Systemisk bakteriell infeksjon og immunforsvar fenotyper i

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster. J. Vis. Exp. (99), e52613, doi:10.3791/52613 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Bananflue Drosophila melanogaster er en av de fremste modellorganismer for å studere funksjonen og utviklingen av immunforsvaret. Mange aspekter av medfødt immunitet er bevart mellom insekter og pattedyr, og siden Drosophila kan lett være genetisk og eksperimentelt manipulert, de er kraftig for å studere immunsystemets funksjon og de ​​fysiologiske konsekvensene av sykdommen. Prosedyren demonstrert her kan smitte av fluer ved innføring av bakterier direkte inn i kroppens hulrom, utenom epitelceller barrierer og mer passive former for forsvar og la fokus på systemisk infeksjon. Prosedyren omfatter protokoller for måling ratene vert dødelighet, systemisk patogen belastning, og graden av stimulering av vertens immunsystem. Denne infeksjonen fremgangsmåten er billig, robust og kvantitativt repeterbar, og kan bli brukt i studier av funksjonelle gener, evolusjons liv historie, og fysiologi.

Introduction

Frukten fly Drosophila melanogaster er en av de fremste modellorganismer for å studere funksjonen og utviklingen av immunforsvaret. Drosophila er billig og lett å bak, er svært mottagelig for eksperimentell manipulasjon, og er støttet av et omfattende vitenskapelige samfunn som har utviklet en bred rekke forskningsverktøy. Mange aspekter av medfødt immunitet er bevart mellom insekter og pattedyr, inkludert signaltransduksjon mediert av Toll-lignende reseptorer og NF-kB familie transkripsjonsfaktorer, JAK / STAT signale og JNK pathway svar. 1,2 Funksjonen til disse genene og trasé kan spørres i D. melanogaster bruker mutasjoner eller RNAi nedslaging som øker eller reduserer pathway aktiviteter. 3 - 6 tillegg Drosophila kan brukes til å studere fysiologiske konsekvensene av smitte og sykdom, blant annet i forbindelse med evolusjonslivshistorieteori 7.- 9 Alle slike studier har imidlertid avhenge av evnen til pålitelig infisere eksperimentelle fluer under definerte behandlingsforhold. Prosedyren er beskrevet her presenterer et metodisk rammeverk for å levere robuste og repeterbare bakterielle infeksjoner i Drosophila melanogaster og deretter måle infeksjon alvorlighetsgrad og kvantifisere vertens immunrespons.

Drosophila kan være naturlig og eksperimentelt infisert med et bredt spekter av parasitter og patogener, inkludert bakterier, sopp, virus, nematoder og parasitoid veps. Den nåværende protokoll er fokusert på å levere systemisk bakterieinfeksjon. Mange forskjellige bakterier kan brukes til å infisere fluer, og eksperimentators valget bør være basert på presise vitenskapelige spørsmålene som stilles. For eksempel kan kliniske isolater være ansatt for å studere bakterie virulensmekanismer 10, eller økologisk relevante isolater kan være preferred for evolusjonære studier. 11 Noen bakterier er kompetente patogener av D. melanogaster, prolifererende på infeksjon og forårsaker vert sykdom eller død. Andre bakterier er effektivt håndtert av vertsimmunsystemet og fjernet i løpet av få dager. I denne demonstrasjonen blir Providencia rettgeri bli brukt som en proliferativ patogen som kan føre til verten dødelighet og vedvarer i overlevende verter. Escherichia coli brukes som en ikke-patogen som er klarert av vertens immunsystem.

Infeksjon vil bli etablert ved innføring av bakterier direkte inn i kroppshulrom av fly. Denne tilnærmingen forbigår epitel-barrierer og beskyttende atferd, slik at undersøkelse av systemisk infeksjon uavhengig av den naturlige modus for overføring. Det er to primære metoder for eksperimentelt å etablere systemisk infeksjon. I den første, en nanoinjector og trukket glass kapillære nåler brukes for å injisere et nøyaktig antallbakterier i fly. Denne metode har den fordel at de muliggjør et stort dynamisk område av infeksjonsdoser og for å være kvantitativt høyt repeterbare. Den andre metoden er å levere infeksjon med et septisk nålestikk. Denne tilnærmingen har den fordelen av å være hurtig og krever ikke noe spesielt utstyr. Når infeksjoner er etablert, blir det mulig å måle systemisk patogen belastning, vert dødelighet, og induserbar immunsystemaktivitet. Selvfølgelig kan en hvilken som helst rekke ekstra fenotyper tenkes å bli målt i infisert D. melanogaster, inkludert post-infeksjon fruktbarhet 12, læringsevne 13, metabolske status 14, eller nesten alle andre trekk som kan tenkes.

Protocol

1. Samle og forberede Fluer

  1. Bakre D. melanogaster under de ønskede eksperimentelle forhold. Pass på å ikke overfylle fluene under stell og pass på at larvetettheter er konsistente på tvers av behandlinger, siden miljøforhold i løpet av larvestadiet kan dypt påvirke immunforsvars fenotyper løpet voksne stadiet. 15
  2. Samle eksperimentelle fluer 0-3 dager etter eklosjonshormon fra pupal sak og overføre dem til frisk medium.
  3. Huset de oppsamlede flyr på en ønsket temperatur (temperaturer mellom 22 ° C og 28 ° C er generelt egnet) inntil de er i alderen 5-7 dager post-eklosjonshormon.
    MERK: Dette gir tilstrekkelig tid for fluene å fullføre metamorfose og bli modne voksne, men er vel før senescens begynner.
  4. Sortere ønsket antall fluer i en egen ampulle før infeksjon, igjen ta vare å unngå overbefolkning.
    MERK: Bare males er smittet i denne demonstrasjonen, men er likeledes mulig å infisere kvinner ved å benytte prosedyren som er beskrevet.

2. Kultur og forberede Bakterier

  1. Forbered en master plate av de utvalgte bakterier minst to dager før infeksjon. Streak bakterier fra en 15% glyserol lager lagret på ubestemt tid ved -80 ° C. Oppbevar master plate ved 4 ° C i opptil 2 uker. Alltid strek master platene direkte fra frossen glyserol lager. Unngå serie passasje av bakterier fra plate til plate, som gjentatte passasje i kultur kan føre bakterier å utvikle seg svekket virulens.
    MERK: Dette eksempelet gjør bruk av Providencia rettgeri og Escherichia coli.
  2. Bruk følgende fremgangsmåte for å forberede en bakteriell suspensjon for injeksjon.
    1. Dyrk en 2 ml bakteriekultur ved å inokulere sterilt medium med en enkel koloni isolert fra hovedplaten. Vokse bakterier til stasjonær fase (f.eks MERK: Både P. rettgeri og E. coli vokser godt i Luria buljong ved temperaturer 20-37 ° C med forsiktig risting.
    2. Når kulturen har nådd stasjonær fase, forsiktig pellet celler fra ca. 600 mL av kulturen i en tabletop sentrifuge (3 min ved 5000 xg), kast supernatanten og resuspender bakterier i ca. 1000 mikroliter sterilt fosfatbufret saltvann (PBS; 137 mM NaCl, 2,7 mM KCl, 10 mM Na 2 PO 4, 1,8 mM KH 2PO 4, pH = 7,4).
    3. Fortynn de resuspenderte cellene i steril PBS for å oppnå en optisk tetthet (OD) egnet for bakterien som brukes, målt med et spektrofotometer som absorbans ved 600 nm. Bruk denne suspensjonen til å infisere fluene.
      MERK: En 600 = 0,1 eller 1,0 tilsvarer henholdsvis om lag 10 8 og 10 9 Providencia rettgeri eller E. coli per ml. Fordi begge leve etnd døde bakterier bidrar til optisk tetthet, er det viktig å høste kulturer tidlig stasjonær fase før bakterie- lik akkumulere og forvrenge forholdet mellom optisk tetthet, og antallet levedyktige bakterier innført i løpet av infeksjonen.

3. infisere Flies

MERK: Fordi Drosophila immunitet er påvirket av døgnrytmen, er det viktig å utføre infeksjoner på et tilsvarende tidspunkt på dagen over eksperimentelle replikater 16.

3.1) Ved hjelp av en Nanoinjector

  1. Forberede glass nåler for infeksjon.
    1. Forbered et glass nål ved å trekke en borsilikatglass kapillær bruke en mikropipette avtrekker.
    2. Ved hjelp av tang, bryte av spissen av kanylen for å skape en åpning på omtrent 50 um i diameter for å tillate utstøting av væske.
  2. Monter injektoren.
    1. Plasser den tettende O-ring, og deretter de hvite spacer (store smilehull vendt utover) på metall stempelet.
    2. Fyll glassålen med mineralolje ved hjelp av en sprøyte med en 30 G nål.
    3. Sett den fylte glasset nålen gjennom ringen og deretter plassere større O-ring rundt sin base, ca 1mm fra den butte enden av nålen.
    4. Skyv nålen på metall stempelet og forsiktig skru på spennhylsen til den sitter fast.
    5. Støte ut det meste av mineralolje fra injektoren, men sørge for at det fortsatt er et lite volum av olje i nålen for å virke som en barriere mellom injektoren og bakteriesuspensjonen. Pass på at det ikke er luftbobler innenfor mineralolje eller bakteriell suspensjon, eller mellom de to væskene.
    6. Sett injektoren til det ønskede volum for injeksjon (mellom 9 og 50 nl nl).
  3. Generere såret kontroller.
    1. Fyll sprøytenål ​​med steril PBS ved forsiktig å innføre spissen av kapillaren nål i en tube av media og pressing "fylle" -knappen på injektoren.
      NOTE: Sterile bakterievekstmedier kan også benyttes en såret kontroll hvis eksperimentet krever injeksjon av bakterier suspendert i sitt vekstmedium. Men fordi bakterievekstmedier inneholder bestanddeler som kan stimulere immunsystemet eller har andre effekter på verten, er en inert bærer så som PBS foretrekke.
    2. Bedøver ønsket antall fluer under en lett strøm av CO 2.
    3. Injisere flyr i fremre del av magen på ventrolateral underlag med steril PBS.
      MERK: Det er også mulig å injisere flyr på andre områder, som for eksempel sternopleural plate av thorax, men det er viktig å holde injeksjonsstedet konsekvent innenfor hvert forsøk 17.
    4. Plasser injisert fluer i nye ampuller med nytt medium, legging ampullene på sin side til alle fluene har utvinnes fra anestesi for å hindre fluene fra å bli sittende fast til maten. <br /> MERK: Det anbefales å injisere PBS kontroll fluer før injisere bakterier å eksperimentelle fluer så det samme nål kan brukes for begge behandlingene. Det vil ikke alltid være mulig å benytte den samme nål for en hel eksperiment. I så tilfelle kan det være ønskelig å registrere hvilken nål ble anvendt som fluer og å inkludere nål identitet som en eksperimentell faktor i den statistiske analysen.
  4. Injisere den bakterielle patogen.
    1. Løse ut rester sterile medier fra injektoren og fylle den samme nålen med bakteriell suspensjon.
    2. Gjenta prosedyren ovenfor (3.1.3), nå injisere fluene med bakteriell suspensjon utarbeidet prosedyre 2.2.

3.2) Med Septic Pinprick

  1. Forbered nålen for stikk.
    1. Smelt slutten av en 200 mL mikropipette tips og sette inn en 0,15 mm insekt minutien i den smeltede plasten. Tillat plast stivne such at tappen holdes på plass med omtrent 0,5 cm på pinne som strekker seg fra plasten.
  2. Generere såret kontroller.
    1. Bedøver ønsket antall fluer under en lett strøm av CO 2.
    2. Prikk fluene i sternopleural plate av thorax med nålen, unngå feste områder av vingene og bena. Hvis det er nødvendig, forsiktig fjerne fluene fra minutien pin bruker myke tang.
      MERK:. Det er også mulig å stikke fluene på andre områder, for eksempel fremre buk på ventrolateral overflaten, men det er viktig å holde injeksjonsstedet konsekvent innenfor hvert eksperiment 17 Pricking gjennom hårstråene av magen har en tendens til å være mer vanskelig å stikke hull av thorax og er derfor mindre vanlig.
    3. Plasser stukket fluer i en fersk hetteglass med nye fly medium, legging hetteglasset på sin side til alle de fluene har utvinnes fra anestesi for å hindre fluene fra becoming stakk til maten.
  3. Introduser bakteriell infeksjon.
    1. Bedøver ønsket antall fluer under en lett strøm av CO 2.
    2. Prikk hvert fly på samme sted som mediekontrollene, dyppe tuppen av pinnen inn i bakteriell suspensjon utarbeidet prosedyre 2.2 før du stikker hvert fly.
    3. Plasser stukket fluer i en fersk hetteglass med nye fly medium, legging hetteglasset på sin side til alle de fluene har utvinnes fra anestesi for å hindre fluene fra å bli sittende fast til maten.

3.3) Vurdere Infeksiøs Dose Leveres

  1. Infisere et sett av fluer som beskrevet ovenfor i begge prosedyre 3.1 eller 3.2, bare i stedet for å returnere fluene til mat hetteglasset for å gjenopprette fra anestesi, plasserer hvert fly inn i en mikro tube på is.
  2. <Legge 250 mL PBS til hvert rør og homogen fluene enten ved hjelp av en støter eller en perle beater./ Li>
  3. Plate homogenate på en LB agar plate, enten ved hjelp av en spiral plater eller en seriell fortynning.
    1. Til platen ved hjelp av seriefortynning, overfører hver flue homogenat til den første raden i en 96-brønners plate.
    2. Fyll hver brønn i resten av radene med 90 mL PBS.
    3. Ved hjelp av en multikanal pipette, ta 10 mL fra første rad som inneholder fly homogenate og dispensere i andre rad.
    4. Pipetter opp og ned minst 10 ganger for å blande grundig, og deretter ta 10 ul og overføring til den tredje rad. Gjenta denne prosedyren med de resterende radene.
    5. Starter fra den nederste raden (mest fortynne bakterier suspensjon), bruker multikanalspipette å ta 10 mL fra hver brønn og innskudd på en LB plate, ta vare på at prøvene er utlevert som atskilte flekker som ikke berører hverandre. Gjenta til alle brønnene har blitt samplet fra hver rad, utlevering dem i synkende rekkefølge av fortynning på LB plate. La platen ved RT inntil flekkene har helt gjennomvåt inn i LB plate.
      MERK: Tørking av LB plate for et par dager på RT før bruk anbefales for å sikre at væsken er lett absorberes, minimere sjansene for utilsiktet kontakt mellom prøve flekker.
  4. Inkuber platene O / N, tar seg ikke å overgrow platene så kolonier forbli liten og diskret.
    MERK: Avhengig av bakterievekst medium og inkubasjonstemperaturen brukes, kan koloniene avledet fra flua endogene gut bakterieflora slutt vises på tallerkenen. Men de fleste bakterier som benyttes for patogene infeksjoner vokse mye raskere enn tarmfloraen på LB-agar ved 37 ° C.
  5. Fjern platene fra inkubatoren når de eksperimentelle bakterier har vokst synlige kolonier (typisk 8 - 12 timer), men før Drosophila gut bakterieflora kolonier vises (ca. 36 timer). For langsomt voksende eksperimentelle bakterier, bruk en selektivantibiotika i LB agar for å fjerne eventuelle kolonier fra tarmen bakterieflora.
  6. Telle antall kolonier for hver homogenate.
    1. For spiral plater, telle koloniene som vokser ved hjelp av en automatisert koloniteller som kan beregne bakteriemengden per ml homogenate basert på antall og plassering av koloniene på plate.
      MERK: Spiral teller er mest nøyaktig når bakteriekonsentrasjonen er i området fra 5 x oktober 2 til 5 x 10 4 bakterier per ml.
    2. For stikk plater, manuelt telle koloniene for hvert fly fra hvilken fortynning inneholder 30-300 kolonier og beregne antall bakterier per ml opprinnelige homogenate.

4. karaktersurvivor av Infeksjon

  1. Analysen dødelighet etter injeksjonen.
    1. Plasser infiserte fluer og sårede kontroller i friske ampuller og opprettholde i en inkubator ved en ønsket temperatur (25 ° C med en 12:12 light: mørke syklus anbefales). Ikke legg mer enn 15 fluer i ett enkelt hetteglass som det blir vanskelig å telle mer enn 15 levende fluer.
    2. Telle antall levende og døde fluer hver dag, eller oftere hvis det er hensiktsmessig.
    3. For å opprettholde kvalitet på maten, flip fluene til ny mat regelmessig.
      1. Hvis hetteglass inneholder kun menn, overføre dem til friske ampuller hver tredje dag. Hvis hetteglass inneholder hunner, overføring til frisk ampuller hver dag fordi larve avkom vil kondensere mat, øker risikoen for at voksne fluene kan sette seg fast og som resulterer i overvurdert dødelighet på grunn av infeksjon.
  2. Statistisk analysere dataene.
    1. Plot overlevelse som Kaplan-Meier kurve, som angir sannsynligheten for at en person vil overleve til en målt tidspoeng etter injeksjon. 18 For overlevelseskurver som ikke krysser, utføre parvise sammenligninger ved hjelp av en Log-Rank Test (også kalt Mantel Cox Test) eller utføre mer komplekse analyser ved hjelp av en Cox modell, som kan inkludere flere faktorer og deres interaksjoner. For overlevelseskurver som krysser, utføre en stratifisert Cox analyse. 17

5. Analyse bakteriemengde Post-infeksjon

  1. Måle bakteriemengde.
    1. På en fastsatt tid etter injeksjon, gjenta prosedyren brukes til å vurdere smittedose for å bestemme bakteriemengde i løpet av infeksjon (se protokoll 3.3).
      MERK: Ved hjelp av spiral plater, fortynne homogenater slik at bakteriesuspensjonen faller innenfor et område på 1000 - 100000 bakteriell per ml.
  2. Analysere dataene.
    1. Hvis bakteriemengde er ikke-normale, enten transformere dataene for bedre å tilnærme en normalfordeling eller analysere data ved hjelp av ikke-parametrisk statistiske analyser (f.eks Mann-Whitney U-test). Bruk en Box-Cox-analyse for å find optimal transformasjon; naturlig logg eller basis -10 loggtransformasjoner er ofte effektive. 19
    2. Hvis dataene er tilstrekkelig normalfordelt, og det er bare to behandlinger blir kontrastert, utføre en t-test for å avgjøre om de to behandlingene resultere i forskjellige gjennomsnitts bakterielle belastninger. Hvis det er flere eksperimentelle variabler eller andre potensielt prediktive faktorer, bruke variansanalyse (ANOVA) for å finne ut hvilke faktorer som er en signifikant prediktor for bakteriell belastning. 19

6. Analyse Transkripsjonell Aktivering av immunsystemet Genes

  1. For å visualisere grov aktivering av immunsystemet etter infeksjon infisere transgene fluer som uttrykker grønt fluorescerende protein (GFP) under kontroll av en promoter fra et antimikrobielt peptid-genet, som beskrevet tidligere. 18
  2. Vis den infiserte fluer under ett fluorescens-stand mikroskop; GFP induksjon bør bli visible i fettet kroppen i første 6 - 10 timer etter infeksjon.
  3. For mer presis kvantifisering av immunaktivering, bruker kvantitativ PCR på cDNA mal (QRT-PCR) for å måle overflod av antimikrobielle peptid gentranskriptene.
    MERK: Ekspresjon av immungener kan måles når som helst etter (eller før) infeksjon. Generelt sett, begynner induksjon av immun genuttrykk ca 4 timer etter injeksjon og øker over de neste 24 timer.
    1. Bedøve fluer benytter CO 2.
    2. Plasser 15 fluer i en mikrofugerør for hver RNA ekstraksjon.
      MERK: Det anbefales å samle inn minst tre gjentatte prøver for hver behandling tilstand.
    3. Utdrag RNA fra fluene og generere første cDNA ved hjelp av noen av en rekke standardprosedyrer eller kommersielle kits. Oppbevares RNA ved -80 ° C. Oppbevares cDNA ved -20 ° C i perioder på noen uker og ved -80 ° C for langtidslagring. Før RNA ekstraksjon, lagre fligger ved -80 ° C.
    4. Utføre kvantitativ PCR (qPCR) på mål-gener av interesse ved bruk av cDNA som et templat. Se tabell 1 for primersekvenser å forsterke de antibakterielle peptid gener Diptericin A, Drosomycin, Defensin, Attacin A, og Metchnikowin samt rengjøring kontroll genet rp49 (også kjent som rpL32).
      MERK: Genene som koder for antimikrobielle peptider Diptericin A og Drosomycin gi svært gode avlesninger av D. melanogaster immunaktivitet indusert hovedsakelig gjennom IMD og Toll trasé, henholdsvis. For å kontrollere for sample-to-sample variasjon i RNA yield og effektiviteten i revers transkripsjon, standardisere registrert uttrykk for mål gener mot en referanse housekeeping gen hvis uttrykk forventes ikke å endre seg med infeksjon som rp49 (også kjent som RPL 32).
    5. Analysere dataene. <ol>
    6. For grov tilnærming av uttrykk forskjeller, å beregne forholdet mellom startmengde (SQ) verdien oppnådd fra test-genet (f.eks Diptericin A) i forhold til SQ verdien oppnådd fra referanse genet (f.eks rp49) for hver prøve (beregnet som SQ - DPTA / SQ - rp49). Skalere disse forholdene til en baseline kontroll behandling som en frisk håndtering kontroll. Vilkårlig satt styrings uttrykk nivå lik 1,0 og visualisere eksperimentelle behandlinger som relative fold endringer. Beregn SQ verdi for hvert gen mot en standardkurve utviklet fra en serie fortynning av kjent mengde cDNA.
      MERK: Statistisk analyse av forholdene kan være komplisert, slik at denne tilnærmingen er bedre enn for rask tilnærming for grundig analyse. Dersom PCR effektiviteten er lav, designe nye primere for å forbedre kinetikken PCR hvis mulig. For qPCR reaksjoner med nesten perfekt effektivitet (adoubling av PCR produkt hver syklus), kan terskelen syklus (C T) erstattes av SQ verdi.
    7. For enkle eksperimenter med optimalt effektiv amplifikasjon, kan dataene bli analysert ved anvendelse av ΔΔC T-metoden. 19 For hver prøve, subtrahere C T verdien til referanse genet (f.eks rp49) fra C T av test-genet (f.eks., Diptericin A) for å gi en A C T. Deretter trekker A C T av grunnlinjen kontroll fra A C T for hver forsøksprøve for å gi en ΔΔC T verdi for hver prøve; Dette ΔΔC T er en indikasjon på relative forskjeller i genuttrykk nivåer mellom behandlinger, hvor 2 (-ΔΔCT) tilnærmet lik ganger endring i uttrykket.
      NB: Denne analysen kan dårlig misestimate fold-endring i ekspresjon av målgenet hvis PCR av enten test gen eller referansegen har lav virkningsgrad.
    8. For den mest grundig analyse, utføre analyse av varians (ANOVA) ved hjelp av den estimerte ekspresjon av test-genet (f.eks Diptericin A) som responsvariabelen og beregnet ekspresjon av kontroll-genet (f.eks rp49) og andre eksperimentelle faktorer som forklaringsvariabler.
      MERK: Denne tilnærmingen er relativt robust til ineffektivitet i PCR forsterkning og tillater analyse av mer kompliserte eksperimentelle design.

Representative Results

Denne delen illustrerer resultater som kan oppnås etter bakteriell infeksjon av Drosophila melanogaster. Figur 1 viser at infeksjon dose varierer med optisk tetthet av bakteriesuspensjonen anvendt for injeksjon, og at den avleverte dose kan måles pålitelig ved å homogenisere og plette går umiddelbart etter injeksjonen . Som illustrert i figur 2, kan forskjellige patogener forårsake forskjellige nivåer av dødelighet vert (figur 2A) og vert dødelighet kan være doseavhengig (figur 2B). Viktigst av alt gir denne protokollen for ulike typer infeksjoner som skal oppnås: Providencia rettgeri kan føre til en kronisk, sub-dødelig infeksjon som vedvarer i 20 dager eller lenger (figur 3A). Imidlertid vil andre bakterier som Escerichia coli hovedsakelig rettes opp av verten fly innen seks timer etter infeksjon (Figur 3B). Induksjon av immun system kan bli beregnet ved hjelp av RNA-isolering og påfølgende QRT-PCR av antibakterielle peptid transkripter (figur 4A og B). Analogt men mindre kvantitativt, flyr uttrykker GFP under kontroll av antimikrobielle peptid genet promotorer kan benyttes for å visualisere induksjon av immunsystemet (figur 4C).

Figur 1
. Figur 1: Bestemme Infeksiøs Dose Fluer ble injisert med 50 nl av bakteriesuspensjoner som dekker en rekke optiske tettheter (0,0001 til 0,05). Fluene ble umiddelbart homogenisert og belagt for å bestemme antall bakterier innføres ved injeksjon. Initial bakteriemengde sterkt korrelerer med innledende OD injisert (r 2 = 0,96)

Figur 2
(A) villtype fluer ble injisert med omtrent 5000 bakterier fra en av tre forskjellige arter. Satsen for verts dødeligheten er svært avhengig av bakteriearter som brukes for infeksjon. (B) vill type fluer ble injisert med tre forskjellige doser av Enterococcous faecalis - 50, 500 og 5000 bakterier per fly. Fluer dør raskere når infisert med høyere infeksiøse doser (c) et immunsystem og dets mutant villtype isogene styreledning ble injisert med ca. 500 Burkholderia cepacia. En parvis Log-Rank sammenligning viser at villtype fly overlever infeksjonen betydelig bedre enn mutant (χ 2 = 59,02, df = 1, p <0,0001).


Figur 3:. Bakteriemengde etter Injection Fluer ble injisert med ca. (A) 5000 P. rettgeri (B) 3400 E. coli. Bakteriemengde ble bestemt umiddelbart etter injeksjon, og på ulike påfølgende tidspunkter. Hvert datapunkt representerer den bakterielle belastningen av et enkelt fly. E. coli er raskt fjernet fra utfordret vertene mens P. rettgeri fortsetter for resten av vertens liv ,.

Figur 4
Figur 4: Induksjon av Immune Gene Expression etter injeksjon. (A) Fluer ble injisert med 50 nl av P. rettgeri eller steril PBS i enten magen eller brysthulen, eller ble forlatt umanipulerte bortsett fra CO Diptericin A-genet ble bestemt ved bruk av QRT-PCR. (A) Expression nivåer fremstilles grafisk som forholdet mellom Diptericin En utskrift til rp49 transkripsjon og skalert slik at CO 2 kontroll er definert som å ha et uttrykk nivå 1. Linjene representerer gjennomsnitt og standardfeil av forholdstall fra hver tilstand (n = 4). (B) Expression nivåer er tegnet opp som en 2 ΔΔCT med gjennomsnittlig C T verdi fra CO 2 aesthesia kontroll fluer brukes som standard uindusert tilstand. Stolpene representerer gjennomsnitt og standard feil av ΔΔC T fra hver tilstand (n = 4). Mens det er ingen forskjell i karakter induksjon grunn av injeksjonsstedet, viser sammenligning av paneler A og B hvordan ΔΔC T metoden kan potensielt overvurdere induksjons nivåer. (C) Fluer som uttrykker GFP under styring av Diptericin A-promotoren ble injisert med 50 nl av P. rettgeri (OD = 0,1) og deretter avbildes 7 dager senere. GFP panelet viser uttrykk for GFP i abdominal fett kroppen av infiserte fluer, noe som indikerer aktivering av Diptericin En promoter i bacterially-infiserte fluer, men ikke medie-injisert kontroller.

Gene Forward Omvendt
rp49 (også kalt rpL32) 5 'AGGCCCAAGATCGTGAAGAA 3' 5 'GACGCACTCTGTTGTCGATACC 3'
Diptericin A 5 'GCGGCGATGGTTTTGG 3' 5 'CGCTGGTCCACACCTTCTG 3'
Drosomycin 5 'CTGCCTGTCCGGAAGATACAA 3 ' 5 'TCCCTCCTCCTTGCACACA 3'
Defensin 5 'GAGGATCATGTCCTGGTGCAT 3' 5 'TCGCTTCTGGCGGCTATG 3'
Attacin A 5 'CGTTTGGATCTGACCAAGG 3' 5 'AAAGTTCCGCCAGGTGTGAC 3'
Metchnikowan 5 'AACTTAATCTTGGAGCGATTTTTCTG 3' 5 'ACGGCCTCGTATCGAAAATG 3'

Tabell 1: Grunnmaling for QRT-PCR.

Discussion

Fremgangsmåten som er beskrevet her gir streng og høy kvalitet infeksjon av Drosophila melanogaster. De illustrerte eksempler primært fokusert på infeksjon med Providencia rettgeri og E. coli, men protokollen er svært fleksibel og kan påføres på infeksjoner med ulike bakterier over et område av verts oppdrett og vedlikeholdsforhold.

Detaljene i en optimal eksperimentell tilnærming vil avhenge av bakterien anvendt for infeksjon, genotypen til verten, og den samlede forsøksbetingelser. Det anbefales sterkt å pilottest noen nye eksperimentelle forhold før oppstart av mer ambisiøse prosjekter. Et godt utgangspunkt er å teste tre infeksjons doser over en 100-fold range. Sterkt virulente patogener blir ofte best innføres ved meget lave infeksiøse doser i størrelsesorden 10 til 100 bakterieceller pr flue. Mer moderate patogener kan injiseres ved høyere doser av rundt 1.000 bakterier per fly, og som ikke er patogener kan injiseres i doser så høye som 10 000 bakterier pr flue. Det er ofte instruktivt å definere kinetikken av nye infeksjoner ved å spore patogen belastning, vert dødelighet, og immunsystemet aktivitet over en langsgående tidsserie. På grunn måling av patogen belastning og vert genekspresjon er destruktive analyser, er det nødvendig å infisere forskjellige fluer ved begynnelsen av eksperimentet for hvert tidspunkt som skal måles.

Ved avgjørelsen av om å bruke stikk eller microcapillary basert injeksjon, er det viktig å være oppmerksom på det er fordeler og begrensninger til hver tilnærming. Kapillær injeksjons introduserer et volum av væske i fly, noe som både øker turgor beskjedent trykk og innfører salter eller andre molekyler som er suspendert eller oppløst i bæreren. Kapillær injeksjon krever også tilgang til en injeksjonsanlegget eller kjøp av nødvendig utstyr. Septic stikk krever ingen spesiell utstyr og introdusererubetydelig media inn i fly, og er vanligvis mer effektivt for å infisere et stort antall fluer. Imidlertid ikke pinprick infeksjoner ikke tillate nøyaktig kontroll over infeksjon dose som kan oppnås med kapillær injeksjon. Denne protokoll fokusert på et injeksjonsapparat som mekanisk regulerer injeksjonsvolum, men det er også innsprøytingssystemer basert på diskrete pulser av trykkluft. 20,21 Disse er vanligvis dyrere enn anordningen omtalt her, og krever kalibrering av luftpuls til hvert nål for å sikre konsistente injeksjonsvolumer.

Det er stor debatt, men svært lite data om hvordan fluene blir systemisk infisert med bakterier i naturen. Noen forskere posit at flertallet av naturlige infeksjoner oppstår når Drosophila svelges patogene bakterier og bakterier er deretter i stand til å unnslippe tarmen for å etablere en systemisk infeksjon. Men det er veldig few bakterier som er kjent for å være i stand til å krysse tarm av D. melanogaster, og de ​​som har denne evnen er svært dødelig for fluer 22,23. En alternativ teori er at flyr regelmessig oppholder cuticular skader gjennom flukt fra mislykkede predasjon forsøk eller angrep av ektoparasittiske midd. Denne hypotesen er understøttet av den hyppige samlingen av vill D. melanogaster peiling melanization flekker som er en indikasjon på leget sårene (upubliserte observasjoner). Midd har vist seg å overføre bakterieinfeksjoner i Drosophila 24 og sårene etter midd kan sekundært infisert av bakterier i honning bier 25. Imidlertid frekvensen i naturen av midd-drevet eller på annen måte opportunistisk infeksjon av D. melanogaster gjennom skjel brudd er ikke kjent. Protokollen er beskrevet her tillater innføring av bakterier direkte inn i hemolymph gjennom kvantitative injeksjon som omgår noen epitelceller barrierer eller atferds immunofluorescensNITY. Metoder for fôring patogene bakterier til D. melanogaster er blitt beskrevet i Vodovar et al. 22 og Nehme et al., 23.

Mange entomopathogenic bakterier utgjør liten eller ingen menneskelig helserisiko, slik at forskere til å jobbe med dem komfortabelt. Videre er det svært få bakterier har evnen til å infisere Drosophila på kontakt uten eksperimentell inngrep, slik at risikoen for "epidemisk" spredning av bakteriell infeksjon ved et laboratorium via kontaminerte overflater eller rømt fluer er vanligvis meget lav. Likevel, er det tilrådelig å sikre at tilstrekkelige inneslutningstiltakene er på plass for å hindre at smittede fluer slipper unna og for å gjenerobre noen rømte fluer. Laboratoriet skal være utstyrt med en biologisk sikkerhetsnivå i samsvar med det av patogener som brukes, og standard beste praksis i mikrobiologi bør benyttes.

Den eksperimentelle infectipå metoden beskrevet her gir infeksjoner i Drosophila melanogaster med enhver dose av vilkårlig bakterien. Når infeksjon har blitt etablert, er det enkelt å måle kinetikken av bakteriell spredning eller klaring, for å spore vert dødelighet, og å analysere induksjon av vertens immunsystem. Infiserte fluer kan lett bli utsatt for andre fenotypisk analyser, inkludert tester av fysiologiske funksjoner som kan form eller være formet av infeksjonen. Prosedyrene som beskrives er billig, krever relativt lite spesialutstyr, og er lett lært, noe som gjør dem mottagelig for bruk i ulike prosjekter over en bredde av forsknings- og undervisningslaboratorier.

Materials

Name Company Catalog Number Comments
Incubator Powers Scientific, Inc DROS52SD
Paintbrush
CO2 Flypads FlyStuff 59-114
CO2 Airgas CD FG50
Drosophila rearing mix 
6 oz Square Bottom Bottles, polypropylene Genesee Scientific 32-130
Nosterile Extra Large Cotton Balls Fisher brand 22-456-882
Microscope Olympus Corporation SZ51
Drosophila Vials polystyrene VWR international 89092-720
Nosterile Large Cotton Balls Fisher brand 22-456-883
2 L flask VWR international 89000-370
Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm; VWR international 25384-302
LB Agar, Miller Difco 244520
Innoculing Loop VWR international 80094-488
Rainin Clasic Pipettes in various sizes
0.1 µl to 2 µl,
2 µl to 20 µl,
20 µl to 200 µl,
100 µl to 1,000 µl
Rainin PR-2
PR-20
PR-200
PR-1000
Micropipette tips (assorted sizes) VWR international 30128-376
53503-810
16466-008
Luria Broth Base, Miller Difco 241420
Disposable Culture Tubes Borosilicate Glass VWR international 47729-576
S-500 Orbital Shaker VWR international 14005-830
Centrifuge VWR international 37001-300
PBS pH 7.4 10X Invitrogen 70011044
SmartSpec 3000 Spectrophotometer Bio-Rad 170-2501
Semimicrovolume Cuvettes Bio-Rad 223-9955
Vertical Capillary Puller Kopf Needle Pipette Puller
3.5'' Replacement glass Capillaries for Nanojet II Drummond Sientific Company 3-000-203-G/X
Nanoject II Drummond Sientific Company 3-000-204
Forceps Fine Science Tools 11255-20
10 ml Syringe BD 309604
Mineral Oil, White, light Macron Fine Chemicals 6358-10
Minutein pins Fine Science Tools 26002-10
1.5 ml  Microcentrifuge tubes; Seal Rite USA Scientific Inc. 1615-5500
Motorized Pestle; Talboys Laboratory Stirrer Troemner 103
Talboys High Throughput Homogenizer OPS Diagnostics 930145
5/32'' Grinding Balls OPS Diagnostics GBSS 156-5000-01
Vortex Genie Scientific indurstries inc. G560
Multichannel Pipettor (10 μl - 300 μl) Sartorius 730360
WASP2 Whitley Automated Spiral Plater Microbiology International
ProtoCOL automated colony counter / plate counter/ plate reader  Microbiology International
TRIzol Life Technologies 15596-026
qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips Bio-Rad TLS0801
qPCR caps; Optical Flat 8-Cap Strips Bio-Rad TCS0803
RQ1 RNase-Free DNase Promega m610a
M-MLV Reverse Transcriptase Promega m170b
dNTPs Promega U1240
Oligo-dT IDT
 SsoAdvanced SYBR Green Supermix Bio-Rad 172-5260
CFX Connect Real-Time PCR Detection System Bio-Rad 185-5200
RNasin Ribonuclease Inhibitor Promega N2115

DOWNLOAD MATERIALS LIST

References

  1. Lemaitre, B., Hoffmann, J. The host defense of Drosophila melanogaster. Annual review of immunology. 25, 697-743 (2007).
  2. Dionne, M. S., Schneider, D. S. Models of infectious diseases in the fruit fly Drosophila melanogaster. Disease models & mechanisms. 1, (1), 43-9 (2008).
  3. Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity. 12, (5), 569-580 (2000).
  4. Ayres, J. S., Freitag, N., Schneider, D. S. Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection. Genetics. 178, (3), 1807-1815 (2008).
  5. Cronin, S. J. F., et al. Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection. Science. 325, (5938), 340-343 (2009).
  6. Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. Methods to study Drosophila immunity. Methods. (2014).
  7. Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila. Current biology CB. 16, (20), 1977-1985 (2006).
  8. McKean, K. a, Yourth, C. P., Lazzaro, B. P., Clark, A. G. The evolutionary costs of immunological maintenance and deployment. BMC evolutionary biology. 8, (1), 76 (2008).
  9. Kuo, T. -H., Pike, D. H., Beizaeipour, Z., Williams, J. A. Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish. BMC neuroscience. 11, 17 (2010).
  10. Panayidou, S., Ioannidou, E., Apidianakis, Y. Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings. Virulence. 5, (2), 253-269 (2014).
  11. Keebaugh, E. S., Schlenke, T. A. Insights from natural host–parasite interactions: The Drosophila model. Developmental & Comparative Immunology. 42, (1), 111-123 (2014).
  12. Howick, V. M., Lazzaro, B. P. Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection. BMC evolutionary biology. 14, (1), 56 (2014).
  13. Babin, A., Kolly, S., Kawecki, T. J. Virulent bacterial infection improves aversive learning performance in Drosophila. Brain, behavior, and immunity. (2014).
  14. Chambers, M. C., Song, K. H., Schneider, D. S. Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster. PLoS ONE. 7, (12), e50679 (2012).
  15. Fellous, S., Lazzaro, B. P. Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition. Molecular ecology. 19, (7), 1462-1468 (2010).
  16. Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila. PLoS pathogens. 8, (1), e1002445 (2012).
  17. Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. Thorax injury lowers resistance to infection in Drosophila melanogaster. Infection and immunity. (2014).
  18. Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. A practical guide to understanding Kaplan-Meier curves. Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143, (3), 331-336 (2010).
  19. Freeman, W. H. Biometry. (1995).
  20. Frydman, H. Wolbachia bacterial infection in Drosophila. Journal of visualized experiments JoVE. (2), 158 (2007).
  21. Kuo, T. -H., Handa, A., Williams, J. A. Quantitative measurement of the immune response and sleep in Drosophila. Journal of visualized experiments JoVE. (70), e4355 (2012).
  22. Vodovar, N., et al. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proceedings of the National Academy of Sciences of the United States of America. 102, (32), 11414-11419 (2005).
  23. Nehme, N. T., et al. A model of bacterial intestinal infections in Drosophila melanogaster. PLoS pathogens. 3, (11), e173 (2007).
  24. Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. Interspecific transmission of endosymbiotic Spiroplasma by mites. Biology. 3, (1), 23-25 (2007).
  25. Kanbar, G., Engels, W. Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites. Parasitology research. 90, (5), 349-354 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics