Produzione e Targeting di monovalente Quantum Dots

1Department of Otolaryngology, University of California, San Francisco, 2Department of Chemistry, University of California, Berkeley, 3Materials Science Division, Lawrence Berkeley National Laboratory, 4Department of Pharmaceutical Chemistry, University of California, San Francisco, 5Tetrad Graduate Program, University of California, San Francisco, 6Center for Systems and Synthetic Biology, University of California, San Francisco, 7Chemistry and Chemical Biology Graduate Program, University of California, San Francisco
* These authors contributed equally
Published 10/23/2014
0 Comments
  CITE THIS  SHARE 
Bioengineering
 

Summary

Cite this Article

Copy Citation

Seo, D., Farlow, J., Southard, K., Jun, Y. w., Gartner, Z. J. Production and Targeting of Monovalent Quantum Dots. J. Vis. Exp. (92), e52198, doi:10.3791/52198 (2014).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

La dinamica di singole molecole sulle cellule vive contribuisce alla loro funzione biologica. Singola molecola di imaging di fluorescenza è un metodo popolare per studiare la dinamica di singola molecola sulla superficie cellulare 1,2,3. Tuttavia, le sonde di imaging più comunemente utilizzati in questi studi hanno diversi svantaggi importanti. Ad esempio, coloranti organici convenzionali e proteine ​​fluorescenti garantiscono luminosità moderata, circa 10 5 -10 6 M -1 cm -1, ma sono fotochimica instabili, sbiancamento dopo l'emissione di circa 10 5 -10 6 fotoni in tipiche condizioni di imaging live-cell 4,5. Al contrario, le nanoparticelle di semiconduttori, spesso chiamati punti quantici (QD), sono significativamente più luminoso e più stabile, con coefficienti di estinzione nel range di 10 6 -10 7 M -1 cm -1 e superiore a 10 7 -10 8 fotoni emessi prima photoblNSEGNARE 5. La luminosità migliorata e fotostabilità di QD oltre fluorofori organici consente l'osservazione delle singole molecole a frame rate notevolmente più veloci e più ancora a lungo traiettorie 6.

Nonostante i loro vantaggi e disponibilità commerciale, alcune passività rimangono per questi potenti agenti di imaging. In primo luogo, essi hanno mal definito il targeting di valenza, che può provocare la reticolazione di biomolecole mirati 6. In secondo luogo, in genere hanno una grande dimensione idrodinamica (> 20 nm) che limita l'accessibilità per determinati ambienti affollati cellulari 7. In terzo luogo, essi hanno limitato il targeting modularità 7. Diverse strategie hanno tentato di affrontare questi problemi 8,9,10, ma in genere richiedono conoscenze e reagenti speciali implementare.

Per affrontare questi problemi, abbiamo recentemente riportato una strategia di "esclusione sterica" ​​per la preparazione monovalente, piccolo, emodulari QD 11. I QD sono avvolti con un unico lungo DNA fosforotioato (ptDNA) polimero. Il ptDNA si lega alla superficie QD attraverso molteplici interazioni Zn-S tra gli atomi di Zn-superficie esposta ei gruppi fosforotioati del polimero ptDNA. Un unico polimero legato stericamente e elettrostaticamente esclude il legame di equivalenti aggiuntivi del polimero senza aumentare significativamente la dimensione complessiva della particella (circa 2 nm). Tutti i reagenti sono disponibili in commercio, i prodotti si formano in alto rendimento, e il processo richiede pochi passi dissalazione per la purificazione. Una volta etichettato, QD avvolto con un unico ptDNA (MQDS) si legano ai filamenti di DNA complementari recanti domini di targeting (ad esempio, benzylguanine (BG), benzylcytosine, o alkylhalides).

Queste funzionalità di mira i MQDS specificamente per tag enzimatici come la SNAP, CLIP & HALO che sono geneticamente fuse alla proteina di interesse. Questo è un protocollo per la sintesi, Targeting e live-cell imaging di MQDS prodotti per esclusione sterica.

Protocol

1 Produzione di monovalente Quantum Dots

  1. Trasferimento di fase di QD da organico a fase acquosa
    1. Diluire 200 ml di una soluzione 1 mM di QD fase organica con 400 ml di cloroformio in un flaconcino di vetro da 5 ml.
    2. Mescolare 400 ml di una soluzione 0.3 M tetrabutilammonio bromuro (TBAB) il cloroformio con 36 ml di pulito mPEG tiolo (CH 3 O (CH 2 CH 2 O) 6 C 2 H 5 SH) e agitare O / N.
    3. Aggiungere 800 ml di una soluzione acquosa 0,2 M di NaOH e agitare per 30 sec. Un trasferimento di fase si verifica entro pochi minuti, indicati dal trasferimento delle particelle colorate alla fase acquosa sopra la fase organica più densa.
    4. Se le particelle si aggregano in una terza fase tra le fasi acquosa ed organica, aumentare il tempo di incubazione con il tiolo MPEG. Se la fase acquosa rimane chiaro, i QD non hanno fatto il trasferimento di fase (vedi Figura 3A). In alternativa, aumentare la concentrazione di mPEG tiolo al punto 2 per alleviare poveri trasferimento di fase.
    5. Recuperare l'(colorato) fase acquosa e quindi concentrare le QD raccolti con una colonna Centricon di spin (peso molecolare 30 kDa cut-off) a 1 ml.
    6. Aggiungere la soluzione QD concentrata in una colonna Sephadex NAP10 pre-equilibrata con tampone Tris 10 mM contenente 30 mM NaCl (pH 8,0). Eluire i QD con 1,5 ml di tampone di eluizione di flusso di gravità.
    7. Misurare la concentrazione di QD con spettroscopia di assorbimento a 350 nm.
  2. Preparazione di MQDS
    1. Acquisto (o sintetizzare) ptDNA. Questo protocollo utilizza la sequenza 5'-A S 50 (CT) 10 (ACTG) 5 -3 '(vedi Tabella 1).
DNA Sequenza
5'-A S 50 (CT) 10 (ACTG) 5 A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG
5'-NH 2 - (CT) 10 (CAGT) 5 -3 ' NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT
BG-DNA BG- / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT

Tabella 1. sequenze di DNA utilizzate per produrre e MQDS bersaglio.

  1. Preparare 1 ml di soluzione di QD 100 nM in tampone Tris 10 mM contenente 30 mM NaCl (pH 8).
  2. Aggiungere una goccia saggi 500 microlitri della soluzione di 100 nM ptDNA ai QD acquosi per 1 min, mescolando energicamente. Mescolare o posizionare su un agitatore per un ulteriore 9 ore.
    Nota: Questo dovrebbe teoricamente produrre un rapporto di 1: 2 di ptDNA: QD. Tuttavia, la stechiometria reale è mai perfetta - solitamente il risultato è più vicino a 1: 1.5. Al fine di produrre un rapporto 1: 1 di ptDNA: QD, densitometria dopo elettroforesi su gel è necessario quantificare l'esatto rapporto di coniugazione in volumi noti utilizzati in precedenza.
  3. Rimuovere ~ 10 ml di miscela QD per funzionare su un gel di agarosio analitica. Rimuovere anche una simile concentrazione di QD non coniugati in fase acquosa (dal punto 1.2.1).
    1. Aggiungere ~ 2 μ; L di tampone di caricamento 6x Ficoll (per aumentare la densità della soluzione) ed eseguire questi due campioni insieme su un gel 0,8% p / v agarosio in tampone borato di sodio per 15 minuti a 150 V. Una singola banda nella corsia di controllo non coniugata migrazione vicino a il bene, e due bande in corsia con QD coniugati sono visti (vedi gel nella Figura 2B).
  4. Calcolare la frazione QD coniugato usando l'intensità relativa delle due bande (vedere l'equazione nella Figura 2B). Quindi utilizzare la frazione per calcolare il volume supplementare di 100 nM ptDNA soluzione necessaria per corrispondere al numero di QD.
  5. Ripetere i passaggi da 1.2.3 a 1.2.5 ancora una volta con questo volume calcolato o fino a quando il QD coniugati crollo in una singola banda sul gel che indica la coniugazione completa di tutti i QD.
  6. Aggiungere 100 ml di 10 mM (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (carbossi PEG6 alcano tiolo) in 10 mM Tris buffer di containing 30 mM NaCl (pH 8) per i MQDS coniugati prodotte in precedenza, e agitare per 10 min.
    Nota: Questi ligandi PEG passivare la superficie QD. Un PEG sarà più meglio passivare i QD, tuttavia, sarà anche aumentare la loro dimensione. La funzionalità alcano tiolo idrofoba ha un'affinità molto maggiore per i QD, nel complesso, rispetto al meno idrofobico PEG-tiolo utilizzato per il trasferimento di fase. Pertanto, non permettere che questo passaggio di procedere troppo a lungo o il ptDNA sarà sostituito dal alcano-PEG-tiolo. Dopo un min di incubazione ~ 30, una frazione significativa di DNA sarà stato spostato dai QD (Figura 3B).
  7. Per rimuovere l'eccesso di alcano PEG-tiolo, aggiungere 0,5 ml della soluzione QD per una colonna Sephadex NAP5 pre-equilibrata con tampone di eluizione (10 mM tampone Tris contenente NaCl 30 mM). Raccogliere le MQDS con 1,0 ml di tampone di eluizione di flusso di gravità.
  8. Concentrare i QD raccolti con una colonna Centricon di spin (30 kDa). Conservare queste MQDS a 4 ° C per mesi. Non frli eeze.
    Nota: Se una pallina colorata nella parte inferiore del tubo è visto, i puntini si sono aggregati e sono probabilmente non più utilizzabili.

2 Produzione di targeting (Benzylguanine-) DNA

  1. Produrre o acquistare DNA ammina-terminato. Questo protocollo utilizza la sequenza 5'-NH 2 - (CT) 10 - (CAGT) 5 -3 '(vedi Tabella 1). Il linker poli-CT aumenta l'accessibilità alla funzionalità sepolto nel profondo del glicocalice, ma potrebbe non essere necessario per tutte le applicazioni. Se vi è l'accesso a un sintetizzatore di DNA, produrre DNA amino-modificato utilizzando un appropriato 5 'amino-modificatore (5' amino-modificatore C6).
  2. Sciogliere BG-N-idrossisuccinimmide (BG-NHS) in dimetilsolfossido secco (DMSO) ad una concentrazione di 10 mg / ml.
    Nota: BG-NHS in grado di assorbire acqua dall'aria e portare a idrolisi del reattiva NHS-estere, in particolare in solventi igroscopici come il DMSO e dimetilformammide (DMF). BG-NHS è miglior negoziod a -80 ° C come polvere nel suo flacone in un contenitore contenente essiccante secondario. Riscaldare a TA prima apertura del flacone. In alternativa, un'aliquota immediatamente per uso singolo estere BG-NHS in un solvente polare asciutto e congelare a -80 ° C, o reagire completamente con il DNA ammina al punto 2.2.
  3. Reagire mescolando il BG-NHS in DMSO dal punto 2.1 con il DNA ammina-terminato in HEPES (4-(2-idrossietil) -1 acido-piperazineethanesulfonic) tamponata (pH 8,5) di acqua. In un tipico reagire 20 ml di 10 mg / ml BG-NHS in DMSO con 2 ml di 2 mM NH 2 - (CT) 10 - (CAGT) 5 a 58 ml di acqua deionizzata tamponata con 20 microlitri 0,5 M HEPES pH 8,5. Effettuare reazioni in una provetta da 1,5 ml microcentrifuga. Mescolare rapidamente la reazione procede rapidamente e deve competere con NHS-estere idrolisi.
  4. Sonicare per 5-10 min per garantire un'accurata miscelazione. Incubare ~ 1 ora a temperatura ambiente. Il rapporto stechiometrico di BG: DNA può essere modificato per guidare la reazione al completamento.
  5. Purificare il BG-DNA dal reagito ammina-DNA-HPLC in fase inversa esecuzione di un TEAA 100 mm: acetonitrile (ACN) pendenza tra l'8% e il 95% acetonitrile oltre 30 min. L'ammina-DNA che non ha reagito viene eluire prima che il BG-DNA. Raccogliere la frazione BG-DNA in un tubo conico.
    1. Utilizzare una colonna C 18 Zorbax per la purificazione oligonucleotide di serie e il seguente gradiente:
      0 → 15 min: 8 → 30% ACN;
      15 → 21 min: 30-90% ACN;
      21 → 25 min: 90 → 8% ACN;
      25 → 30 min: 8% ACN;
  6. Congelare in azoto liquido e liofilizzare la frazione raccolta. Risospendere il DNA in acqua deionizzata. Per essere molto attenti, liofilizzare altre due volte per rimuovere TEAA residuo. TEAA residuo può essere tossico per le cellule a concentrazioni più elevate.
  7. Risospendere il liofilizzato BG-DNA in acqua, avendo cura di lavare i lati di the tubo, e portare a ~ 25 mM magazzino. Aliquota e conservare a 4 ° C. I campioni sono stati conservati per ~ 9 mesi senza degrado evidente.

3. Cellule Etichettatura diretta con monovalente Quantum Dots

  1. Facoltativamente, passivare le MQDS appena prima di un esperimento di imaging utilizzando reagenti quali caseina (0,5%) o albumina di siero bovino (BSA, 1-3%).
  2. Cellule piastra che esprimono la proteina SNAP-tag sulla riflessione totale interna fluorescenza (TIRF) vetro -Qualità. In questo esperimento, si usa una linea cellulare U2OS esprimono un recettore Notch1 SNAP-tag e superfici in vetro di alta qualità.
  3. Dopo che le cellule hanno attaccato al vetro (~ 24 ore), rimuovere i supporti di crescita, lavare con PBS, e incubare le cellule per 10-30 minuti a temperatura ambiente in ~ 100-150 ml di PBS o supporti cella contenente ~ 1 mM BG- DNA a partire dal punto 2.6.
  4. Dopo l'incubazione con BG, lavare accuratamente le cellule con PBS o supporti cellulare. Incubare le cellule per ~ 5-10 min con thE MQDS prodotte nella fase 1.2.9 (e facoltativamente passivazione al punto 3.1).
  5. Facoltativamente, lavare i MQDS non legate e tornare alle cellule di un buffer / media adatto sia per l'imaging e la cultura. Per le celle che dovevano essere ripreso in modalità TIRF, una fase di lavaggio finale è stato spesso inutili come MQDS sciolti in soluzione diffuse così rapidamente rispetto a MQDS legati da essere rilevabile durante l'analisi.

4. Microscopia e analisi

  1. Immagine le cellule utilizzando un microscopio TIRF.
    Nota: Il campo di applicazione deve avere eccitazione separabili e filtri di emissione, o un filtro cubo QD personalizzato. QD sono meglio eccitato con un laser a bassa lunghezza d'onda (405 o 488 nm). QD di diametro diverso hanno caratteristiche lunghezze d'onda di emissione, in genere associato a un grande cambiamento di Stoke.
  2. A causa della luminosità di MQDS, raccogliere immagini a frame rate elevati in TIRF mentre l'imaging lato basale di una cellula dal vivo.
    Nota: In alternativa, dinamica singola molecola possono essere followed in altri piani focali utilizzando un microscopio confocale disco rotante. Automatizzato software di monitoraggio singola particella è generalmente efficace a seguire con precisione le MQDS luminose e fotostabili.

Representative Results

Il trasferimento di fase dei QD da un organico ad una fase acquosa è critica per la produzione di MQDS, ma può essere sia condizionamento e QD-specifico. Trasferimento di fase nella sezione 1.1 dovrebbe apparire pulito come i primi due flaconcini in Figura 3. Se il trasferimento appare più come fiala 3, allora si dovrebbe cercare di nuovo con condizioni diverse.

Una volta che i QD sono rivestite con il DNA caricata negativamente dovrebbero migrare su un gel separatamente dai QD non avvolto. Utilizzando una aliquota di QD da scartare come un controllo, una seconda, fascia più veloce la migrazione dovrebbe apparire sulla aggiunta del ptDNA, come si è visto nel primo gel in figura 2B. Formazione completa a MQDS è dimostrato con la perdita della banda immobile, e la sua caduta nella banda cellulare come visto nell'ultimo gel in Figura 2B. Se una aliquota di prodotto dell'MQD migra come una singola banda separabili dai QD da scartare, quindi i vostri MQDS sono monovalenti e r Eady per essere utilizzato in ulteriori passi.

Etichettatura delle cellule dovrebbe essere specifico per il target di vostra scelta e dovrebbe essere dipendente da livelli di espressione di proteine ​​e concentrazione MQD. Ottimizzazione empirica sia di concentrazione MQD e MQD passivazione è spesso necessaria per una determinata applicazione. Figura 4B mostra l'etichettatura delle cellule U2OS che esprimono un recettore Notch SNAP-tag con MQDS che variano in concentrazione da 0,5 Nm a 10 Nm.

Figura 1
Figura 1 modulare il targeting di MQDS. MQDS ibridano a ssDNA funzionalizzati da varie molecole di targeting. Benzylguanine-legata obiettivi DNA MQDS di SNAP-tag proteine ​​di fusione. Altri 5 'modifiche e sequenze di DNA permettono la presa di mira di MQDS a una varietà di altre biomolecole./files/ftp_upload/52198/52198fig1highres.jpg "target =" _blank "> Clicca qui per visualizzare una versione più grande di questa figura.

Figura 2
Figura 2 Schema per la produzione di MQDS. (A) QD Organic-fase vengono trasferite alla fase acquosa mediante trattamento con mPEG tiolo e TBAB, avvolto con ptDNA, e passivato con carbossi PEG6 tiolo alcani. Immagini rappresentative TEM sono QD545 organico, QD585, e QD605 rispettivamente. (B) Un metodo per determinare empiricamente la stechiometria di interazione tra QD e ptDNA al precedente punto due. QD & ptDNA stechiometrie sono empiricamente verificate da densitometria tale che la stechiometria di reazione finale è di 1: 1 (QD: ptDNA). Il numero iniziale di moli di ptDNA è moltiplicato per il rapporto di QD: MQD, e regolata dal af effettivo volume di ter coniugazione di cedere il numero di moli necessari per raggiungere 1:. 1 coniugazione Cliccare qui per visualizzare una versione più grande di questa figura.

Figura 3
Figura 3. dettagli sperimentali per la produzione di MQDS. (A) foto rappresentative di successo e fallito il trasferimento di fase. QD dovrebbe trasferire visivamente tra la fase organica densa e la fase acquosa meno densa. Separazione di fase incompleta indica scarsa trasferimento. (B) ptDNA può essere sostituito dal alcano-PEG-tiolo. Dati gel di destra è rappresentativo di una reazione in cui una frazione significativa di ptDNA sono stati sfollati dai QD a causa di eccesso di passivazione.ES.jpg "target =" _blank "> Clicca qui per visualizzare una versione più grande di questa figura.

Figura 4
Figura 4 Etichettatura proteine ​​SNAP-tag su cellule vive. (A) Schema che dimostra l'espressione, l'attaccamento e l'etichettatura di un recettore SNAP-tag con un MQD BG-targeting. (B) l'etichettatura Rappresentante di cellule che esprimono una SNAP-Notch-mCherry costruire a varie concentrazioni MQD. MQDS passivato con PEG12 colocalizzano con mCherry indica etichettatura specifica. Densità di etichettatura più bassi (<0,5 nM) sono generalmente preferibili per l'inseguimento singola particella. Barra della scala è di 10 micron. Cliccate qui per vedere una versione più grande di questa figura.

Discussion

La modularità del disegno dell'MQD consente una maggiore flessibilità sperimentale. Ad esempio, una varietà di MQDS può essere rapidamente preparato in colori unici consentano imaging simultaneo di più bersagli. La sequenza di targeting ssDNA può dirigere MQDS alle proteine, zuccheri, lipidi e 12 superfici 13. Un certo numero di tag enzimatiche sono disponibili con reattività ortogonali, consentendo a più obiettivi da essere ripreso in contemporanea con MQDS differenziale mirati. Oltre al targeting con il tag SNAP, l'etichettatura delle proteine ​​bersaglio con MQDS utilizzando il tag CLIP, il tag HALO, e proteine ​​biotinilati era anche successo. Questo protocollo dimostra la marcatura specifica di un recettore di superficie su cellule vive con questi MQDS, ma il protocollo può essere facilmente adattato a diversi contesti differenti.

L'intuizione metodologica significativo nella produzione MQDS con valenza definita è che ~ 50 fosforotioato-linkedle basi sono tenuti ad avvolgere i QD (e quindi evitare che due molecole di legarsi contemporaneamente). Una poli-Una sequenza S 50 riproducibile e stabilmente vincolata 605 nm QD da Life Technologies. Anche se questo prodotto è fuori produzione, la strategia di esclusione sterica è generalizzabile a prodotti simili di altri produttori che hanno diverse dimensioni, forme, le proprietà spettrali.

L'efficienza e la stabilità dei QD ptDNA-avvolto dipende in modo critico dalla chimica di superficie e la struttura dei QD. Pertanto, il successo di un protocollo dipenderà dalla struttura sorgente e la chimica commerciale dei QD. Ai fini del presente protocollo, tre grandi punti di differenza esiste tra le varie fonti commerciali di QD: una differenza nelle condizioni necessarie per il trasferimento di fase; una differenza nella forza di iniziale PEG-tiolo-ligando vincolante, eventualmente ostacolare lo spostamento dal ptDNA; e una differenza nella quantità di nucleo CdSe esposto, che può leannuncio a la tempra del QD dalle condizioni di trasferimento di fase tiolo Mpeg.

Come di pubblicazione, QD con la migliore struttura per la produzione di MQDS sono 4-10 nm QD CdSe / ZnS nucleo / guscio acquistati da Life Technologies con spettri di emissione a 545, 585, 605 e 625 nm (Figura 2A). QD basati sulla formulazione 'Vivid' (545, 605, ecc) estinguono dopo l'aggiunta di mPEG tiolo e non sono adatti per questa applicazione. QD da Aldrich e Ocean Nanotech funzionano bene, ma richiedono il trasferimento gradini e pre-trattamento con ossido trioctylphosphine fase più lunga. Questo protocollo è stato ottimizzato per QD da Life Technologies.

La sequenza poly-A fosforotioato utilizzato per avvolgere i QD termina con una coda di DNA di 20-mer nativo contenente la sequenza di (ACTG) 5 a cui un filamento di targeting può ibridare. Questa sequenza è conveniente, in quanto ha poca o nessuna struttura secondaria, e rimarrà hybridized a 37 ° C in PBS. Se vi è l'accesso a un sintetizzatore di DNA, il ptDNA può venire sintetizzato e poi purificato per cromatografia in fase inversa liquida ad alta prestazione (HPLC) utilizzando una colonna C 8. Il ptDNA si eluire in seguito alla HPLC di oligonucleotidi equivalenti con una spina dorsale nativo. Noi di solito lasciamo il 5 'DMT gruppo protettivo sui nostri oligonucleotidi fosforotioati dopo la purificazione.

Passivazione dei QD ptDNA-avvolto è di solito necessario per migliorare la stabilità colloidale del QD e ridurre vincolante per le applicazioni più sperimentali sfondo. Il protocollo utilizza un PEG-livello per passivare le QD. Carboxy PEG tiolo alcano con unità aggiuntive PEG ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H 23 SH, carbossi-PEG12 alcano tiolo) fornisce significativamente ridotto sfondo, anche se i PEG più lunghi sono entrambi più grandi, e generalmente più costosi. MQDS rivestiti con carbossi PEG alkaleganti tiolici ne sono altamente stabili nel buffer fisiologici come fosfato tamponata saline e terreni di coltura. Stoccaggio a lungo termine (> 8 mesi) di MQDS a 4 ° C non ha mostrato alcuna significativa aggregazione o ptDNA distacco 11. A seconda l'esperimento, PEG passivazione dei QD da sola non sempre sufficiente a ridurre legame non specifico delle MQDS. Incubare entrambe le cellule e MQDS in tampone fosfato salino (PBS) contenente il 3% di BSA per 20 minuti prima dell'uso sostanzialmente riduce legame non specifico per le cellule, anche se non aumentare il raggio idrodinamico apparente delle MQDS da ~ 50%. Passivazione con 0,5% di caseina riduce il legame non specifico ulteriormente ma aumenta la dimensione apparente in misura maggiore di BSA.

L'estremità 5 'di un filamento di DNA complementare ai MQDS può essere modificato per consentire il targeting di diverse biomolecole. Ci sono un certo numero di tecniche consolidate disponibili per modificare covalentemente proteine, lipids e zuccheri con DNA a singolo filamento (ssDNA). Finché il ssDNA viene presentato extracellulare, è accessibile a MQDS solubili. MQDS con le sequenze di cui sopra saranno rapidamente ibridare con il loro filamento di DNA complementare in condizioni di coltura cellulare. A 10-20x poli (CT) distanziale tra il ptDNA e la sequenza di targeting può essere richiesto per il targeting efficiente in modo da elevare la sequenza di legame sopra il glicocalice della cellula spessa e carica negativa. Per questo protocollo abbiamo scelto di produrre un BG-DNA con una sequenza complementare di (CAGT) 5 che sia ibridato ai MQDS e covalente si collegherà ad una proteina SNAP-tag per l'etichettatura rapida e specifica. A funzioni di protocollo simili anche per l'accoppiamento altre NHS-esteri di oligonucleotidi aminoacidi modificati.

Per l'imaging singola molecola, una bassa densità di etichettatura è in genere necessario per risolvere singole molecole. Una concentrazione finale MQD di ~ 0,5 nM in PBS con l'agente passivanteè un buon obiettivo. Tuttavia, queste diluizioni elevate talvolta portato a sotto-etichettatura delle cellule. In questo caso, ulteriore MQD possono essere aggiunti fino a quando si osserva una densità ottimale di etichettatura. Nel caso di SNAP-tag Notch1 umano, concentrazioni> 10 nM MQD prodotte cellule di etichettatura dense mentre 0,5 nM MQD portato l'attaccamento di ~ 20 MQDS sulla superficie basale della cellula bersaglio (vedi Figura 4B). Etichettatura delle cellule con MQDS era altamente dipendente dalla confluenza delle cellule placcato. Eccessivamente cellule confluenti non etichettare a loro superfici basali.

In sintesi, un metodo semplice per generare monovalenti e QD modulari è stato descritto. Questi MQDS trovano utilità in un'ampia gamma di applicazioni di imaging cellulare dal vivo, come dimostra l'imaging del recettore Notch sulle cellule U2OS dal vivo. Applicabilità MQDS non è limitata a questo caso specifico, ma può essere potenzialmente estesa per altri bersagli cellulari come altre proteine, acidi nucleici, ed enzimi.

Acknowledgements

Finanziamento previsto dal DOD W81XWH-1023/10/01 (ZJG), concessione P50 GM081879 dal Centro UCSF per sistemi e Biologia Sintetica (ZJG), NIH 5R21EB015088-02 (YJ) e NIH 1R21EB018044 (ZJG & YJ). DS è stato sostenuto da Human Frontier Science Program Cross postdoc disciplinare Research Fellowship.

Materials

Name Company Catalog Number Comments
mQD Production
Phosphorothioate DNA:
(A*)x50-(ACTG)x5 IDT Most DNA Synthesis companies
Quantum Dots:
QDots 525, 585, 605 & 625 Invitrogen Q21791MP (545), Q21711MP (585), Q21701MP (605) Custom QD synthesis for QD625.
QD610 Ocean Nanotech QSP-610-10 
QD 610 lamda Aldrich 731854
Chloroform, 99.8% ACROS 67-66-3
Tetrabutylammonium bromide, 98.0% Sigma-Aldrich 426288
mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95% Polypure 11156-0695
HSC11EG6CO2H  [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H] ProChimia TH 003-m11.n6-0.1
Boric Acid, 99.5% Sigma-Aldrich B0394
Sodium Hydroxide, 99.0% ACROS S/4845
Sodium Chloride, 98% Sigma-Aldrich 310166
Agarose LE U.S. Biotech Sources G02PD-125
Ethanol Sigma-Aldrich 459828
BG-DNA Production
Amine DNA:
(CAGT)5-NH2 IDT N/A Most DNA Synthesis companies
(CAGT)5(T)40-NH2 IDT N/A Most DNA Synthesis companies
NHS-GLA-Benzylguanine New England Biosciences S9151
DMSO Sigma-Aldrich D8428
HEPES Buffer Sigma-Aldrich 83264
NAP5 Column GE Healthcare 17-0853-01
C18 Column
Acetonitrile
Mammalian Cell Culture & Imaging
Cell line expressing SNAP-tagged protein New England Biosciences E9100S
McCoys 5A UCSF Cell Culture Facility Specific to U2OS culture
Fetal Bovine Serum UCSF Cell Culture Facility Specific to U2OS culture
PBS UCSF Cell Culture Facility
Nunc Lab-tek II Chambered Coverglass Thermo-Fischer Scientific 155409
Matriplate 96-well plate Brooks Life Science Systems MGB096-1-2-LG-L
BSA
5% Alkali-soluble Casein EMD Millipore 70955 Not all caseins are the same
(Optional) DNA Synthesis Reagents
5’ Amine modifier C6 Glen Research Oct-06
dA-Thiophosphoramidite Glen Research 10-700
Analysis Software
FIJI http://valelab.ucsf.edu/~schindelin/
RyTrack.pro http://sun.iwu.edu/~gspaldin/rytrack.html
Tracker http://www.gartnerlab.ucsf.edu/more/software

DOWNLOAD MATERIALS LIST

References

  1. Sako, Y., Minoghchi, S., Yanagida, T. Single-molecule imaging of EGFR signaling on the surface of living cells. Nature Cell Biology. 2, (3), 168-172 (2000).
  2. Luo, W., He, K., Xia, T., Fang, X. Single-molecule monitoring in living cells by use of fluorescence microscopy. Analytical and Bioanalytical Chemistry. 405, (1), 43-49 (2013).
  3. Chung, I., et al. Spatial control of EGF receptor activation by reversible dimerization on living cells. Nature. 464, (7289), 783-787 (2010).
  4. Fernández-Suárez, M., Ting, A. Fluorescent probes for super-resolution imaging in living cells. Nature Reviews Molecular Cell Biology. 9, (12), 929-943 (2008).
  5. Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy. The Journal of Physical Chemistry B. 105, (35), 8281-8284 (2001).
  6. Pinaud, F., Clarke, S., Sittner, A., Dahan, M. Probing cellular events, one quantum dot at a time. Nature Methods. 7, (4), 275-285 (2010).
  7. Michalet, X., et al. Quantum dots for live cells, in vivo imaging, and diagnostics. Science. 307, (5709), 538-544 (2005).
  8. Howarth, M., et al. Monovalent, reduced-size quantum dots for imaging receptors on living cells. Nature Methods. 5, (5), 397-399 (2008).
  9. Iyer, G., et al. Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging. Bioconjugate Chemistry. 22, (6), 1006-1011 (2011).
  10. Tikhomirov, G., et al. DNA-based programming of quantum dot valency, self-assembly and luminescence. Nature Nanotechnology. 6, (8), 485-490 (2011).
  11. Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. Formation of targeted monovalent quantum dots by steric exclusion. Nature Methods. 10, (12), 1203-1205 (2013).
  12. Gartner, Z. J., Bertozzi, C. R. Programmed assembly of 3-dimensional microtissues with defined cellular connectivity. Proceeding of the National Academy of Sciences USA. 106, (12), 4606-4610 (2009).
  13. Selden, N. S., et al. Chemically programmed cell adhesion with membrane-anchored oligonucleotides. Journal of the American Chemical Society. 134, (2), 765-768 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats