Sistemica infezione batterica e immunitario Difesa fenotipi in

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster. J. Vis. Exp. (99), e52613, doi:10.3791/52613 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La mosca della frutta Drosophila melanogaster è uno degli organismi modello premier per lo studio della funzione e l'evoluzione di difesa immunitaria. Molti aspetti dell'immunità innata sono conservate tra insetti e mammiferi, e dato che Drosophila può essere facilmente manipolato geneticamente e sperimentalmente, sono potenti per studiare la funzione del sistema immunitario e le conseguenze fisiologiche della malattia. La procedura permette dimostrato qui infezione di mosche dall'introduzione di batteri direttamente nella cavità del corpo, bypassando barriere epiteliali e forme più passivi di difesa e consentendo attenzione alla infezione sistemica. Il procedimento comprende i protocolli per i tassi di mortalità misurazione ospitante, carico patogeno sistemica, e il grado di induzione del sistema immunitario dell'ospite. Questa procedura infezione è poco costoso, robusto e quantitativamente ripetibile, e può essere usato in studi di genetica funzionale, storia di vita evolutiva e fisiologia.

Introduction

La mosca della frutta Drosophila melanogaster è uno degli organismi modello premier per lo studio della funzione e l'evoluzione di difesa immunitaria. Drosophila sono poco costosi e facili da dietro, sono altamente suscettibili di manipolazione sperimentale, e sono supportato da una vasta comunità scientifica che si è sviluppato un ampio serie di strumenti di ricerca. Molti aspetti dell'immunità innata sono conservate tra insetti e mammiferi, tra cui trasduzione del segnale mediata da recettori Toll-like e NF-kB fattori di trascrizione della famiglia, di segnalazione JAK / STAT, e le risposte via di JNK. 1,2 La funzione di questi geni e vie can essere interrogato in D. melanogaster con mutazioni o RNAi abbattimenti che le attività di aumentare o diminuire pathway. 3 - 6 Inoltre, Drosophila può essere usato per studiare le conseguenze fisiologiche della infezione e la malattia, anche nel contesto della teoria evoluzionistica storia di vita 7.- 9 Tutti questi studi, tuttavia, dipendono dalla capacità di infettare in modo affidabile le mosche sperimentali in condizioni di trattamento definite. La procedura qui descritta presenta un quadro metodologico per la consegna di infezioni batteriche resistenti e ripetibili di Drosophila melanogaster e successivamente misurare infezione gravità e quantificare la risposta immunitaria.

Drosophila può essere naturalmente e sperimentalmente infettato da una grande varietà di parassiti e patogeni, tra cui batteri, funghi, virus, nematodi e vespe parassitoidi. Il protocollo attuale è focalizzata sulla fornitura di un'infezione batterica sistemica. Molti batteri differenti possono essere utilizzati per infettare le mosche, e la scelta dello sperimentatore dovrebbero essere basati sulle precise questioni scientifiche essere chiesto. Ad esempio, isolati clinici umani possono essere impiegati per studiare i meccanismi di virulenza batterica 10, o ecologicamente pertinenti isolati possono essere preferite lad per lo studio evolutivo. 11 Alcuni batteri sono patogeni competenti di D. melanogaster, proliferando su infezioni e che causa la malattia di accoglienza o la morte. Altri batteri sono effettivamente gestiti dal sistema immunitario ospite e cancellati entro pochi giorni. In questa dimostrazione, Providencia rettgeri sarà utilizzato come un agente patogeno proliferativa che può causare la mortalità ospitante e persiste in hosts sopravvissuti. Escherichia coli viene utilizzata come non patogeno che viene eliminato dal sistema immunitario dell'ospite.

Infezione sarà stabilito dalla introduzione di batteri direttamente nella cavità del corpo della mosca. Questo approccio bypassa barriere epiteliali e comportamenti protettivi, consentendo indagini di infezione sistemica indipendentemente dal modo naturale della trasmissione. Ci sono due metodi principali per stabilire sperimentalmente infezione sistemica. Nel primo, un nanoinjector e capillare di vetro tirato aghi sono usati per iniettare un numero preciso dibatteri nel volo. Questo metodo ha il vantaggio di consentire una vasta gamma dinamica di dosi infettive e di essere quantitativamente altamente ripetibili. Il secondo approccio è quello di fornire l'infezione con una puntura di spillo settico. Questo approccio ha il vantaggio di essere rapida e non richiede attrezzature speciali. Una volta che le infezioni sono stabiliti, diventa possibile misurare il carico sistemico patogeno, la mortalità host e l'attività inducibile sistema immunitario. Naturalmente, qualsiasi numero di fenotipi supplementari potrebbe concepibilmente essere misurata in infetto D. melanogaster, anche post-infezione fecondità 12, la capacità di apprendimento 13, stato metabolico 14, o per qualsiasi altra caratteristica che si possa immaginare.

Protocol

1. Raccogliere e preparare Flies

  1. D. posteriore melanogaster nelle condizioni sperimentali desiderati. Fare attenzione a non affollare linea durante l'allevamento e fare in modo che le densità larvali sono coerenti tra i trattamenti, dal momento che le condizioni ambientali durante la fase larvale può influenzare profondamente fenotipi di difesa immunitaria durante la fase adulta. 15
  2. Raccogliere mosche sperimentali 0-3 giorni dopo eclosion dal caso pupa e trasferirli su terreno fresco.
  3. Casa in linea raccolti alla temperatura desiderata (temperatura compresa tra 22 ° C e 28 ° C sono generalmente adatte) fino a quando non sono di età 5-7 giorni dopo eclosion.
    NOTA: In questo modo il tempo necessario per le mosche per completare la metamorfosi e diventare adulti maturi, ma è ben prima che inizi la senescenza.
  4. Ordinare il numero desiderato di mosche in un flacone separato prima di infezione, di nuovo facendo attenzione a evitare il sovraffollamento.
    NOTA: solo MAles sono infettati in questa dimostrazione, ma è ugualmente possibile infettare femmine utilizzando la procedura descritta.

2. Cultura e preparare batteri

  1. Preparare un piatto principale dei batteri scelti almeno 2 giorni prima della infezione. Streak i batteri da un stock di glicerolo 15% conservati indefinitamente a -80 ° C. Conservare il piatto principale a 4 ° C per un massimo di due settimane. Sempre striscia le piastre di master direttamente dal congelato stock di glicerolo. Evitare il passaggio in serie di batteri da lastra a lastra, come passaggio ripetuto in cultura può portare i batteri ad evolversi virulenza attenuata.
    NOTA: Questo esempio fa uso di Providencia rettgeri ed Escherichia coli.
  2. Utilizzare la seguente procedura per preparare una sospensione batterica iniettabile.
    1. Grow coltura di 2 ml di batteri inoculando mezzo sterile con una singola colonia isolata dalla piastra master. Crescere i batteri a fase stazionaria (ad esempio, NOTA: Entrambi P. rettgeri ed E. coli crescono bene in Luria Broth a temperature 20-37 ° C agitando delicatamente.
    2. Una volta che la cultura ha raggiunto la fase stazionaria, pellet delicatamente le cellule da ca. 600 ml di cultura in una centrifuga da tavolo (3 min a 5.000 xg), scartare il surnatante e risospendere i batteri in ca. 1,000 ml di soluzione salina tamponata di fosfato sterile (PBS; 137 mM NaCl, 2,7 mM KCl, 10 mM Na 2 PO 4, 1.8 mM KH 2 PO 4, pH = 7,4).
    3. Diluire le cellule risospese in PBS sterile per ottenere una densità ottica (OD) appropriati per il batterio utilizzato, misurata con uno spettrofotometro l'assorbanza a 600 nm. Con tale sospensione per infettare le mosche.
      NOTA: A 600 = 0,1 o 1,0 corrisponde rispettivamente a circa 10 e 8 10 9 Providencia rettgeri o E. coli per ml. Perché entrambi vivono unand batteri morti contribuiscono alla densità ottica, è importante raccogliere culture presto fase stazionaria prima cadaveri batteriche accumulano e falsare la relazione tra la densità ottica e il numero di batteri vitali introdotte durante l'infezione.

3. Infettare le mosche

NOTA: Come Drosophila immunità è influenzata dal ritmo circadiano, è importante eseguire le infezioni in un momento simile di giorno in tutto replicati sperimentali 16.

3.1) Con un Nanoinjector

  1. Preparare gli aghi di vetro per l'infezione.
    1. Preparare un ago di vetro tirando un capillare di vetro borosilicato con un estrattore micropipetta.
    2. Utilizzando pinze, rompere la punta dell'ago per creare un'apertura di circa 50 micron di diametro per permettere l'espulsione di liquido.
  2. Montare l'iniettore.
    1. Posizionare la guarnizione O-ring e poi la sp biancoacer (grande fossetta rivolta verso l'esterno) sul pistone di metallo.
    2. Riempire l'ago di vetro con olio minerale con una siringa con un ago da 30 G.
    3. Mettere l'ago di vetro riempito attraverso il collare e quindi inserire l'O-ring grande attorno alla sua base, circa 1mm dalla punta smussata dell'ago.
    4. Far scorrere l'ago sulla stantuffo di metallo e avvitare delicatamente sul colletto fino sicura.
    5. Estrarre maggior parte dell'olio minerale dall'iniettore, ma assicurarsi che non vi è ancora una piccola quantità di olio in dell'ago di agire come una barriera tra l'iniettore e la sospensione batterica. Assicurarsi che non vi siano bolle d'aria all'interno della olio minerale o sospensione batterica, oppure tra i due liquidi.
    6. Impostare l'iniettore al volume desiderato per l'iniezione (tra 9 e 50 nl nl).
  3. Generare ferendo controlli.
    1. Riempire l'ago iniettore con PBS sterile inserendo con attenzione la punta dell'ago in un tubo capillare dei media e pressil tasto "fill" sull'iniettore.
      NOTA: Sterile terreni di crescita batterica può essere utilizzato anche un controllo ferendo se l'esperimento richiede iniezione di batteri in sospensione nel loro mezzo di crescita. Tuttavia, perché i media crescita batterica contiene componenti che possono stimolare il sistema immunitario o avere altri effetti sull'ospite, un vettore inerte come PBS è preferibile.
    2. Anestetizzare il numero desiderato di mosche sotto un flusso luminoso di CO 2.
    3. Iniettare linea nell'addome anteriore sulla superficie ventrolaterale con la PBS sterile.
      NOTA: È anche possibile iniettare mosche in altri siti, come la piastra sternopleural del torace, ma è importante mantenere il sito di iniezione costante all'interno di ogni esperimento 17.
    4. Mettere mosche iniettati in fiale fresche con nuovo mezzo, ponendo le fiale dalla loro parte fino a quando tutte le mosche hanno recuperato dalla anestesia per evitare che le mosche di diventare bloccato al cibo. <br /> Nota: Si raccomanda di iniettare in linea di controllo PBS prima di iniettare batteri di mosche sperimentali così lo stesso ago può essere utilizzato per entrambi i trattamenti. Non sarà sempre possibile utilizzare lo stesso ago per un intero esperimento. In tal caso, può essere desiderabile per registrare quale ago è stato utilizzato con cui mosche e includere identità ago come un fattore sperimentale nell'analisi statistica.
  4. Iniettare l'agente patogeno batterico.
    1. Espellere i restanti mezzi sterile dall'iniettore e riempire lo stesso ago con la sospensione di batteri.
    2. Ripetere la procedura di cui sopra (3.1.3), ora l'iniezione in linea con la sospensione batterica preparato in procedura 2.2.

3.2) Con Septic Pinprick

  1. Preparare l'ago per puntura.
    1. Sciogliere il fine di una punta micropipetta 200 microlitri e inserire un perno insetto minutien 0,15 millimetri nella plastica fusa. Lasciare che la plastica solidificare such che il perno è tenuto in posizione con circa 0,5 cm di perno che si estende dalla plastica.
  2. Generare ferendo controlli.
    1. Anestetizzare il numero desiderato di mosche sotto un flusso luminoso di CO 2.
    2. Bucherellare linea nella piastra sternopleural del torace con l'ago, evitando i siti di fissaggio delle ali e le gambe. Se necessario, rimuovere delicatamente le mosche dal perno minutien con pinze morbide.
      NOTA:. E 'anche possibile per pungere linea in altri siti, come l'addome anteriore sulla superficie ventrolaterale, ma è importante mantenere il sito di iniezione costante all'interno di ciascun esperimento 17 pizzicore attraverso la cuticola dell'addome tende ad essere più difficile di puntura del torace ed è quindi meno comune.
    3. Mettere in linea dritte in un flaconcino fresco con nuovo mezzo mosca, posa la fiala sul suo lato fino a quando tutti i mosche hanno recuperato dalla anestesia per evitare che le mosche bevenendo attaccato al cibo.
  3. Introdurre l'infezione batterica.
    1. Anestetizzare il numero desiderato di mosche sotto un flusso luminoso di CO 2.
    2. Prick ogni volano nella stessa posizione i controlli multimediali, immergendo la punta del perno nella sospensione batterica preparato in procedura 2.2 prima puntura ogni mosca.
    3. Mettere in linea dritte in un flaconcino fresco con nuovo mezzo mosca, posa la fiala sul suo lato fino a quando tutti i mosche hanno recuperato dalla anestesia per evitare che le mosche di diventare bloccato al cibo.

3.3) Valutare il infettiva dose erogata

  1. Infettare una serie di mosche come sopra descritto in entrambe le procedure 3.1 o 3.2, solo che invece di restituire i mosche al cibo fiala di recuperare da anestesia, collocare ogni volare in una provetta su ghiaccio.
  2. Aggiungere 250 microlitri di PBS in ogni provetta e omogeneizzare in linea sia con un pestello o un battitore tallone. </ Li>
  3. Piatto l'omogeneizzato su una piastra di agar LB, sia utilizzando un placcatore spirale o una diluizione seriale.
    1. Per piastra con diluizione seriale, trasferire ogni omogeneizzato volo per la prima fila di una piastra ben 96.
    2. Riempire ciascun pozzetto delle rimanenti righe con 90 ml di PBS.
    3. Utilizzando una pipetta multicanale, prendere 10 ml dalla prima riga contenente volare omogeneizzato ed erogare in seconda fila.
    4. Pipetta su e giù per almeno 10 volte per mescolare accuratamente, e poi prendere 10 ml e trasferire alla terza fila. Ripetere questa procedura utilizzando le righe rimanenti.
    5. A partire dalla prima fila in basso (più diluito batteri sospensione), utilizzare la pipetta multicanale a prendere 10 ml di ogni bene e di deposito su una piastra LB, facendo attenzione che i campioni vengano erogate come macchie distinte che non si toccano l'un l'altro. Ripetere l'operazione fino a quando tutti i pozzetti sono stati campionati per ogni fila, li medicinale, al fine di diluizione decrescente sulla piastra LB. Lasciare la piastra a temperatura ambiente fino a quando le macchie sono completamente inzuppato nella piastra LB.
      NOTA: Essiccamento piastra LB per alcuni giorni a temperatura ambiente prima dell'uso si raccomanda di assicurare che il liquido viene facilmente assorbito, minimizzando la possibilità di contatto accidentale tra punti campione.
  4. Incubare le piastre O / N, facendo attenzione a non invadere i piatti così colonie rimangono piccolo e discreto.
    NOTA: A seconda del mezzo di crescita e di incubazione di temperatura batterico usato, colonie derivate da endogena flora intestinale della mosca possono finalmente apparire sul piatto. Tuttavia, la maggior parte dei batteri usati per l'infezione patogena crescono molto più velocemente della flora intestinale su LB agar a 37 ° C.
  5. Rimuovere le piastre dal termostato quando i batteri sperimentali sono cresciute colonie visibili (in genere 8-12 ore), ma prima di Drosophila colonie gut microbiota appaiono (circa 36 ore). Per crescita lenta batteri sperimentali, utilizzare un selettivoantibiotico nel agar LB per rimuovere eventuali colonie dalla flora intestinale.
  6. Contare il numero di colonie per ogni omogeneizzato.
    1. Per piastre a spirale, contare le colonie che crescono usando un contatore di colonie automatizzato che può stimare la carica batterica per ml di omogenato in base al numero e la posizione delle colonie sulla piastra.
      NOTA: conta spirale sono più accurate quando la concentrazione batterica è nell'intervallo di 5 x 02-5 ottobre x 10 4 batteri per ml.
    2. Per le lastre piatte, contare manualmente le colonie per ogni volo da qualsiasi diluizione contiene 30-300 colonie e calcolare il numero di batteri per ml di omogenato originale.

4. Caratterizzare Survivorship di infezione

  1. Mortalità Assay post-iniezione.
    1. Inserire mosche infetti e controlli feriti in fiale freschi e mantenere in termostato a una temperatura desiderata (25 ° C con un 12:12 ligHT: è consigliato ciclo scuro). Non mettere più di 15 mosche in un singolo flaconcino come diventa difficile contare più di 15 mosche viventi.
    2. Contare il numero di vivi e morti mosche ogni giorno, o più frequentemente se necessario.
    3. Al fine di mantenere la qualità del cibo, capovolgere le mosche al nuovo cibo a intervalli regolari.
      1. Se il flacone contiene solo i maschi, trasferirli fiale fresche ogni tre giorni. Se il flacone contiene femmine, trasferimento fiale freschi ogni due giorni perché la progenie larvale si liquefare il cibo, aumentando il rischio che le mosche adulte possono bloccarsi e conseguente tassi sopravvalutato di mortalità a causa di un'infezione.
  2. Statisticamente analizzare i dati.
    1. Sopravvivenza Plot come una curva di Kaplan-Meier, che indica la probabilità che un individuo sopravviverà ad un time-point dopo l'iniezione misurato. 18 Per le curve di sopravvivenza che non attraversano, eseguire confronti a coppie con un log-rank Test (chiamato anche Mantel Cox Test) o di eseguire analisi più complesse utilizzando un Cox proporzionale pericoli del modello, che può comprendere diversi fattori e le loro interazioni. Per le curve di sopravvivenza che attraversano, eseguire un'analisi stratificata Cox. 17

5. prova batterica carico post-infezione

  1. Misurare carica batterica.
    1. Ad una post-iniezione tempo prescritto, ripetere la procedura usata per valutare la dose infettiva di determinare carica batterica nel corso dell'infezione (vedi protocollo 3.3).
      NOTA: Se si utilizza il plater spirale, diluire omogenati in modo che la sospensione batterica rientra in un intervallo di 1.000 - 100.000 batterica per ml.
  2. Analizzare i dati.
    1. Se carica batterica non è normale, o trasformare i dati per approssimare meglio una distribuzione normale o analizzare i dati utilizzando non parametrico analisi statistica (ad esempio test di Mann-Whitney). Utilizzare una analisi Box-Cox per find la trasformazione ottimale; logaritmo naturale o di base -10 trasformazioni di registro sono spesso efficaci. 19
    2. Se i dati sono sufficientemente distribuiti normalmente e ci sono solo due trattamenti contrastato, eseguire un t-test per determinare se i due trattamenti determinano differenti cariche batteriche medi. Se ci sono più variabili sperimentali o ad altri fattori potenzialmente predittivi, usare analisi della varianza (ANOVA) per determinare quali fattori sono predittori significativi di carica batterica. 19

6. Tenore trascrizionale attivazione di geni del sistema immunitario

  1. Per visualizzare grossolanamente attivazione immunitaria dopo l'infezione, infettare moscerini transgenici che esprimono la proteina fluorescente verde (GFP) sotto il controllo di un promotore di un gene peptide antimicrobico come precedentemente descritto. 18
  2. Guarda le mosche infette sotto un microscopio a fluorescenza con capacità; Induzione GFP dovrebbe diventare visible nel corpo grasso all'interno del primo 6 - 10 da ore dopo l'infezione.
  3. Per la quantificazione più precisa di attivazione del sistema immunitario, utilizzare la PCR quantitativa cDNA (qRT-PCR) per misurare l'abbondanza di antimicrobici trascritti genici peptide.
    NOTA: L'espressione dei geni immunitari può essere misurato in qualsiasi momento dopo (o prima) infezione. In generale, l'induzione dell'espressione genica immunitario inizia circa 4 ore dopo l'iniezione e aumenta nel prossimo 24 hr.
    1. Anestetizzare le mosche con CO 2.
    2. Mettere 15 mosche in una provetta per microcentrifuga per ogni estrazione di RNA.
      NOTA: Si raccomanda di raccogliere almeno tre campioni replicati per ogni condizione di trattamento.
    3. Estrarre RNA dalle mosche e generare cDNA primo filamento utilizzando qualsiasi di una serie di procedure standard o kit commerciali. Conservare l'RNA a -80 ° C. Conservare cDNA a -20 ° C per periodi di alcune settimane ed a -80 ° C per una conservazione a lungo termine. Prima di estrazione di RNA, negozio fsi trova a -80 ° C.
    4. Eseguire la PCR quantitativa (qPCR) su geni bersaglio di interesse utilizzando il cDNA come modello. Fare riferimento alla Tabella 1 per le sequenze dei primer per amplificare i geni peptidi antibatterici Diptericin A, Drosomycin, defensin, Attacin A, e Metchnikowin così come il rp49 gene di controllo housekeeping (noto anche come rpL32).
      NOTA: I geni che codificano per i peptidi antimicrobici Diptericin A e Drosomycin forniscono ottime letture di D. melanogaster attività immunitaria indotta principalmente attraverso le vie IMD e Toll, rispettivamente. Per controllare per campione a campione variazione resa RNA e l'efficienza della trascrizione inversa, uniformare l'espressione di geni bersaglio registrata contro un gene housekeeping riferimento la cui espressione non dovrebbe cambiare con infezioni quali rp49 (noto anche come Rpl 32).
    5. Analizzare i dati. <ol>
    6. Per approssimazione di differenze di espressione, calcolare il rapporto della (SQ) valore di quantità di partenza ottenuto dal gene di prova (ad esempio, Diptericin A) rispetto al valore SQ ottenuto dal gene di riferimento (ad esempio, rp49) per ciascun campione (calcolata come SQ - DPTA / SQ - rp49). Scala questi rapporti ad un trattamento di controllo di base, come un controllo di gestione non infetto. Arbitrariamente impostare il livello di espressione di controllo pari a 1,0 e visualizzare trattamenti sperimentali come cambiamenti volte rispetto. Stimare il valore di SQ per ogni gene contro una curva standard generata da una serie di diluizioni di nota-quantità cDNA.
      NOTA: L'analisi statistica dei rapporti può essere complicato, per cui questo approccio è meglio per approssimazione rapido che per un'analisi rigorosa. Se l'efficienza della PCR è bassa, di progettare nuovi primer per migliorare la cinetica PCR, se possibile. Per le reazioni qPCR con quasi perfetta efficienza (adoubling del prodotto di PCR ogni ciclo), il ciclo di soglia (C T) può essere sostituito per il valore SQ.
    7. Per gli esperimenti semplici con amplificazione ottimale efficiente, i dati possono essere analizzati utilizzando il metodo ΔΔC T. 19 Per ogni campione, sottrarre il valore C T del gene di riferimento (ad esempio, rp49) dalla C T del gene prova (per esempio., Diptericin A) fino ad ottenere una ΔC T. Poi sottrarre la ΔC T del controllo di base dalla ΔC T per ciascun campione sperimentale per produrre un valore ΔΔC T per ogni campione; questo ΔΔC T è indicativa di relativi differenze nei livelli di espressione genica tra i trattamenti, dove 2 (-ΔΔCT) approssima la variazione piega espressione.
      NOTA: Questa analisi può gravemente misestimate ribaltabile cambiamento nell'espressione del gene bersaglio se la PCR sia del gene test o il riferimentogene ha una bassa efficienza.
    8. Per l'analisi più rigorosa, condurre analisi della varianza (ANOVA) utilizzando l'espressione stimato del gene prova (per esempio Diptericin A) come variabile di risposta e l'espressione stimata del gene di controllo (ad esempio rp49) e altri fattori sperimentali come variabili esplicative.
      NOTA: Questo approccio è relativamente robusta di inefficienza in PCR e consente l'analisi di disegni sperimentali più complicate.

Representative Results

Questa sezione illustra i risultati ottenibili dopo l'infezione batterica di Drosophila melanogaster. La Figura 1 mostra quella dose infezione varia con la densità ottica della sospensione batterica utilizzato per l'iniezione, e che la dose erogata può essere attendibilmente stimato omogeneizzazione e placcatura vola immediatamente dopo l'iniezione . Come illustrato in figura 2, diversi agenti patogeni possono causare diversi livelli di mortalità host (figura 2A) e mortalità ospitante può essere dose-dipendente (Figura 2B). È importante sottolineare che questo protocollo consente diversi tipi di infezioni da raggiungere: Providencia rettgeri può causare un'infezione cronica, subletale che persiste per 20 giorni o più (Figura 3A). Tuttavia, altri batteri come Escerichia coli saranno per lo più cancellati dalla mosca ospitante entro sei ore dopo l'infezione (Figura 3B). Induzione di sys immunitarioTEM può essere stimata attraverso l'isolamento di RNA e la successiva qRT-PCR dei trascritti peptidi antibatterici (Figura 4A e B). Analogamente ma meno quantitativamente, mosche esprimendo GFP sotto il controllo del peptide antimicrobico promotori genici può essere utilizzato per visualizzare l'induzione del sistema immunitario (Figura 4C).

Figura 1
. Figura 1: Determinazione Infectious Dose mosche sono stati iniettati con 50 nl di sospensioni batteriche che coprono una gamma di densità ottiche (,0001-,05). Le mosche erano immediatamente omogeneizzati e piastrate per determinare il numero di batteri introdotto dalla iniezione. Carica batterica iniziale è strettamente correlato con OD iniziale iniettato (r 2 = 0,96)

Figura 2
(A) mosche wild type sono stati iniettati con circa 5.000 batteri di una delle tre specie diverse. Il tasso di mortalità di accoglienza dipende in larga misura dalla specie batterica usati per l'infezione. (B) mosche wild type sono stati iniettati con tre diverse dosi di Enterococcous faecalis - 50, 500 e 5.000 batteri per volare. Le mosche muoiono più rapidamente quando infettati con dosi superiori infettive (C) Un mutante del sistema immunitario e la sua wild-type linea di controllo isogenico sono stati iniettati con circa 500 Burkholderia cepacia. Un confronto Log-Rank coppie dimostra che la wild-type fly sopravvive l'infezione significativamente migliore rispetto al mutante (χ 2 = 59,02, df = 1, p <0,0001).


Figura 3:. Carica batterica dopo iniezione mosche sono state iniettate con circa il (A) 5000 P. rettgeri (B) 3.400 E. coli. Carica batterica è stata determinata immediatamente dopo l'iniezione e in vari punti temporali successivi. Ciascun punto di dati rappresenta la carica batterica di una mosca. E. coli è rapidamente eliminato da host sfidato mentre P. rettgeri persiste per il resto della vita dell'ospite ,.

Figura 4
Figura 4: Induzione immunitario genica dopo l'iniezione. (A) Le mosche sono stati iniettati con 50 nl di P. rettgeri o PBS sterile sia nel torace, o sono stati lasciati non manipolata a parte CO Diptericin Un gene è stato determinato utilizzando qRT-PCR. (A) I livelli di espressione sono rappresentati graficamente come rapporto tra Diptericin Una trascrizione di rp49 trascrizione e scalato in modo tale che il controllo CO 2 è definito come aventi un livello di espressione di 1. Le barre rappresentano la media e l'errore standard di rapporti da ciascuna condizione (n = 4). Livelli (B) di espressione vengono rappresentati graficamente come ΔΔCT 2 con il valore medio C T da CO 2 aesthesia linea di controllo utilizzati come condizione uninduced standard. Le barre rappresentano l'errore medio e standard ΔΔC T da ciascuna condizione (n = 4). Mentre non vi è alcuna differenza di induzione trascrizione causa al sito di iniezione, il confronto di pannelli A e B mostra come il metodo ΔΔC T può potenzialmente sovrastimare i livelli di induzione. (C) Vola esprimono GFP sotto il controllo del Diptericin Un promotore sono stati iniettati con 50 nl di P. rettgeri (OD = 0,1) e poi ripreso sette giorni più tardi. Il pannello GFP mostra l'espressione di GFP nel corpo grasso addominale di mosche infette, indicando l'attivazione della Diptericin Un promotore in linea con infezione da batteri, ma non controlli multimediali a iniezione.

Gene Avanti Reverse
rp49 (chiamato anche rpL32) 5 'AGGCCCAAGATCGTGAAGAA 3' 5 'GACGCACTCTGTTGTCGATACC 3'
Diptericin A 5 'GCGGCGATGGTTTTGG 3' 5 'CGCTGGTCCACACCTTCTG 3'
Drosomycin 5 'CTGCCTGTCCGGAAGATACAA 3 ' 5 'TCCCTCCTCCTTGCACACA 3'
Defensin 5 'GAGGATCATGTCCTGGTGCAT 3' 5 'TCGCTTCTGGCGGCTATG 3'
Attacin A 5 'CGTTTGGATCTGACCAAGG 3' 5 'AAAGTTCCGCCAGGTGTGAC 3'
Metchnikowan 5 'AACTTAATCTTGGAGCGATTTTTCTG 3' 5 'ACGGCCTCGTATCGAAAATG 3'

Tabella 1: Primer per qRT-PCR.

Discussion

La procedura qui descritta produce infezione qualità rigoroso e alto di Drosophila melanogaster. Gli esempi illustrati concentrati principalmente sulla infezione da Providencia rettgeri ed E. coli, ma il protocollo è altamente adattabile e può essere applicato alle infezioni con diversi batteri su una gamma di condizioni di allevamento host e manutenzione.

I dettagli di un approccio sperimentale ottimale dipenderà batterio utilizzato per l'infezione, il genotipo dell'ospite, e le condizioni sperimentali generali. E 'fortemente raccomandato di test pilota eventuali nuove condizioni sperimentali prima di avviare i progetti più ambiziosi. Un buon punto di partenza è quello di testare tre dosi di infezione in un range di 100 volte. Altamente patogeni virulenti sono spesso meglio introdotti a dosi infettive molto bassi, dell'ordine di 10 - 100 cellule batteriche per mosca. Gli agenti patogeni più moderati possono essere iniettati in dosi più elevate di circa 1.000 batteri per fly, e non gli agenti patogeni possono essere iniettati in dosi fino a 10.000 batteri per volare. Spesso è istruttivo definire le cinetiche di infezioni nuovi tracciando carico patogeno, la mortalità host e l'attività del sistema immunitario su una serie temporale longitudinale. Poiché la misura del carico patogeno e l'espressione genica ospitante sono prove distruttive, è necessario per infettare le mosche distinti fin dall'inizio dell'esperimento per ogni punto di tempo che deve essere misurato.

Al momento di decidere se utilizzare puntura di spillo o iniezione a base microcapillare-, è importante notare che ci sono vantaggi e limitazioni di ogni approccio. Iniezione capillare presenta un volume di liquido nella mosca, che sia modestamente aumenta la pressione turgore e introduce sali o altre molecole che sono sospesi o disciolti nel veicolo. Iniezione capillare richiede anche l'accesso ad un impianto di iniezione o l'acquisto delle attrezzature necessarie. Pinprick Septic non richiede attrezzature speciali e introducesupporti trascurabili nel volo, ed è in genere più efficace per infettare un gran numero di mosche. Tuttavia, le infezioni puntura di spillo non consentono il controllo preciso dosaggio infezione che può essere raggiunto con iniezione capillare. Il presente protocollo focalizzata su un apparato di iniezione che regola meccanicamente volume di iniezione, ma ci sono anche sistemi di iniezione a base di impulsi discreti di aria pressurizzata. 20,21 Questi sono in genere più costosi dei apparecchiatura descritta qui e richiedono la calibrazione dell'impulso aria per ciascun aghi per garantire volumi di iniezione coerenti.

Vi è un ampio dibattito, ma pochissimi dati su come le mosche diventano sistemica infettati con i batteri in natura. Alcuni ricercatori ipotizzano che la maggior parte delle infezioni naturali si verificano quando Drosophila ingerire batteri patogeni e batteri sono successivamente in grado di sfuggire l'intestino per stabilire una infezione sistemica. Tuttavia, ci sono molto few batteri noti per essere in grado di attraversare l'intestino di D. melanogaster, e quelli che hanno questa capacità sono altamente letale per le mosche 22,23. Una teoria alternativa è che vola regolarmente subire lesioni cuticolari attraverso fuga dai tentativi di predazione falliti o attacco di acari ectoparassiti. Questa ipotesi è supportata dalla raccolta frequente di selvaggio D. melanogaster recanti macchie melanizzazione che sono indicativi delle ferite guarite (osservazioni non pubblicate). Gli acari sono stati indicati per la trasmissione di infezioni batteriche in Drosophila 24 e le ferite lasciate da acari possono essere secondariamente infettato da batteri nelle api 25. Tuttavia, la frequenza naturale di infezione acari-driven o altrimenti opportunistica di D. melanogaster attraverso violazioni cuticola non è noto. Il protocollo qui descritto consente l'introduzione di batteri direttamente nella emolinfa attraverso l'iniezione quantitativa che bypassa le barriere epiteliali o Immu comportamentalicomunitario. Metodi per alimentare i batteri patogeni a D. melanogaster sono stati descritti in Vodovar et al. 22 e Nehme et al. 23.

Molti batteri entomopatogeni rappresentano poco o nessun rischio per la salute umana, consentendo ai ricercatori di lavorare con loro in modo confortevole. Inoltre, molto pochi i batteri hanno la capacità di infettare Drosophila in contatto senza intervento sperimentale, per cui il rischio di diffusione "epidemica" di infezione batterica attraverso un laboratorio di via superfici contaminate o fuggiti mosche è generalmente molto basso. Tuttavia, è opportuno garantire che adeguate misure di contenimento sono in atto per evitare che le mosche infette di fuggire e per riconquistare qualsiasi mosche sfuggito. Il laboratorio deve essere attrezzato ad un livello di sicurezza biologica commisurata a quella dei patogeni in uso, e migliori pratiche standard in microbiologia deve essere impiegato.

Il infecti sperimentaleil metodo qui descritto permette di infezioni di Drosophila melanogaster, con qualsiasi dosaggio di qualsiasi batterio arbitrario. Una volta che l'infezione è stata stabilita, è semplice per misurare la cinetica di proliferazione batterica o di liquidazione, per monitorare la mortalità di accoglienza, e di saggiare l'induzione del sistema immunitario dell'ospite. Mosche infetti possono essere facilmente sottoposti ad altri test fenotipici, compresi i test di funzioni fisiologiche che possono modellare o essere modellati dal infezione. Le procedure descritte sono poco costosi, richiedono relativamente poco attrezzature specializzate, e sono facilmente apprese, che li rende suscettibili per l'utilizzo in diversi progetti attraverso una larghezza di laboratori di ricerca e di insegnamento.

Materials

Name Company Catalog Number Comments
Incubator Powers Scientific, Inc DROS52SD
Paintbrush
CO2 Flypads FlyStuff 59-114
CO2 Airgas CD FG50
Drosophila rearing mix 
6 oz Square Bottom Bottles, polypropylene Genesee Scientific 32-130
Nosterile Extra Large Cotton Balls Fisher brand 22-456-882
Microscope Olympus Corporation SZ51
Drosophila Vials polystyrene VWR international 89092-720
Nosterile Large Cotton Balls Fisher brand 22-456-883
2 L flask VWR international 89000-370
Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm; VWR international 25384-302
LB Agar, Miller Difco 244520
Innoculing Loop VWR international 80094-488
Rainin Clasic Pipettes in various sizes
0.1 µl to 2 µl,
2 µl to 20 µl,
20 µl to 200 µl,
100 µl to 1,000 µl
Rainin PR-2
PR-20
PR-200
PR-1000
Micropipette tips (assorted sizes) VWR international 30128-376
53503-810
16466-008
Luria Broth Base, Miller Difco 241420
Disposable Culture Tubes Borosilicate Glass VWR international 47729-576
S-500 Orbital Shaker VWR international 14005-830
Centrifuge VWR international 37001-300
PBS pH 7.4 10X Invitrogen 70011044
SmartSpec 3000 Spectrophotometer Bio-Rad 170-2501
Semimicrovolume Cuvettes Bio-Rad 223-9955
Vertical Capillary Puller Kopf Needle Pipette Puller
3.5'' Replacement glass Capillaries for Nanojet II Drummond Sientific Company 3-000-203-G/X
Nanoject II Drummond Sientific Company 3-000-204
Forceps Fine Science Tools 11255-20
10 ml Syringe BD 309604
Mineral Oil, White, light Macron Fine Chemicals 6358-10
Minutein pins Fine Science Tools 26002-10
1.5 ml  Microcentrifuge tubes; Seal Rite USA Scientific Inc. 1615-5500
Motorized Pestle; Talboys Laboratory Stirrer Troemner 103
Talboys High Throughput Homogenizer OPS Diagnostics 930145
5/32'' Grinding Balls OPS Diagnostics GBSS 156-5000-01
Vortex Genie Scientific indurstries inc. G560
Multichannel Pipettor (10 μl - 300 μl) Sartorius 730360
WASP2 Whitley Automated Spiral Plater Microbiology International
ProtoCOL automated colony counter / plate counter/ plate reader  Microbiology International
TRIzol Life Technologies 15596-026
qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips Bio-Rad TLS0801
qPCR caps; Optical Flat 8-Cap Strips Bio-Rad TCS0803
RQ1 RNase-Free DNase Promega m610a
M-MLV Reverse Transcriptase Promega m170b
dNTPs Promega U1240
Oligo-dT IDT
 SsoAdvanced SYBR Green Supermix Bio-Rad 172-5260
CFX Connect Real-Time PCR Detection System Bio-Rad 185-5200
RNasin Ribonuclease Inhibitor Promega N2115

DOWNLOAD MATERIALS LIST

References

  1. Lemaitre, B., Hoffmann, J. The host defense of Drosophila melanogaster. Annual review of immunology. 25, 697-743 (2007).
  2. Dionne, M. S., Schneider, D. S. Models of infectious diseases in the fruit fly Drosophila melanogaster. Disease models & mechanisms. 1, (1), 43-9 (2008).
  3. Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity. 12, (5), 569-580 (2000).
  4. Ayres, J. S., Freitag, N., Schneider, D. S. Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection. Genetics. 178, (3), 1807-1815 (2008).
  5. Cronin, S. J. F., et al. Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection. Science. 325, (5938), 340-343 (2009).
  6. Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. Methods to study Drosophila immunity. Methods. (2014).
  7. Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila. Current biology CB. 16, (20), 1977-1985 (2006).
  8. McKean, K. a, Yourth, C. P., Lazzaro, B. P., Clark, A. G. The evolutionary costs of immunological maintenance and deployment. BMC evolutionary biology. 8, (1), 76 (2008).
  9. Kuo, T. -H., Pike, D. H., Beizaeipour, Z., Williams, J. A. Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish. BMC neuroscience. 11, 17 (2010).
  10. Panayidou, S., Ioannidou, E., Apidianakis, Y. Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings. Virulence. 5, (2), 253-269 (2014).
  11. Keebaugh, E. S., Schlenke, T. A. Insights from natural host–parasite interactions: The Drosophila model. Developmental & Comparative Immunology. 42, (1), 111-123 (2014).
  12. Howick, V. M., Lazzaro, B. P. Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection. BMC evolutionary biology. 14, (1), 56 (2014).
  13. Babin, A., Kolly, S., Kawecki, T. J. Virulent bacterial infection improves aversive learning performance in Drosophila. Brain, behavior, and immunity. (2014).
  14. Chambers, M. C., Song, K. H., Schneider, D. S. Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster. PLoS ONE. 7, (12), e50679 (2012).
  15. Fellous, S., Lazzaro, B. P. Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition. Molecular ecology. 19, (7), 1462-1468 (2010).
  16. Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila. PLoS pathogens. 8, (1), e1002445 (2012).
  17. Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. Thorax injury lowers resistance to infection in Drosophila melanogaster. Infection and immunity. (2014).
  18. Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. A practical guide to understanding Kaplan-Meier curves. Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143, (3), 331-336 (2010).
  19. Freeman, W. H. Biometry. (1995).
  20. Frydman, H. Wolbachia bacterial infection in Drosophila. Journal of visualized experiments JoVE. (2), 158 (2007).
  21. Kuo, T. -H., Handa, A., Williams, J. A. Quantitative measurement of the immune response and sleep in Drosophila. Journal of visualized experiments JoVE. (70), e4355 (2012).
  22. Vodovar, N., et al. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proceedings of the National Academy of Sciences of the United States of America. 102, (32), 11414-11419 (2005).
  23. Nehme, N. T., et al. A model of bacterial intestinal infections in Drosophila melanogaster. PLoS pathogens. 3, (11), e173 (2007).
  24. Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. Interspecific transmission of endosymbiotic Spiroplasma by mites. Biology. 3, (1), 23-25 (2007).
  25. Kanbar, G., Engels, W. Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites. Parasitology research. 90, (5), 349-354 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics