العدوى البكتيرية النظامية والمناعة الظواهر الدفاع في

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster. J. Vis. Exp. (99), e52613, doi:10.3791/52613 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

ذبابة الفاكهة ذبابة الفاكهة السوداء البطن هو واحد من الكائنات النموذجية رئيس الوزراء لدراسة وظيفة وتطور الدفاع المناعي. هي الحفاظ العديد من الحصانة الفطرية الجوانب بين الحشرات والثدييات، ومنذ ذبابة الفاكهة يمكن بسهولة وراثيا وتجريبيا التلاعب بها، فهي قوية لدراسة وظيفة الجهاز المناعي والآثار الفسيولوجية للمرض. الإجراء أثبت هنا يسمح إصابة الذباب بواسطة إدخال البكتيريا مباشرة في تجويف الجسم، وتجاوز الحواجز الظهارية وأشكال أكثر سلبية للدفاع والسماح التركيز على العدوى النظامية. ويشمل الإجراء بروتوكولات لمعدلات قياس وفيات المضيف، تحميل الممرض النظامية، ودرجة تحريض الجهاز المناعي المضيف. هذا الإجراء العدوى غير مكلفة وقوية وقابلة للتكرار كميا، ويمكن استخدامها في دراسات علم الوراثة وظيفية، التطوري تاريخ الحياة، وعلم وظائف الأعضاء.

Introduction

ذبابة الفاكهة ذبابة الفاكهة السوداء البطن هو واحد من الكائنات النموذجية رئيس الوزراء لدراسة وظيفة وتطور الدفاع المناعي. ذبابة الفاكهة هي غير مكلفة وسهلة العمق، هي قابلة للغاية للتلاعب التجريبية، والمدعومة من قبل المجتمع العلمي واسعة النطاق التي وضعت عريضة مجموعة من أدوات البحث. يتم حفظها العديد من الحصانة الفطرية الجوانب بين الحشرات والثدييات، بما في ذلك نقل الإشارة بوساطة مستقبلات تول مثل وNF كيلوبايت عوامل النسخ الأسرة، JAK / STAT الإشارات، وردود مسار JNK 1،2 وظيفة هذه الجينات ومسارات يمكن يمكن الاستعلام في D. البطن باستخدام الطفرات أو رني knockdowns أن زيادة أو نقصان مسار الأنشطة 3 - 6 بالإضافة إلى ذلك، ذبابة الفاكهة يمكن استخدامها لدراسة الآثار الفسيولوجية للعدوى والمرض، بما في ذلك في سياق التطور نظرية التاريخ الحياة 7.- 9 جميع هذه الدراسات، ومع ذلك، تعتمد على القدرة على إصابة موثوق الذباب التجريبية في ظل ظروف العلاج المحددة. الإجراء الموضح هنا يمثل الإطار المنهجي لتقديم الالتهابات البكتيرية قوية ومتكررة لذبابة الفاكهة السوداء البطن وبعد ذلك قياس شدة الإصابة وقياس الاستجابة المناعية.

ذبابة الفاكهة يمكن بطبيعة الحال وتجريبيا بالعدوى عن طريق مجموعة واسعة من الطفيليات ومسببات الأمراض، بما في ذلك البكتيريا والفطريات والفيروسات والديدان والطفيليات الدبابير. ويركز البروتوكول الحالي على تقديم عدوى بكتيرية النظامية. العديد من أنواع البكتيريا المختلفة التي يمكن استخدامها لتصيب الذباب، وينبغي أن يستند اختيار مجرب على الأسئلة العلمية الدقيقة التي طلب منها ذلك. على سبيل المثال، يمكن استخدامها العزلات السريرية البشرية لدراسة آليات الفوعة البكتيرية 10، أو بيئيا العزلات ذات الصلة قد تكون preferreد لدراسة تطورية. 11 بعض أنواع البكتيريا الممرضة المختصة D. البطن، تنتشر على العدوى والتسبب في المرض المضيف أو الموت. وتمكنت البكتيريا الأخرى على نحو فعال من قبل النظام المناعي المضيفة وبرأت في غضون أيام قليلة. في هذه المظاهرة، سيتم استخدام بروفيدنسيا الرتغرية كما الممرض التكاثري التي يمكن أن تسبب وفيات المضيفة واستمرت في المضيفين على قيد الحياة. وسوف تستخدم الإشريكية القولونية كغير الممرض التي يتم تطهيرها من قبل النظام المناعي المضيف.

وسيتم إنشاء العدوى عن طريق إدخال البكتيريا مباشرة في تجويف الجسم من الطاير. هذا النهج يتجاوز الحواجز الظهارية والسلوكيات الوقائية، مما يتيح التحقيق في العدوى النظامية بصرف النظر عن طريقة طبيعية لانتقال العدوى. هناك طريقتان الأساسية لإنشاء تجريبيا العدوى النظامية. في المرحلة الأولى، يتم استخدام nanoinjector وسحب الزجاج الشعرية الإبر لحقن العدد الدقيق للالبكتيريا في الطيران. هذا الأسلوب له مزايا السماح لمجموعة ديناميكية كبيرة من جرعات العدوى وكونها من الناحية الكمية تكرار للغاية. النهج الثاني هو تقديم الإصابة بوخز الصرف الصحي. هذا النهج لديه مزايا يجري السريع والتي لا تتطلب أية معدات خاصة. مرة واحدة يتم وضع العدوى، يصبح من الممكن قياس حمولة النظامية الممرض، وفيات المضيف، ومحرض نشاط الجهاز المناعي. بالطبع، يمكن تصور أن يقاس أي عدد من الظواهر إضافية في D. المصاب البطن، بما في ذلك بعد الإصابة الخصوبة 12، القدرة على التعلم 13، والوضع الأيضي 14، أو تقريبا أي سمة أخرى يمكن أن يتصور.

Protocol

1. جمع وإعداد الذباب

  1. D. العمق البطن تحت ظروف تجريبية المطلوب. احرص على عدم ازدحام الذباب خلال تربية والتأكد من أن كثافة اليرقات هي متناسقة عبر العلاجات، لأن الظروف البيئية خلال مرحلة اليرقات يمكن أن تؤثر بعمق الظواهر الدفاع المناعي خلال مرحلة البلوغ. 15
  2. جمع الذباب التجريبية 0-3 أيام بعد eclosion من حالة العذراء ونقلها إلى متوسطة جديدة.
  3. بيت الذباب التي تم جمعها في درجة الحرارة المطلوبة (درجات حرارة تتراوح بين 22 درجة مئوية و 28 درجة مئوية هي مناسبة عموما) حتى وتتراوح اعمارهم بين 5-7 أيام eclosion آخر.
    ملاحظة: هذا يتيح وقتا كافيا للذباب لاستكمال التحول وتصبح ناضجة البالغين، ولكن على ما يرام قبل أن تبدأ الشيخوخة.
  4. فرز العدد المطلوب من الذباب إلى قارورة منفصلة السابقة للإصابة، مع الأخذ مرة أخرى الحرص على تجنب الازدحام.
    ملاحظة: فقط أماهمصابون ليه في هذه المظاهرة ولكن من الممكن أن تصيب الإناث على حد سواء باستخدام الإجراء الموضح.

2. الثقافة وتحضير البكتيريا

  1. إعداد لوحة رئيسية من البكتيريا المختار 2 يوما على الأقل قبل الإصابة. خط البكتيريا من المخزون الجلسرين 15٪ تخزينها إلى أجل غير مسمى في -80 ° C. تخزين لوحة رئيسية عند 4 درجة مئوية لمدة تصل الى 2 أسابيع. دائما متتالية لوحات رئيسية مباشرة من مخزون الجلسرين المجمدة. تجنب مرور المسلسل من البكتيريا من لوحة إلى لوحة، كما المتكررة مرور في الثقافة يمكن أن تسبب البكتيريا أن تتطور الفوعة الموهنة.
    ملاحظة: هذا المثال يجعل من استخدام بروفيدنسيا الرتغرية والإشريكية القولونية.
  2. استخدم الإجراء التالي لإعداد تعليق البكتيرية للحقن.
    1. تنمو ثقافة 2 مل من البكتيريا، فحقن المتوسطة العقيمة مع مستعمرة واحدة معزولة عن لوحة رئيسية. تنمو البكتيريا إلى مرحلة ثابتة (على سبيل المثال ملاحظة: كل P. الرتغرية وكولاي تنمو جيدا في مرق لوريا في درجات حرارة 20-37 درجة مئوية مع الهز لطيف.
    2. بمجرد وصول ثقافة مرحلة ثابتة، بيليه بلطف الخلايا من تقريبا. 600 ميكرولتر من الثقافة في جهاز للطرد المركزي الطاولة (3 دقائق في 5000 x ج)، تجاهل طاف، و resuspend البكتيريا في تقريبا. 1000 ميكرولتر من الفوسفات العقيمة مخزنة المالحة (PBS، 137 ملي كلوريد الصوديوم، و 2.7 ملي بوكل، 10 ملي نا 2 PO 1.8 مم KH 2 PO ودرجة الحموضة = 7.4).
    3. تمييع الخلايا معلق في برنامج تلفزيوني العقيمة لتحقيق الكثافة الضوئية (OD) المناسبة للبكتيريا المستخدمة، ويقاس مع طيفي كما الامتصاصية في 600 نانومتر. استخدام هذا التعليق لتصيب الذباب.
      ملاحظة: A 600 = 0.1 أو 1.0 يتوافق على التوالي إلى ما يقرب من 10 8 و 10 9 بروفيدنسيا الرتغرية أو E. القولونية لكل مل. لأن كلا من العيشالثاني البكتيريا الميتة تسهم في الكثافة الضوئية، فمن المهم أن حصاد الثقافات في مرحلة ثابتة في وقت مبكر قبل تتراكم الجثث البكتيرية وتشويه العلاقة بين الكثافة الضوئية وعدد من البكتيريا قادرة على البقاء قدم خلال العدوى.

3. تصيب الذباب

ملاحظة: كما يتأثر ذبابة الفاكهة الحصانة التي كتبها إيقاع الساعة البيولوجية، فمن المهم أن تؤدي العدوى في وقت مماثل من اليوم عبر مكررات التجريبية 16.

3.1) باستخدام Nanoinjector

  1. إعداد الإبر الزجاج للعدوى.
    1. إعداد إبرة الزجاج عن طريق سحب الزجاج الشعرية البورسليكات باستخدام مجتذب micropipette.
    2. باستخدام ملقط، وقطع غيض من الإبرة إلى إنشاء افتتاح حوالي 50 ميكرون قطر للسماح للطرد من السائل.
  2. تجميع حاقن.
    1. وضع ختم يا الدائري ومن ثم س الأبيضأيسر (الدمل كبيرة تواجه الخارج) على المكبس المعدني.
    2. شغل الإبرة الزجاج مع الزيوت المعدنية باستخدام حقنة بإبرة G 30.
    3. وضع إبرة زجاجية مملوءة من خلال كوليت ثم ضع أكبر O-حلقة حول قاعدته، وحوالي 1MM من نهاية حادة من الإبرة.
    4. حرك إبرة على المكبس معدنية والمسمار بلطف على كوليت حتى أمانا.
    5. إخراج معظم الزيوت المعدنية من محقن، ولكن تأكد من أنه لا يزال هناك كمية صغيرة من النفط في الإبرة ليكون بمثابة حاجز بين حاقن وتعليق البكتيرية. تأكد من عدم وجود أي فقاعات الهواء داخل الزيت المعدني أو تعليق البكتيرية، أو بين السائلين.
    6. تعيين حاقن للحجم المطلوب للحقن (بين 9 و 50 NL NL).
  3. توليد اصابة الضوابط.
    1. شغل الإبرة حاقن مع برنامج تلفزيوني العقيمة عن طريق إدراج بعناية غيض من الإبرة الشعرية في أنبوب من وسائل الإعلام وpressiنانوغرام على زر "ملء" على محقن.
      ملاحظة: يمكن أيضا العقيمة وسائل الإعلام نمو البكتيريا يمكن استخدام عنصر تحكم اصابة إذا كانت التجربة يتطلب حقن البكتيريا العالقة في المتوسط ​​نموها. ومع ذلك، لأن وسائل الإعلام نمو البكتيريا يحتوي على المكونات التي قد تحفز الجهاز المناعي أو يكون لها آثار أخرى على المضيف، حاملة خامل مثل PBS هو الأفضل.
    2. تخدير العدد المطلوب من الذباب في ظل تدفق ضوء CO 2.
    3. حقن الذباب في البطن الأمامي على سطح بطناني مع برنامج تلفزيوني العقيمة.
      ملاحظة: من الممكن أيضا لحقن الذباب في مواقع أخرى، مثل لوحة sternopleural من القفص الصدري، ولكن من المهم للحفاظ على موقع الحقن ثابت في كل تجربة 17.
    4. وضع الذباب حقنها في قوارير جديدة مع الوسيلة الجديدة، ووضع قارورة الى جانبهم حتى كل من الذباب قد تعافى من التخدير لمنع الذباب من أن تصبح عالقة على الغذاء. <ر /> ملاحظة: من المستحسن لحقن الذباب السيطرة PBS قبل حقن البكتيريا إلى الذباب التجريبية حتى نفس الإبرة يمكن أن تستخدم في العلاج على حد سواء. فإنه لن يكون من الممكن دائما لاستخدام نفس الإبرة لتجربة بأكملها. في هذه الحالة، قد يكون مطلوبا لتسجيل الذي إبرة تم استخدامها مع أي الذباب وتشمل الهوية إبرة كعامل التجريبي في التحليل الإحصائي.
  4. حقن مسببات الأمراض البكتيرية.
    1. إخراج الوسائط المعقم المتبقي من حاقن وإعادة ملء نفس الإبرة مع تعليق البكتيرية.
    2. كرر الإجراء أعلاه (3.1.3)، والآن عن طريق الحقن الذباب مع تعليق البكتيرية أعدت في الإجراء 2.2.

3.2) مع التفسخ تستهلكه

  1. إعداد الإبرة لوخز.
    1. تذوب نهاية micropipette غيض 200 ميكرولتر وإدراج 0.15 ملم الحشرات minutien دبوس في البلاستيك المنصهر. السماح للالبلاستيك ليصلب سوالفصل الذي عقد دبوس في مكان مع حوالي 0.5 سم من دبوس تمتد من البلاستيك.
  2. توليد اصابة الضوابط.
    1. تخدير العدد المطلوب من الذباب في ظل تدفق ضوء CO 2.
    2. وخز الذباب في لوحة sternopleural من القفص الصدري مع الإبرة، وتجنب مواقع الحجز على الأجنحة والساقين. إذا لزم الأمر، وإزالة بلطف الذباب من دبوس minutien باستخدام ملقط لينة.
      ملاحظة: ومن الممكن أيضا لوخز الذباب في مواقع أخرى، مثل البطن الأمامي على سطح بطناني، ولكن من المهم للحفاظ على موقع الحقن ثابت في كل تجربة 17 وخز من خلال بشرة البطن تميل إلى أن تكون أكثر صعوبة من وخز من القفص الصدري وبالتالي فهي أقل شيوعا.
    3. وضع الذباب وخز في قارورة جديدة مع الجديد المتوسطة الطاير، وضع قنينة على جانبها حتى كل من الذباب قد تعافى من التخدير لمنع الذباب من كنالمجيء تمسك الطعام.
  3. إدخال العدوى البكتيرية.
    1. تخدير العدد المطلوب من الذباب في ظل تدفق ضوء CO 2.
    2. وخز كل تطير في نفس الموقع مثل الضوابط وسائل الاعلام، لينخفض ​​غيض من دبوس في تعليق البكتيرية أعدت في الإجراء 2.2 قبل وخز كل الطاير.
    3. وضع الذباب وخز في قارورة جديدة مع الجديد المتوسطة الطاير، وضع قنينة على جانبها حتى تعافى كل من الذباب من التخدير لمنع الذباب من أن تصبح عالقة على الغذاء.

3.3) تقييم المعدية الجرعة تسليم

  1. إصابة مجموعة من الذباب كما هو موضح أعلاه في أي إجراء 3.1 أو 3.2، فقط بدلا من إرجاع الذباب إلى قارورة الغذاء للتعافي من التخدير، ووضع كل يطير في أنبوب microcentrifuge على الجليد.
  2. إضافة 250 ميكرولتر PBS إلى كل أنبوب والتجانس الذباب إما باستخدام مدقة أو الخافق حبة. </ لى>
  3. لوحة جناسة على صفيحة أجار LB، إما باستخدام بلاتر دوامة أو التخفيف المتسلسل.
    1. لوحة باستخدام التخفيف المتسلسل، ونقل كل جناسة يطير إلى الصف الأول من 96 لوحة جيدا.
    2. ملء كل بئر من الصفوف المتبقية مع 90 ميكرولتر من برنامج تلفزيوني.
    3. باستخدام ماصة الأقنية، يستغرق 10 ميكرولتر من الصف الأول الذي يحتوي يطير جناسة والاستغناء في الصف الثاني.
    4. ماصة صعودا وهبوطا 10 مرات على الأقل لتخلط جيدا، ثم يستغرق 10 ميكرولتر ونقل إلى الصف الثالث. كرر هذا الإجراء باستخدام الصفوف المتبقية.
    5. بدءا من الصف السفلي (أكثر تمييع البكتيريا تعليق)، استخدام ماصة الأقنية ليستغرق 10 ميكرولتر من كل بئر ودائع على لوحة LB، مع الحرص على أن يتم الاستغناء عن عينات كبقع المنفصلة التي لا تلمس بعضها البعض. كرر حتى تم أخذ عينات من جميع الآبار من كل صف، صرف لهم حسب الترتيب التنازلي للتخفيف على لوحة LB. ترك لوحة في RT حتى غارقة البقع تماما في لوحة LB.
      ويوصى التجفيف لوحة LB لبضعة أيام في RT قبل استخدامها للتأكد من أن السائل يمتص بسهولة، والتقليل من فرص الاتصال العرضي بين البقع عينة: ملاحظة.
  4. احتضان لوحات O / N، مع الحرص على عدم كسا الأرض لوحات من المستعمرات لا تزال صغيرة ومنفصلة.
    ملاحظة: اعتمادا على درجة حرارة متوسطة النمو البكتيرية وحضانة استخدامها، قد تظهر المستعمرات المستمدة من الذاتية الأمعاء البكتيرية الذبابة في نهاية المطاف على لوحة. ومع ذلك، فإن معظم البكتيريا المستخدمة لعدوى الإمراض تنمو بشكل أسرع بكثير من الجراثيم الأمعاء على LB أجار في 37 ° C.
  5. إزالة لوحات من الحاضنة عندما نمت البكتيريا التجريبية المستعمرات مرئية (عادة 8-12 ساعة)، ولكن قبل أن تظهر ذبابة الفاكهة المستعمرات البكتيرية القناة الهضمية (حوالي 36 ساعة). لبطء البكتيريا التجريبية المتزايدة، واستخدام انتقائيةالمضادات الحيوية في أجار LB لإزالة أي مستعمرات من الجراثيم الأمعاء.
  6. حساب عدد المستعمرات لكل جناسة.
    1. لوحات لولبية، عد المستعمرات التي تنمو باستخدام عداد مستعمرة الآلية التي يمكن تقدير الحمولة الجرثومية لكل مل من جناسة على أساس عدد والموقف من المستعمرات على لوحة.
      ملاحظة: التهم لولبية أكثر دقة عندما تركيز البكتيريا هي في حدود 5 × 02-05 أكتوبر × 10 4 بكتيريا في كل مل.
    2. لوحات بقعة، عد يدويا المستعمرات لكل ذبابة من أي تخفيف يحتوي 30-300 المستعمرات وحساب عدد من البكتيريا لكل مل من جناسة الأصلي.

4. تميز الوراثة من العدوى

  1. وفيات فحص بعد الحقن.
    1. وضع الذباب المصابين والضوابط الجرحى في قوارير جديدة والحفاظ في حاضنة في درجة الحرارة المطلوبة (25 ° C مع 12:12 التركي الممتازحزب التحرير: يوصى دورة الظلام). لا تضع أكثر من 15 الذباب في قارورة واحدة كما يصبح من الصعب الاعتماد أكثر من 15 الذباب المعيشة.
    2. حساب عدد من الذباب الأحياء منهم والأموات في كل يوم، أو أكثر في كثير من الأحيان إذا كان ذلك مناسبا.
    3. من أجل الحفاظ على جودة الأغذية، والوجه الذباب على طعام جديد على جدول منتظم.
      1. إذا القارورة تحتوي على الذكور فقط، نقلها إلى قارورة جديدة كل ثلاثة أيام. إذا القارورة تحتوي على الإناث، ونقل إلى قارورة جديدة كل يومين بسبب سلالة اليرقات وإسالة الطعام، مما يزيد من خطر أن الذباب الكبار قد تتعثر ويؤدي إلى المبالغة في تقدير معدلات وفيات بسبب الإصابة.
  2. إحصائية تحليل البيانات.
    1. البقاء على قيد الحياة مؤامرة كما منحنى كابلان-ماير، وهو ما يشير إلى احتمال أن الفرد سوف البقاء على قيد الحياة لقياس حقن آخر الوقت نقطة. 18 لمنحنيات البقاء على قيد الحياة أن لا يعبرون، نفذ المقارنات الزوج الحكيم باستخدام سجل رتبة Tمؤسسة (وتسمى أيضا رف كوكس اختبار) أو إجراء تحليلات أكثر تعقيدا باستخدام نموذج المخاطر كوكس النسبي، والتي يمكن أن تتضمن العديد من العوامل وتفاعلاتها. لمنحنيات البقاء على قيد الحياة التي تعبر، إجراء تحليل كوكس طبقية. 17

5. الفحص الجرثومي تحميل ما بعد الإصابة

  1. قياس الحمولة الجرثومية.
    1. في الوقت المحدد بعد الحقن، كرر الإجراءات المستخدمة لتقييم الجرعة المعدية لتحديد الحمولة الجرثومية على مدار العدوى (انظر بروتوكول 3.3).
      ملاحظة: في حالة استخدام بلاتر دوامة، وتمييع الخليط بحيث يسقط تعليق البكتيرية ضمن مجموعة من 1000 - 100،000 بكتيرية لكل مل.
  2. تحليل البيانات.
    1. إذا الحمولة الجرثومية هو غير طبيعي، وإما تحويل البيانات لتقريب أفضل التوزيع الطبيعي أو تحليل البيانات باستخدام التحليل الإحصائي غير المعيارية (مثل مان ويتني U الاختبار). استخدام التحليل صندوق كوكس إلى fIND التحول الأمثل. سجل الطبيعية أو قاعدة -10 التحولات سجل غالبا ما تكون فعالة. 19
    2. إذا كاف يتم توزيع البيانات بشكل طبيعي وهناك اثنين فقط من العلاجات التي يتناقض، إجراء ر -test لتحديد ما إذا كان العلاجين ينتج في مختلف الأحمال البكتيرية متوسط. إذا كان هناك متغيرات التجريبية متعددة أو عوامل أخرى يحتمل أن تكون تنبؤية، استخدم تحليل التباين (ANOVA) لتحديد العوامل التي هي تنبئ كبيرة من الحمولة الجرثومية. 19

6. الفحص الترانسكربتي تفعيل الجينات الجهاز المناعي

  1. لتصور خشنا تنشيط جهاز المناعة بعد الإصابة، ويصيب الذباب المعدلة وراثيا التي تعبر عن بروتين الفلورية الخضراء (GFP) تحت سيطرة المروج من الجينات الببتيد مضادات الميكروبات كما هو موضح سابقا. 18
  2. عرض الذباب المصابين تحت المجهر مضان قادرة. وينبغي أن تصبح GFP تحريض visibلو في الدهون في الجسم في أول 6 - 10 ساعة بعد العدوى.
  3. لتقدير أكثر دقة لتنشيط جهاز المناعة، استخدم الكمي PCR في قالب كدنا] (QRT-PCR) لقياس وفرة من النصوص المضادة للجراثيم الببتيد الجين.
    ملاحظة: يمكن قياس التعبير عن الجينات المناعية في أي وقت بعد (أو قبل) إصابة. بصفة عامة، وتحريض المناعة التعبير الجيني يبدأ ما يقرب من 4 ساعات بعد الحقن والزيادات على مدى ساعة 24 القادمة.
    1. تخدير الذباب باستخدام CO 2.
    2. وضع 15 الذباب في أنبوب microfuge لكل استخراج الحمض النووي الريبي.
      ملاحظة: من المستحسن أن يجمع على الأقل ثلاث عينات تكرار لكل حالة العلاج.
    3. استخراج الحمض النووي الريبي من الذباب وتوليد [كدنا أول حبلا باستخدام أي عدد من الإجراءات المعيارية أو مجموعات تجارية. متجر RNA في -80 ° C. متجر كدنا] في -20 ° C لفترات من بضعة أسابيع وعند -80 درجة مئوية لمدة التخزين على المدى الطويل. قبل استخراج الحمض النووي الريبي، مخزن وتقع في -80 ° C.
    4. أداء الكمي PCR (QPCR) على الجينات المستهدفة من الاهتمام باستخدام [كدنا كقالب. الرجوع إلى الجدول رقم 1 لمتواليات التمهيدي لتضخيم الجينات الببتيد مضادة للجراثيم Diptericin A، Drosomycin، Defensin، Attacin A، وMetchnikowin وكذلك مراقبة التدبير المنزلي وrp49 الجين (المعروف أيضا باسم rpL32).
      ملاحظة: الجينات التي تكود الببتيدات المضادة للميكروبات Diptericin ألف وDrosomycin توفر قراءات جيدة جدا من D. البطن النشاط المناعي الناجم أساسا عن طريق IMD وتول مسارات، على التوالي. من أجل السيطرة على تباين عينة إلى عينة في الغلة RNA وكفاءة النسخ العكسي، وتوحيد التعبير مسجل الجينات المستهدفة ضد الجينات التدبير المنزلي المرجعية التي ليس من المتوقع أن تتغير مع العدوى مثل rp49 (المعروف أيضا باسم RPL التعبير 32).
    5. تحليل البيانات. <رأ>
    6. لتقريبي من الاختلافات التعبير، وحساب نسبة (SQ) قيمة كمية انطلاق الحصول عليها من الجينات اختبار (على سبيل المثال، Diptericin A) بالنسبة للقيمة SQ تم الحصول عليها من الجينات المرجعية (على سبيل المثال، rp49) لكل عينة (المحسوبة على النحو SQ - DptA / SQ - rp49). توسيع نطاق هذه النسب لعلاج مراقبة خط الأساس مثل عنصر تحكم التعامل مع غير المصابة. تعسفا تعيين مراقبة على مستوى التعبير يساوي 1.0 و تصور علاجات تجريبية عن التغيرات النسبية أضعاف. تقدير قيمة SQ لكل الجينات ضد منحنى القياسية الناتجة عن سلسلة التخفيف من المعروف كمية كدنا].
      ملاحظة: التحليل الإحصائي للنسب يمكن أن يكون معقدا، لذلك هذا النهج هو أفضل لتقريب سريع من أجل تحليل دقيق. إذا كانت فعالية PCR منخفضة، تصميم الاشعال جديدة لتحسين حركية PCR إذا كان ذلك ممكنا. ردود فعل QPCR بكفاءة شبه مثالية (الإعلانoubling من PCR المنتج كل دورة)، ودورة عتبة (C T) يمكن أن تكون بديلا عن القيمة SQ.
    7. للتجارب بسيطة مع التضخيم كفاءة على النحو الأمثل، يجوز تحليل البيانات باستخدام طريقة ΔΔC T 19 لكل عينة، طرح قيمة C T من الجين المرجعية (على سبيل المثال، rp49) من C T من الجينات اختبار (على سبيل المثال، Diptericin أ) أن تسفر عن ΔC T. ثم طرح ΔC T للتحكم أساسية من ΔC T لكل عينة تجريبية لانتاج قيمة ΔΔC T لكل عينة. هذا ΔΔC T يدل على الفوارق النسبية في مستويات التعبير الجيني بين العلاجات، حيث 2 (-ΔΔCT) يقترب من تغيير أضعاف في التعبير.
      ملاحظة: هذا التحليل يمكن أن يسيء تقدير سيئة أضعاف تغير في التعبير عن الجينات المستهدفة إذا كان PCR إما الجينات اختبار أو الإشارةالجينات لديها كفاءة منخفضة.
    8. لتحليل أكثر صرامة، وإجراء تحليل التباين (ANOVA) باستخدام التعبير المقدرة الجين الاختبار (على سبيل المثال Diptericin A) كمتغير الاستجابة والتعبير المقدرة الجين السيطرة (مثل rp49) والعوامل التجريبية الأخرى المتغيرات التفسيرية.
      ملاحظة: هذا النهج هو القوي نسبيا لعدم الكفاءة في PCR التضخيم ويسمح تحليل التصاميم التجريبية أكثر تعقيدا.

Representative Results

يوضح هذا القسم النتائج التي يمكن الحصول عليها بعد العدوى البكتيرية من ذبابة الفاكهة السوداء البطن الشكل 1 يدل على أن جرعة العدوى يختلف مع الكثافة البصرية للتعليق البكتيرية المستخدمة للحقن، وأن الجرعة تسليمها يمكن تقديرها بشكل موثوق من قبل المجانسة والطلاء الذباب على الفور بعد الحقن . كما هو موضح في الشكل 2، يمكن أن مسببات الأمراض المختلفة يسبب مستويات مختلفة من وفيات المضيف (الشكل 2A) وفيات المضيف يمكن أن يكون (الشكل 2B) تعتمد على الجرعة. الأهم من ذلك، هذا البروتوكول يسمح لأنواع مختلفة من الالتهابات التي يتعين تحقيقها: بروفيدنسيا الرتغرية يمكن أن يسبب والعدوى الفرعي قاتلة المزمن الذي لا يزال قائما لمدة 20 يوما أو أكثر (الشكل 3A). ومع ذلك، فإن الغالب أن يتم مسح البكتيريا الأخرى مثل Escerichia القولونية التي كتبها الطاير المضيف في غضون ست ساعات بعد الإصابة (الشكل 3B). تحريض على تميز الكلية المناعيةويمكن تقدير تيم من خلال عزل الحمض النووي الريبي واللاحق QRT-PCR النصوص الببتيد مضادة للجراثيم (4A الشكل وB). بالقياس ولكن أقل من الناحية الكمية، الذباب معربا عن GFP تحت سيطرة المروجين الجين الببتيد مضادات الميكروبات يمكن استخدامها لتصور تحريض الجهاز المناعي (الشكل 4C).

الشكل 1
تم حقن الجرعة المعدية تحديد الذباب مع 50 NL من تعليق البكتيرية التي تغطي مجموعة واسعة من الكثافة الضوئية (،0001-،05): الشكل 1. كانت الذباب المتجانس على الفور ومطلي لتحديد عدد من بكتيريا التي أدخلتها الحقن. الحمولة الجرثومية الأولية يرتبط بقوة مع OD الأولي حقن (ص 2 = 0.96)

الرقم 2
ترونج> الشكل 2: البقاء على قيد الحياة بعد حقن مع مسببات الأمراض البكتيرية تم حقن خمسة إلى سبعة أيام الذكور القديمة مع 50 NL إما تعليق البكتيرية أو وسائل الإعلام معقمة ومراقبتها من أجل البقاء. (A) حقنت الذباب نوع البرية مع ما يقرب من 5000 من البكتيريا واحد من ثلاثة أنواع مختلفة. معدل وفيات المضيف يعتمد بشكل كبير على الأنواع البكتيرية المستخدمة للعدوى. تم حقن (B) الذباب نوع البرية مع ثلاث جرعات مختلفة من Enterococcous البرازية - 50، 500، 5000 وبكتيريا في كل الطاير. الذباب يموت بسرعة أكبر عندما المصابة بجرعات أعلى المعدية (C) تم حقن أحد متحولة جهاز المناعة، والبرية من نوع خط السيطرة إسوي مع ما يقرب من 500 بيركولديريا الشرهة. وتظهر المقارنة البشرى تسجيل رتبة أن من النوع البري يطير يبقى العدوى أفضل بكثير من المسخ (χ 2 = 59.02، DF = 1، ص <0.0001).

FO: المحافظة على together.within صفحة = "دائما"> الشكل (3)
الرقم 3: الحمولة الجرثومية بعد حقن الذباب تم حقن مع ما يقرب من (A) 5000 P. الرتغرية (B) 3400 E. القولونية. تم تحديد الحمولة الجرثومية فورا بعد الحقن وعلى مختلف نقاط زمنية لاحقة. كل نقطة تمثل بيانات الحمولة الجرثومية من ذبابة واحدة. E. تم مسح القولونية بسرعة من المضيفين تحدى بينما P. الرتغرية استمرت للفترة المتبقية من عمر المضيف،.

الرقم 4
الرقم 4: تحريض المناعة التعبير الجيني بعد الحقن. تم حقن (A) الذباب مع 50 NL من P. PBS الرتغرية أو معقمة سواء في البطن أو الصدر، أو تركت unmanipulated جانبا من CO Diptericin تم تحديد الجينات باستخدام QRT-PCR. ورسوم بيانية (A) مستويات التعبير على أنها نسبة Diptericin يمكن الاطلاع على نص إلى نص rp49 وتوسيع نطاقها بحيث تحكم CO 2 وتعرف بأنها ذات مستوى التعبير 1. أشرطة تمثل المتوسط ​​والخطأ المعياري للنسب من كل شرط (ن = 4). يتم رسم المستويات (B) التعبير باعتبارها ΔΔCT 2 مع متوسط ​​قيمة C T من CO الذباب السيطرة 2 aesthesia تستخدم كشرط uninduced القياسية. القضبان تمثل الخطأ نفسه ومستوى ΔΔC T من كل شرط (ن = 4). في حين ليس هناك فرق في النص التعريفي بسبب موقع الحقن، والمقارنة لوحات A و B تبين كيف يمكن للطريقة ΔΔC T يحتمل المبالغة مستويات الاستقراء. (C) الذباب معربا عن GFP تحت سيطرة Diptericin حقنت A المروج مع 50 NL من P. الرتغرية (OD = 0.1)، ثم تصوير 7 أيام في وقت لاحق. تظهر لوحة GFP التعبير عن GFP في الجسم الدهون في منطقة البطن من الذباب المصابة، مشيرا إلى تفعيل Diptericin A المروج في الذباب المصابين البكتريا، ولكن ليس الرقابة حقن سائل الإعلام.

جينة إلى الأمام الاتجاه المعاكس
rp49 (وتسمى أيضا rpL32) 5 'AGGCCCAAGATCGTGAAGAA 3' 5 'GACGCACTCTGTTGTCGATACC 3'
Diptericin A 5 'GCGGCGATGGTTTTGG 3' 5 'CGCTGGTCCACACCTTCTG 3'
Drosomycin 5 'CTGCCTGTCCGGAAGATACAA 3 ' 5 'TCCCTCCTCCTTGCACACA 3'
Defensin 5 'GAGGATCATGTCCTGGTGCAT 3' 5 'TCGCTTCTGGCGGCTATG 3'
Attacin A 5 'CGTTTGGATCTGACCAAGG 3' 5 'AAAGTTCCGCCAGGTGTGAC 3'
Metchnikowan 5 'AACTTAATCTTGGAGCGATTTTTCTG 3' 5 'ACGGCCTCGTATCGAAAATG 3'

الجدول 1: كبسولة تفجير عن QRT-PCR.

Discussion

الإجراء الموضح هنا غلة العدوى الجودة الصارمة وارتفاع ذبابة الفاكهة السوداء البطن. الأمثلة يتضح تركز في المقام الأول على الإصابة بروفيدنسيا الرتغرية وE. القولونية، ولكن البروتوكول هو متكيف جدا ويمكن تطبيقها على العدوى بالبكتيريا المتنوعة على مجموعة من الشروط تربية المضيفة والصيانة.

وتفاصيل هذا النهج التجريبي الأمثل تعتمد على البكتيريا المستخدمة للعدوى، وراثى للمضيف، والظروف التجريبية الشاملة. فمن المستحسن لاختبار تجريبي أي ظروف تجريبية جديدة قبل الشروع في مشاريع أكثر طموحا. وهناك نقطة انطلاق جيدة لاختبار ثلاث جرعات العدوى على نطاق 100 أضعاف. للغاية في كثير من الأحيان أفضل عرض مسببات الأمراض الفتاكة المعدية عند تناول جرعات منخفضة جدا، بناء على أمر من 10-100 الخلايا البكتيرية في الطيران. ويمكن حقن مسببات الأمراض الأكثر اعتدالا في جرعات أعلى من حوالي 1،000 البكتيريا في فلوريداص، وغير الممرضة قد يتم حقنه بجرعات عالية مثل 10000 بكتيريا في كل الطاير. غالبا ما يكون من المفيد أن تعرف حركية العدوى الجديدة من خلال تتبع حمولة الممرض، وفيات المضيف، ونشاط الجهاز المناعي على سلسلة زمنية طولية. لأن قياس الحمولة الممرض والتعبير الجيني المضيف والمقايسات مدمرة، فمن الضروري أن تصيب الذباب متميزة في بداية التجربة في كل نقطة زمنية وهذا هو المراد قياسها.

عند اتخاذ قرار ما إذا كان استخدام الوخز بالابر أو حقن القائم على microcapillary، فمن المهم أن نلاحظ أن هناك مزايا وعيوب كل نهج. حقن الشعرية يدخل حجم السائل في الطيران، وكلاهما يزيد متواضعة ضغط الامتلاء ويدخل الأملاح أو الجزيئات الأخرى التي يتم تعليق أو الذائبة في الناقل. يتطلب حقن الشعرية أيضا الوصول إلى مرفق حقن أو شراء المعدات اللازمة. ما تستهلكه الصرف الصحي لا يتطلب أي معدات خاصة ويدخلوسائل الاعلام لا تذكر في الطيران، وعادة ما يكون أكثر كفاءة لإصابة أعداد كبيرة من الذباب. ومع ذلك، والتهابات الوخز بالابر لا تسمح مراقبة دقيقة على جرعة العدوى التي يمكن أن يتحقق مع حقن الشعرية. ركز هذا البروتوكول على جهاز حقن أن ينظم ميكانيكيا حجم الحقن، ولكن هناك أيضا أنظمة حقن استنادا نبضات منفصلة من الهواء المضغوط. 20،21 هذه هي عادة أغلى من الأجهزة واردة هنا وتتطلب معايرة نبض الهواء على كل إبرة من أجل ضمان حقن كميات ثابتة.

هناك جدلا كبيرا ولكن البيانات قليلة جدا عن كيف تصبح الذباب المصابة بشكل منتظم مع البكتيريا في البرية. بعض المحققين يفترضون أن غالبية الإصابات الطبيعية تحدث عندما ذبابة الفاكهة ابتلاع الجراثيم المسببة للأمراض والبكتيريا وبعد ذلك تمكن من الفرار القناة الهضمية لإقامة العدوى النظامية. ومع ذلك، هناك جدا الحديدالبكتيريا ث المعروفة لتكون قادرة على عبور القناة الهضمية من D. البطن، وتلك التي لديها هذه القدرة هي قاتلة للغاية لالذباب 22،23. نظرية بديلة هي التي تطير بانتظام إصابات جليدية من خلال الهروب من محاولات الافتراس فشل أو هجوم من قبل العث ectoparasitic. ويدعم هذه الفرضية من قبل مجموعة متكررة من البرية D. البطن تحمل بقع التصبغ التي تدل على الجروح تلتئم (الملاحظات غير منشورة). وقد ثبت العث لنقل العدوى البكتيرية في ذبابة الفاكهة 24 والجراح التي العث اليسار يمكن أن يصاب بشكل ثانوي عن طريق البكتيريا في عسل النحل 25. ومع ذلك، فإن تردد في طبيعة الإصابة سوس مدفوعة أو غير ذلك من الانتهازية D. البطن من خلال الخروقات بشرة غير معروف. بروتوكول الموصوفة هنا يسمح إدخال البكتيريا مباشرة في الدملمف من خلال حقن الكمي الذي يتجاوز أي حواجز الظهارية أو immu السلوكيةnity. طرق لتغذية البكتيريا الممرضة للD. وقد وصفت البطن في Vodovar وآخرون. 22 ونعمة وآخرون. 23.

العديد من أنواع البكتيريا الممرضة للحشرات تشكل مخاطر قليلة أو معدومة على صحة الإنسان، مما يسمح للباحثين للعمل معهم بشكل مريح. وعلاوة على ذلك، عدد قليل جدا من البكتيريا لديها القدرة على إصابة ذبابة الفاكهة على اتصال دون تدخل التجريبية، وبالتالي فإن خطر "وباء" انتشار العدوى البكتيرية من خلال المختبر عبر الأسطح الملوثة أو هرب الذباب بشكل عام منخفضة جدا. ومع ذلك، فإنه من المستحسن للتأكد من أن تدابير احتواء الكافية في المكان لمنع الذباب المصابة من الهرب ويسترد أي الذباب لاذوا بالفرار. يجب تجهيزه المختبر على مستوى السلامة البيولوجية يتناسب مع أن من مسببات الأمراض المستخدمة، وينبغي استخدام أفضل الممارسات القياسية في علم الأحياء الدقيقة.

وinfecti تجريبيعلى الطريقة الموصوفة هنا يسمح للأمراض المعدية من ذبابة الفاكهة السوداء البطن مع أي جرعة من أي بكتيريا التعسفي. بمجرد ثبوت العدوى، فإنه واضح ومباشر لقياس حركية انتشار البكتيريا أو التخليص، لتتبع وفيات المضيف، ومقايسة تحريض الجهاز المناعي المضيف. يمكن بسهولة الذباب المصابة التعرض للفحوصات المظهري الأخرى، بما في ذلك اختبارات الوظائف الفسيولوجية التي قد تشكل أو تكون على شكل من العدوى. الإجراءات المذكورة غير مكلفة، وتتطلب القليل نسبيا المعدات المتخصصة، وعلمت بسهولة، مما يجعلها قابلة للاستخدام في مشاريع متنوعة عبر مجموعة واسعة من البحث والتدريس مختبرات.

Materials

Name Company Catalog Number Comments
Incubator Powers Scientific, Inc DROS52SD
Paintbrush
CO2 Flypads FlyStuff 59-114
CO2 Airgas CD FG50
Drosophila rearing mix 
6 oz Square Bottom Bottles, polypropylene Genesee Scientific 32-130
Nosterile Extra Large Cotton Balls Fisher brand 22-456-882
Microscope Olympus Corporation SZ51
Drosophila Vials polystyrene VWR international 89092-720
Nosterile Large Cotton Balls Fisher brand 22-456-883
2 L flask VWR international 89000-370
Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm; VWR international 25384-302
LB Agar, Miller Difco 244520
Innoculing Loop VWR international 80094-488
Rainin Clasic Pipettes in various sizes
0.1 µl to 2 µl,
2 µl to 20 µl,
20 µl to 200 µl,
100 µl to 1,000 µl
Rainin PR-2
PR-20
PR-200
PR-1000
Micropipette tips (assorted sizes) VWR international 30128-376
53503-810
16466-008
Luria Broth Base, Miller Difco 241420
Disposable Culture Tubes Borosilicate Glass VWR international 47729-576
S-500 Orbital Shaker VWR international 14005-830
Centrifuge VWR international 37001-300
PBS pH 7.4 10X Invitrogen 70011044
SmartSpec 3000 Spectrophotometer Bio-Rad 170-2501
Semimicrovolume Cuvettes Bio-Rad 223-9955
Vertical Capillary Puller Kopf Needle Pipette Puller
3.5'' Replacement glass Capillaries for Nanojet II Drummond Sientific Company 3-000-203-G/X
Nanoject II Drummond Sientific Company 3-000-204
Forceps Fine Science Tools 11255-20
10 ml Syringe BD 309604
Mineral Oil, White, light Macron Fine Chemicals 6358-10
Minutein pins Fine Science Tools 26002-10
1.5 ml  Microcentrifuge tubes; Seal Rite USA Scientific Inc. 1615-5500
Motorized Pestle; Talboys Laboratory Stirrer Troemner 103
Talboys High Throughput Homogenizer OPS Diagnostics 930145
5/32'' Grinding Balls OPS Diagnostics GBSS 156-5000-01
Vortex Genie Scientific indurstries inc. G560
Multichannel Pipettor (10 μl - 300 μl) Sartorius 730360
WASP2 Whitley Automated Spiral Plater Microbiology International
ProtoCOL automated colony counter / plate counter/ plate reader  Microbiology International
TRIzol Life Technologies 15596-026
qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips Bio-Rad TLS0801
qPCR caps; Optical Flat 8-Cap Strips Bio-Rad TCS0803
RQ1 RNase-Free DNase Promega m610a
M-MLV Reverse Transcriptase Promega m170b
dNTPs Promega U1240
Oligo-dT IDT
 SsoAdvanced SYBR Green Supermix Bio-Rad 172-5260
CFX Connect Real-Time PCR Detection System Bio-Rad 185-5200
RNasin Ribonuclease Inhibitor Promega N2115

DOWNLOAD MATERIALS LIST

References

  1. Lemaitre, B., Hoffmann, J. The host defense of Drosophila melanogaster. Annual review of immunology. 25, 697-743 (2007).
  2. Dionne, M. S., Schneider, D. S. Models of infectious diseases in the fruit fly Drosophila melanogaster. Disease models & mechanisms. 1, (1), 43-9 (2008).
  3. Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity. 12, (5), 569-580 (2000).
  4. Ayres, J. S., Freitag, N., Schneider, D. S. Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection. Genetics. 178, (3), 1807-1815 (2008).
  5. Cronin, S. J. F., et al. Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection. Science. 325, (5938), 340-343 (2009).
  6. Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. Methods to study Drosophila immunity. Methods. (2014).
  7. Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila. Current biology CB. 16, (20), 1977-1985 (2006).
  8. McKean, K. a, Yourth, C. P., Lazzaro, B. P., Clark, A. G. The evolutionary costs of immunological maintenance and deployment. BMC evolutionary biology. 8, (1), 76 (2008).
  9. Kuo, T. -H., Pike, D. H., Beizaeipour, Z., Williams, J. A. Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish. BMC neuroscience. 11, 17 (2010).
  10. Panayidou, S., Ioannidou, E., Apidianakis, Y. Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings. Virulence. 5, (2), 253-269 (2014).
  11. Keebaugh, E. S., Schlenke, T. A. Insights from natural host–parasite interactions: The Drosophila model. Developmental & Comparative Immunology. 42, (1), 111-123 (2014).
  12. Howick, V. M., Lazzaro, B. P. Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection. BMC evolutionary biology. 14, (1), 56 (2014).
  13. Babin, A., Kolly, S., Kawecki, T. J. Virulent bacterial infection improves aversive learning performance in Drosophila. Brain, behavior, and immunity. (2014).
  14. Chambers, M. C., Song, K. H., Schneider, D. S. Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster. PLoS ONE. 7, (12), e50679 (2012).
  15. Fellous, S., Lazzaro, B. P. Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition. Molecular ecology. 19, (7), 1462-1468 (2010).
  16. Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila. PLoS pathogens. 8, (1), e1002445 (2012).
  17. Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. Thorax injury lowers resistance to infection in Drosophila melanogaster. Infection and immunity. (2014).
  18. Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. A practical guide to understanding Kaplan-Meier curves. Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143, (3), 331-336 (2010).
  19. Freeman, W. H. Biometry. (1995).
  20. Frydman, H. Wolbachia bacterial infection in Drosophila. Journal of visualized experiments JoVE. (2), 158 (2007).
  21. Kuo, T. -H., Handa, A., Williams, J. A. Quantitative measurement of the immune response and sleep in Drosophila. Journal of visualized experiments JoVE. (70), e4355 (2012).
  22. Vodovar, N., et al. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proceedings of the National Academy of Sciences of the United States of America. 102, (32), 11414-11419 (2005).
  23. Nehme, N. T., et al. A model of bacterial intestinal infections in Drosophila melanogaster. PLoS pathogens. 3, (11), e173 (2007).
  24. Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. Interspecific transmission of endosymbiotic Spiroplasma by mites. Biology. 3, (1), 23-25 (2007).
  25. Kanbar, G., Engels, W. Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites. Parasitology research. 90, (5), 349-354 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics