiellt tillgängliga produkter bildas i högt utbyte, och processen kräver endast avsaltningssteg för rening. En gång märkt, QDs inslagna med en enda ptDNA (mQDs) binder till komplementära DNA-strängar som bär riktar domäner (t.ex. bensylguanin (BG), benzylcytosine eller alkylhalider).

Dessa funktioner rikta mQDs specifikt till enzymatiska taggar såsom SNAP, CLIP & HALO som är genetiskt smält till proteinet av intresse. Detta är ett protokoll för syntesen, Inriktning, och live-cell imaging av mQDs produceras av steriskt utanförskap.

Protocol

1 Produktion av Monovalent Quantum Dots

  1. Fas överföring av QDs från organiskt till vattenfasen
    1. Späd 200 ^ il av en 1 uM lösning av organiska fas QDs med 400 ul av kloroform i en 5 ml glasampuU.
    2. Blanda 400 l av en 0,3 M tetrabutylammoniumbromid (TBAB) kloroformlösning med 36 l av snyggt mPEG tiol (CH 3 O (CH 2 CH 2 O) 6 C 2 H 5 SH) och skaka O / N.
    3. Lägg 800 l av en 0,2 M NaOH vattenlösning och skaka i 30 sekunder. En fas överföring sker inom några minuter, vilket indikeras av en överföring av de färgade partiklarna till den vattenhaltiga fasen ovanför den tätare organiska fasen.
    4. Om partiklarna aggregera i en tredje fas mellan de vattenhaltiga och organiska faserna, öka inkubationstiden med mPEG tiol. Om vattenfasen förblir klar, gjorde QDs inte fasöverförings (se figur 3A). Alternativt öka concentranson av mPEG tiol i steg 2 för att lindra överföring dålig fas.
    5. Recover den (färgad) vattenfasen och därefter koncentrera de uppsamlade QDs med en Centricon spinnkolonn (30 kDa molekylvikt cut-off) till en ml.
    6. Tillsätt koncentrerad QD lösningen i en Sephadex NAP10 kolonn förjämviktad med 10 mM Tris-buffert innehållande 30 mM NaCl (pH 8,0). Eluera de QDs med 1,5 ml elueringsbuffert från gravitationsflöde.
    7. Mäta koncentrationen av QDs med absorptionsspektroskopi vid 350 nm.
  2. Framställning av mQDs
    1. Köp (eller syntetisera) ptDNA. Detta protokoll använder sekvensen 5'-A S 50 (CT) 10 (ACTG) 5 -3 '(se tabell 1).
DNA Sekvens
5'-A S 50 (CT) 10 (ACTG) 5 A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG
5'-NH 2 - (CT) 10 (CAGT) 5 -3 ' NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT
BG-DNA BG / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT

Tabell 1. DNA-sekvenser som används för att producera och målgrupp mQDs.

  1. Bered en ml 100 nM QD lösning i 10 mM Tris-buffert innehållande 30 mM NaCl (pH 8).
  2. Lägg droppvis 500 | il av 100 nM ptDNA lösning till de vattenhaltiga QDs under 1 min under kraftig omröring. Rör om eller placera på en shaker under ytterligare 9 timmar.
    OBS: Detta bör teoretiskt producera en 1: 2 förhållande av ptDNA: QD. Emellertid är den verkliga stökiometrin aldrig perfekt - oftast resultatet är närmare 1: 1,5. För att framställa en 1: 1-förhållande av ptDNA: QD, är nödvändig densitometri efter gelelektrofores för att kvantifiera den exakta förhållandet av konjugering ges de kända volymer som används ovan.
  3. Ta bort ~ 10 pl av QD blandningen för att köras på en analytisk agarosgel. Ta också bort en liknande koncentration av okonjugerade QDs i vattenfasen (från steg 1.2.1).
    1. Lägg ~ 2 μ; Ll 6x Ficoll laddningsbuffert (för att öka lösningens densitet) och köra dessa två prover tillsammans på en 0,8% vikt / volym agarosgel i natriumboratbuffert i 15 min vid 150 V. Ett enda band i det okonjugerade kontrollbanan migrerar nära brunnen, och två band i körfält med konjugerade QDs ses (se geler i figur 2B).
  4. Beräkna den okonjugerade QD fraktionen med användning av den relativa intensiteten hos de två banden (se ekvationen i figur 2B). Använd sedan den fraktion för att beräkna den ytterligare volymen av 100 nM ptDNA lösning som krävs för att matcha antalet QDs.
  5. Upprepa steg 1.2.3 till 1.2.5 gång med denna beräknade volymen eller tills konjugerade QDs kollapsar in i ett enda band på gelén indikerar fullständig konjugering av alla QDs.
  6. Tillsätt 100 pl 10 mM (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (karboxi PEG6 alkan tiol) i 10 mM Tris-buffert containing 30 mM NaCl (pH 8) till de konjugerade mQDs produceras ovan, och skaka i 10 minuter.
    Anmärkning: Dessa PEG ligander passivera QD ytan. En längre PEG kommer bättre-passivera de QDs emellertid kommer den också att öka deras storlek. Den hydrofoba alkan Tiolfimktionaliteten har en mycket högre affinitet för QDs, sammanlagt, än mindre hydrofoba PEG-tiol används mot fas överföring. Därför tillåter inte detta steg för att fortsätta för länge eller ptDNA kommer att ersättas av den alkan-PEG-tiol. Efter en ~ 30 min inkubation, kommer en betydande fraktion av DNA har förskjutits från de QDs (Figur 3B).
  7. För att avlägsna överskott av alkan PEG-tiol, tillsätt 0,5 ml av den QD lösningen till en Sephadex NAP5-kolonn förjämviktad med elueringsbuffert (10 mM Tris-buffert innehållande 30 mM NaCl). Samla mQDs med 1,0 ml elueringsbuffert från gravitationsflöde.
  8. Koncentrera de uppsamlade QDs med en Centricon spinnkolonn (30 kDa). Förvara dessa mQDs vid 4 ° C i flera månader. Inte frEEZE dem.
    Obs: Om en färgad pellet i botten av röret sett har prickarna aggregeras och kommer sannolikt inte längre användbar.

2 Produktion av Targeting (Benzylguanine-) DNA

  1. Producera eller köper aminterminerad DNA. Detta protokoll använder sekvensen 5'-NH 2 - (CT) 10 - (CAGT) 5 -3 '(se tabell 1). Poly-CT länk ökar tillgängligheten till funktioner begravd djupt i glykokalyx men kanske inte behövs för alla applikationer. Om det inte finns tillgång till en DNA-syntetiserare, producera aminomodifierade DNA med användning av ett lämpligt 5 'amino-modifierare (5' amino-modifier C6).
  2. Lös BG-N-hydroxisuccinimid (BG-NHS) i torr dimetylsulfoxid (DMSO) vid en koncentration av 10 mg / ml.
    Anm: BG-NHS kommer att absorbera vatten från luften och leda till hydrolys av det reaktiva NHS-ester, i synnerhet hygroskopiska lösningsmedel såsom DMSO och dimetylformamid (DMF). BG-NHS är bästa butikend vid -80 ° C som ett pulver i en egen flaska i en sekundär behållare innehållande torkmedel. Varm till RT innan du öppnar flaskan. Alternativt, omedelbart Prov för engångsbruk BG-NHS-ester till ett torrt polärt lösningsmedel och frys vid -80 ° C, eller reagera fullständigt med den amin-DNA i steg 2,2.
  3. React genom blandning av den BG-NHS i DMSO från steg 2,1 med amin-terminerade DNA i HEPES (4-(2-hydroxietyl) -1-piperazinetansulfonsyra) buffrad (pH 8,5) vatten. I ett typiskt reagera 20 pl av 10 mg / ml BG-NHS i DMSO med 2 | il av 2 mM NH 2 - (CT) 10 - (CAGT) 5 i 58 | il avjoniserat vatten buffrat med 20 | il 0,5 M HEPES, pH 8,5. Utför reaktioner i ett 1,5 ml mikrocentrifugrör. Blanda snabbt som reaktionen fortskrider snabbt och måste konkurrera med NHS-ester-hydrolys.
  4. Sonikera för 5-10 min för att säkerställa grundlig blandning. Inkubera ~ 1 h vid RT. Det stökiometriska förhållandet av BG: DNA kan förändras för att driva reaktionen till fullbordan.
  5. Rena den BG-DNA från den oreagerade aminen-DNA genom omvänd fas-HPLC som kör en 100 mM TEAA: acetonitril (ACN) gradient mellan 8% och 95% acetonitril under 30 min. Den oreagerade aminen-DNA kommer att eluera före den BG-DNA. Samla BG-DNA fraktionen i ett koniskt rör.
    1. Använd en C 18 Zorbax kolumnen för standard oligonukleotid rening och följande gradient:
      0 → 15 min: 8 → 30% ACN;
      15 → 21 min: 30 till 90% ACN;
      21 → 25 min: 90 → 8% ACN;
      25 → 30 min: 8% ACN;
  6. Frys i flytande kväve och lyofilisera den uppsamlade fraktionen. Resuspendera DNA i avjoniserat vatten. För att vara extra försiktig, lyofilisera två gånger för att avlägsna rester TEAA. Rest TEAA kan vara toxiska för celler vid högre koncentrationer.
  7. Resuspendera lyofiliserade BG-DNA i vatten och se till att tvätta sidorna av the rör och späd till ~ 25 ^ M lager. Fördela och förvara vid 4 ° C. Prover lagrades för ~ 9 månader utan märkbar försämring.

3. Märkning levande celler med Monovalent Quantum Dots

  1. Eventuellt passivera de mQDs precis före en avbildningsexperiment med användning av reagens såsom kasein (0,5%) eller bovint serumalbumin (BSA, 1 till 3%).
  2. Plate celler som uttrycker SNAP-märkta proteinet på total inre reflektion fluorescens (TIRF) -kvalitet glas. I detta experiment använder vi en U2OS cellinje som uttrycker en SNAP-tagged Notch1 receptorn och högkvalitativa glasytor.
  3. Efter att cellerna har fäst till glas (~ 24 h), avlägsna tillväxtmedia, tvätta med PBS och inkubera cellerna under 10-30 min vid RT i ~ 100-150 pl av PBS eller cellmedia innehållande ~ 1 | iM BG DNA från steg 2.6 ovan.
  4. Efter inkubation med BG, försiktigt tvätta cellerna med PBS eller cellmedier. Inkubera cellerna i ~ 5-10 minuter med the mQDs producerats i steg 1.2.9 (och valfritt passiveras i steg 3,1).
  5. Eventuellt, tvätta de obundna mQDs och retur cellerna till en buffert / media lämplig för både avbildning och kultur. För celler som var som skall avbildas i TIRF-läge, ett slutligt tvättsteg var ofta onödigt eftersom obundna mQDs i lösning diffunderar så snabbt jämfört med bundna mQDs ex vara odetekterbar under analysen.

4. Mikroskopi & Analys

  1. Bild cellerna med hjälp av en TIRF mikroskop.
    Obs: Omfattningen måste ha separerbar excitation och emissionsfilter, eller en anpassad QD filter kub. QDs är bäst glada med en låg våglängd laser (405 eller 488 nm). QDs av olika diameter har karakteristiska emissionsvåglängder, typiskt förknippade med ett stort Stokes skift.
  2. På grund av ljusstyrka mQDs, samla bilder med hög bildhastighet i TIRF samtidigt avbildning av basala sidan av en levande cell.
    Anm: Alternativt kan enda molekyl dynamik vara FollOwed vid andra fokalplan med en snurrande skiva konfokalmikroskop. Automatiserad enda partikel spårningsprogram är generellt bra på att exakt spåra de ljusa och fotostabil mQDs.

Representative Results

Fasen överföringen av QDs från en organisk till en vattenhaltig fas är kritisk för framställningen av mQDs, men kan vara både Skick- och QD-specifik. Fas överföring i avsnitt 1.1 ska visas så rena som de första två flaskorna i figur 3. Om överföringen verkar mer som flaskan 3, så man bör försöka igen med andra förutsättningar.

När QDs är belagda med det negativt laddade DNA ska de vandrar på en gel separat från de icke-inslaget QDs. Med användning av en alikvot av oöppnade QDs som kontroll, en andra, bör snabbare vandrande band visas vid tillsats av ptDNA, såsom ses i den första gelén i figur 2B. Fullständig bildning av mQDs demonstreras med förlusten av den orörliga bandet, och dess kollaps i mobilbandet som kan ses i den sista gelén i figur 2B. Om en alikvot av din MQD produkten migrerar som ett enda band kan separeras från den oöppnade QDs, då dina mQDs är envärd och r eady att användas i ytterligare steg.

Cell Märkningen bör vara specifika för målet du vill och bör vara beroende av proteinexpressionsnivåer och MQD koncentration. Empirisk optimering av både MQD koncentration och MQD passive krävs ofta för en given tillämpning. Figur 4B visar märkningen av U2OS celler som uttrycker en SNAP-märkt Notch-receptorn med mQDs varierar i koncentration från 0,5 nM till 10 nM.

Figur 1
Figur 1 Modulär målinriktning av mQDs. MQDs hybridisera till ssDNA funktionaliserad genom olika målsökande molekyler. Bensylguanin bunden DNA mål mQDs Snap-taggade fusionsproteiner. Andra 5 'modifieringar och DNA-sekvenser möjliggör målinriktning av mQDs till en variation av andra biomolekyler./files/ftp_upload/52198/52198fig1highres.jpg "target =" _blank "> Klicka här för att se en större version av denna siffra.

Figur 2
Figur 2 System för produktion av mQDs. (A) Organisk fas QDs överförs till vattenfasen genom behandling med mPEG tiol och TBAB, lindade med ptDNA och passiv med karboxi PEG6 alkan tiol. Representant TEM bilder är ekologiska QD545, QD585 och QD605, respektive. (B) En metod för att empiriskt bestämma stökiometrin för interaktion mellan QDs och ptDNA i steg två ovan. QD & ptDNA stökiometrier är empiriskt verifieras genom densitometri sådan att den slutliga reaktions stökiometrin är 1: 1 (QD: ptDNA). Det ursprungliga antalet mol ptDNA multipliceras med förhållandet QD: MQD och justeras av den verkliga volymen af ter konjugering att ge antalet mol krävs för att uppnå 1:. 1 konjugering Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3. Experimentella detaljer för produktion av mQDs. (A) Representativa bilder av lyckade och misslyckade fas överföring. QDs bör visuellt överföra mellan den täta organiska fasen och den mindre täta vattenfasen. Ofullständig fasseparation indikerar dålig överföring. (B) ptDNA kan ersättas av den alkan-PEG-tiol. Rätt gel informationen representerar en reaktion där en betydande andel av ptDNA har fördrivits från QDs på grund av överpassive.es.jpg "target =" _blank "> Klicka här för att se en större version av denna siffra.

Figur 4
Figur 4 Märkning SNAP-taggade proteiner på levande celler. (A) Schematisk visar uttrycket, fastsättning och märkning av ett SNAP-märkt receptor med en BG-riktad MQD. (B) Representant märkning av celler som uttrycker en SNAP-Notch-mCherry bygga på olika MQD koncentrationer. mQDs passive med PEG12 colocalize med mCherry indikerar särskild märkning. Lägre märkning täthet (<0,5 nM) är i allmänhet att föredra för enkel spårning partikel. Skala bar är 10 mikrometer. Klicka här för att se en större version av denna siffra.

Discussion

Den modularitet MQD designen möjliggör en ökad grad av experimentell flexibilitet. Till exempel kan en mängd olika mQDs snabbt ställdes på unika färger som möjliggör för samtidig avbildning av multipla mål. The ssDNA målsekvens kan rikta mQDs till proteiner, sockerarter 12, lipider och ytor 13. Ett antal enzymatiska taggar finns med ortogonala reaktivitet, vilket gör att flera mål som ska avbildas samtidigt med differentiellt riktade mQDs. Förutom att rikta med SNAP tag, märkning av målproteiner med mQDs använder CLIP etikett, HALO tag, och biotinylerade proteiner var också framgångsrika. Detta protokoll visar den specifika märkningen av en ytreceptor på levande celler med dessa mQDs, men protokollet skulle lätt kunna anpassas till en rad olika sammanhang.

Den betydande metodologiska insikter i att producera mQDs med definierad valens är att ~ 50 fosfortioat bundenbaser måste linda QDs (och därigenom förhindra två molekyler från att binda samtidigt). En poly-A S 50 sekvens reproducerbart och stabilt bunden 605 nm QDs från Life Technologies. Även om denna produkt har upphört, är den steriska utanförskap strategin generaliserbar för liknande produkter från andra leverantörer som har olika storlekar, former, spektrala egenskaper.

Den effektivitet och stabilitet ptDNA-inslagna QDs beror kritiskt på ytkemi och struktur QDs. Därför kommer framgången av ett protokoll beror på kommersiell källa och kemisk struktur av QDs. I detta protokoll, tre stora meningsskiljaktigheter finns mellan olika kommersiella källor av QDs: en skillnad i nödvändiga för fasöverförings förhållanden; en skillnad i styrkan av initiala PEG-tiol-ligand-bindning, eventuellt hindrar förskjutning av ptDNA; och en skillnad i mängden exponerade CdSe kärna, som kan lead till släckning av QD av MPEG tiol fasöverföringsbetingelser.

Från och med publiceringen, QDs med den bästa strukturen för produktion av mQDs är 4-10 nm CdSe / ZnS core / shell QDs köpt från Life Technologies med emissionsspektra vid 545, 585, 605 och 625 nm (Figur 2A). QDs baserade på "Levande" formulering (545, 605, etc.) släcka vid tillsats av mPEG tiol och är inte lämpliga för denna tillämpning. QDs från Aldrich och Ocean Nanotech fungerar bra, men kräver längre fas överföringssteg och förbehandling med trioktylfosfinoxid. Detta protokoll har optimerats för QDs från Life Technologies.

Poly-A fosfortioat sekvens som används för att linda QDs avslutas med en infödd 20-mer DNA svans innehållande sekvensen av (ACTG) 5 till vilken en inriktning sträng kan hybridisera. Denna sekvens är bekvämt, eftersom det har liten eller ingen sekundär struktur, och kommer att förbli hybridized vid 37 ° C i PBS. Om det inte finns tillgång till en DNA-syntetiserare kan ptDNA genom syntetiserades och renades därefter genom omvänd fas högpresterande vätskekromatografi (HPLC) med användning av en C-8-kolonn. Den ptDNA kommer eluera senare på HPLC än motsvarande oligonukleotider med en infödd ryggrad. Vi lämnar vanligtvis 5 "DMT skyddsgruppen på våra fosforotioatoligonukleotider efter rening.

Passive av ptDNA-inslagna QDs krävs vanligtvis för att förbättra kolloidal stabilitet QDs och reducera bakgrunds bindande för de flesta experimentella tillämpningar. Protokollet använder ett PEG-skikt för att passivera de QDs. Karboxi PEG alkan tiol med ytterligare PEG-enheter ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H 23 SH, karboxi-PEG12 alkan tiol) ger signifikant minskad bakgrund, även de längre PEG är både större, och i allmänhet dyrare. mQDs belagda med karboxi PEG alkane tiol ligander är mycket stabilt i fysiologiska buffertar såsom fosfat-buffrad saltlösningar och odlingsmedia. Långtidslagring (> 8 månader) för mQDs vid 4 ° C visade ingen signifikant aggregering eller ptDNA lossnar 11. Beroende på experimentet, PEG passivering av de QDs ensam inte alltid i tillräcklig utsträckning reducera icke-specifik bindning av de mQDs. Inkubation av både celler och mQDs i fosfatbuffrad saltlösning (PBS) innehållande 3% BSA under 20 min före användning väsentligen reducerar icke-specifik bindning till celler, men den gör det ökar den skenbara hydrodynamiska radien av de mQDs vid ~ 50%. Passivering med 0,5% kasein minskar den icke-specifika bindningen ännu längre men det ökar den skenbara storleken till en större utsträckning än BSA.

5'-änden av en DNA-sträng som är komplementär till de mQDs kan modifieras för att möjliggöra inriktning av ett antal olika biomolekyler. Det finns ett antal etablerade tekniker tillgängliga för att kovalent modifiera proteiner, lipids & socker med enkelsträngat DNA (ssDNA). Så länge som ssDNA presenteras extracellulärt, är den tillgänglig för lösliga mQDs. mQDs med ovanstående sekvenser kommer snabbt hybridisera med deras komplementära DNA-strängen i cellodlingsförhållanden. En 10-20x poly (CT) spacer mellan ptDNA och den målsökande sekvensen kan krävas för effektiv inriktning, så att höja bindningssekvensen ovanför den tjocka och negativt laddade glykokalyx av cellen. För detta protokoll valde vi att producera en BG-DNA med en komplementär sekvens av (CAGT) 5 som både hybridiserade till mQDs och kovalent länka sig till en SNAP-tagg protein för snabb och specifik märkning. Ett liknande protokoll fungerar väl för koppling av andra NHS-estrar till aminomodifierade oligonukleotider.

För enkel-molekyl avbildning, är en låg densitet av märkning som typiskt krävs för att lösa enskilda molekyler. En slutlig MQD koncentration av ~ 0,5 nM i PBS med passiveringsmedletär ett bra mål. Men ibland lett till under märkning av cellerna dessa höga utspädningar. Om detta inträffar kan ytterligare MQD sättas tills en optimal densitet av märkning observeras. I fallet med SNAP-tagged human Notch1, koncentrationer av> 10 nM MQD produceras täta märkningsceller medan 0,5 nM MQD resulterade i vidhäftning av ~ 20 mQDs vid den basala ytan av målcellen (se figur 4B). Cell märkning med mQDs var starkt beroende av sammanflyt av pläterade celler. Alltför sammanflytande celler inte märka på sina basala ytor.

I sammanfattning, att en enkel metod generera monovalenta och modulära QDs beskrevs. Dessa mQDs finna användbarhet inom brett spektrum av levande cellavbildningstillämpningar, såsom visas genom avbildning av Notch-receptorn på levande U2OS celler. Tillämpligheten av mQDs är inte begränsad till detta specifika fall, men kan potentiellt utvidgats till andra cellulära mål, såsom andra proteiner, nukleinsyror och enzymer.

Acknowledgements

Finansiering från DOD W81XWH-1023/10/01 (ZJG), bidrag P50 GM081879 från UCSF Centrum för Systems och Syntetisk biologi (ZJG), NIH 5R21EB015088-02 (YJ) och NIH 1R21EB018044 (ZJG & YJ). DS stöddes av Human Frontier Science Program tvärvetenskaplig postdoc forskningsgemenskap.

Materials

Name Company Catalog Number Comments
mQD Production
Phosphorothioate DNA:
(A*)x50-(ACTG)x5 IDT Most DNA Synthesis companies
Quantum Dots:
QDots 525, 585, 605 & 625 Invitrogen Q21791MP (545), Q21711MP (585), Q21701MP (605) Custom QD synthesis for QD625.
QD610 Ocean Nanotech QSP-610-10 
QD 610 lamda Aldrich 731854
Chloroform, 99.8% ACROS 67-66-3
Tetrabutylammonium bromide, 98.0% Sigma-Aldrich 426288
mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95% Polypure 11156-0695
HSC11EG6CO2H  [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H] ProChimia TH 003-m11.n6-0.1
Boric Acid, 99.5% Sigma-Aldrich B0394
Sodium Hydroxide, 99.0% ACROS S/4845
Sodium Chloride, 98% Sigma-Aldrich 310166
Agarose LE U.S. Biotech Sources G02PD-125
Ethanol Sigma-Aldrich 459828
BG-DNA Production
Amine DNA:
(CAGT)5-NH2 IDT N/A Most DNA Synthesis companies
(CAGT)5(T)40-NH2 IDT N/A Most DNA Synthesis companies
NHS-GLA-Benzylguanine New England Biosciences S9151
DMSO Sigma-Aldrich D8428
HEPES Buffer Sigma-Aldrich 83264
NAP5 Column GE Healthcare 17-0853-01
C18 Column
Acetonitrile
Mammalian Cell Culture & Imaging
Cell line expressing SNAP-tagged protein New England Biosciences E9100S
McCoys 5A UCSF Cell Culture Facility Specific to U2OS culture
Fetal Bovine Serum UCSF Cell Culture Facility Specific to U2OS culture
PBS UCSF Cell Culture Facility
Nunc Lab-tek II Chambered Coverglass Thermo-Fischer Scientific 155409
Matriplate 96-well plate Brooks Life Science Systems MGB096-1-2-LG-L
BSA
5% Alkali-soluble Casein EMD Millipore 70955 Not all caseins are the same
(Optional) DNA Synthesis Reagents
5’ Amine modifier C6 Glen Research Oct-06
dA-Thiophosphoramidite Glen Research 10-700
Analysis Software
FIJI http://valelab.ucsf.edu/~schindelin/
RyTrack.pro http://sun.iwu.edu/~gspaldin/rytrack.html
Tracker http://www.gartnerlab.ucsf.edu/more/software

DOWNLOAD MATERIALS LIST

References

  1. Sako, Y., Minoghchi, S., Yanagida, T. Single-molecule imaging of EGFR signaling on the surface of living cells. Nature Cell Biology. 2, (3), 168-172 (2000).
  2. Luo, W., He, K., Xia, T., Fang, X. Single-molecule monitoring in living cells by use of fluorescence microscopy. Analytical and Bioanalytical Chemistry. 405, (1), 43-49 (2013).
  3. Chung, I., et al. Spatial control of EGF receptor activation by reversible dimerization on living cells. Nature. 464, (7289), 783-787 (2010).
  4. Fernández-Suárez, M., Ting, A. Fluorescent probes for super-resolution imaging in living cells. Nature Reviews Molecular Cell Biology. 9, (12), 929-943 (2008).
  5. Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy. The Journal of Physical Chemistry B. 105, (35), 8281-8284 (2001).
  6. Pinaud, F., Clarke, S., Sittner, A., Dahan, M. Probing cellular events, one quantum dot at a time. Nature Methods. 7, (4), 275-285 (2010).
  7. Michalet, X., et al. Quantum dots for live cells, in vivo imaging, and diagnostics. Science. 307, (5709), 538-544 (2005).
  8. Howarth, M., et al. Monovalent, reduced-size quantum dots for imaging receptors on living cells. Nature Methods. 5, (5), 397-399 (2008).
  9. Iyer, G., et al. Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging. Bioconjugate Chemistry. 22, (6), 1006-1011 (2011).
  10. Tikhomirov, G., et al. DNA-based programming of quantum dot valency, self-assembly and luminescence. Nature Nanotechnology. 6, (8), 485-490 (2011).
  11. Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. Formation of targeted monovalent quantum dots by steric exclusion. Nature Methods. 10, (12), 1203-1205 (2013).
  12. Gartner, Z. J., Bertozzi, C. R. Programmed assembly of 3-dimensional microtissues with defined cellular connectivity. Proceeding of the National Academy of Sciences USA. 106, (12), 4606-4610 (2009).
  13. Selden, N. S., et al. Chemically programmed cell adhesion with membrane-anchored oligonucleotides. Journal of the American Chemical Society. 134, (2), 765-768 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats