सेल पारगम्य Cys का प्रयोग स्तनधारी कोशिकाओं को सीधे प्रोटीन डिलिवरी
1Departments of Chemistry and Cell and Molecular Biology, The Scripps Research Institute, 2Shanghai Institute for Advanced Immunochemical Studies, ShanghaiTech University
* These authors contributed equally

Published 3/25/2015
0 Comments
  CITE THIS  SHARE 
Biology

You must be subscribed to JoVE to access this content.

Fill out the form below to receive a free trial:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit," you agree to our policies.

 

Summary

जिंक उंगली डोमेन के आंतरिक रूप से सेल पारगम्य और स्तनधारी सेल प्रकार की एक विस्तृत रेंज में प्रोटीन वितरण मध्यस्थता करने में सक्षम हैं। इधर, intracellular प्रोटीन प्रसव के लिए जिंक उंगली प्रौद्योगिकी को लागू करने के लिए एक विस्तृत कदम-दर-कदम प्रोटोकॉल प्रस्तुत किया है।

Cite this Article

Copy Citation

Gaj, T., Liu, J. Direct Protein Delivery to Mammalian Cells Using Cell-permeable Cys2-His2 Zinc-finger Domains. J. Vis. Exp. (97), e52814, doi:10.3791/52814 (2015).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

अत्यधिक कुशल और बहुमुखी प्रोटीन वितरण रणनीतियों कई बुनियादी अनुसंधान और चिकित्सीय अनुप्रयोगों के लिए महत्वपूर्ण हैं। कोशिकाओं में शुद्ध प्रोटीन के प्रत्यक्ष वितरण इस को प्राप्त करने के लिए सबसे सुरक्षित और आसान तरीकों में से एक। 1,2 न्यूक्लिक एसिड से जीन अभिव्यक्ति पर भरोसा रणनीति है कि विपरीत का प्रतिनिधित्व करता है, 3-5 प्रोटीन वितरण insertional उत्परिवर्तजनन का कोई खतरा बना हुआ है, से स्वतंत्र है सेलुलर प्रतिलेखन / अनुवाद मशीनरी और एक तत्काल प्रभाव के लिए अनुमति देता है। हालांकि, प्रोटीन पर सेल मर्मज्ञ गतिविधि endowing के लिए सरल और generalizable के तरीकों की कमी के कारण नियमित रूप से कोशिकाओं में उनके सीधे प्रवेश घालमेल कर दिया। इंट्रासेल्युलर प्रोटीन प्रसव की सुविधा के लिए मौजूदा तरीकों को स्वाभाविक रूप से 6-8 या डिजाइन सेल मर्मज्ञ पेप्टाइड्स, 9-12 सुपरचार्ज पारगमन डोमेन, 13,14 नैनोकणों 15 और liposomes, 16 वायरस कणों की तरह 17,18 होने वाली के उपयोग पर आधारित हैं 19 दुर्भाग्य से, इन तरीकों में से बहुत कम सेलुलर तेज दरें, 20,21 गरीब स्थिरता, 22 अनजाने सेल प्रकार विशिष्टता, 23 कम endosomal भागने गुणों 24 और इसके अलावा विषाक्तता। 25 के द्वारा बाधा उत्पन्न कर रहे हैं, कई प्रोटीन पारगमन प्रौद्योगिकियों वितरित प्रोटीन की bioactivity कम। 14

हमारी प्रयोगशाला में पहले कि जस्ता उंगली nuclease का प्रदर्शन (ZFN) प्रोटीन - चिमेरिक प्रतिबंध एक प्रोग्राम Cys दो -His दो जस्ता उंगली डीएनए बाध्यकारी प्रोटीन और FokI प्रतिबंध endonuclease 26-28 की दरार डोमेन से मिलकर endonucleases - स्वाभाविक सेल कर रहे हैं पारगम्य। 29 यह आश्चर्य की बात सेल मर्मज्ञ गतिविधि कस्टम डिजाइन जस्ता उंगली डोमेन, लक्षित जीनोम एन के लिए एक शक्तिशाली उपकरण के रूप में उभरा है कि एक डीएनए बाध्यकारी मंच का अभिन्न संपत्ति होना दिखाया गया थाgineering, 30-32 और माना प्रोटीन सतह पर छह सकारात्मक आरोप लगाया अवशेषों के नक्षत्र का नतीजा हो। दरअसल, सी-जून और एन-Dek सहित कई डीएनए बाध्यकारी प्रोटीन,। कोशिका झिल्ली को पार करने के लिए एक सहज क्षमता के अधिकारी दिखाया गया है 33 हाल ही में, हमारी प्रयोगशाला इन परिणामों पर विस्तार किया है और दिखा दिया कि zinc- की सेल-मर्मज्ञ गतिविधि उंगली (ZIF) डोमेन इंट्रासेल्युलर प्रोटीन प्रसव के लिए leveraged किया जा सकता है। कई पारंपरिक सेल मर्मज्ञ पेप्टाइड वितरण प्रणाली को पार कर कि क्षमता तेज करने के लिए नेतृत्व विशिष्ट प्रोटीन कार्गो के लिए एक या दो उंगली ZIF डोमेन के लिए या तो जेनेटिक संलयन। 34 सबसे विशेष रूप से, ZIF की मध्यस्थता वितरण इनकार एंजाइमी कार्गो की गतिविधि समझौता और मदद की नहीं था साइटोसोलिक प्रसव के उच्च स्तरों। सामूहिक रूप से, इन निष्कर्षों प्रोटीन के कुशल और सतही प्रसव की सुविधा के लिए ZIF डोमेन के संभावित प्रदर्शन, और मैक्रो का संभवत: अधिक विविध प्रकारकोशिकाओं में अणुओं।

इधर, स्तनधारी कोशिकाओं में प्रोटीन प्रसव के लिए ZIF प्रौद्योगिकी को लागू करने पर एक विस्तृत कदम-दर-कदम प्रोटोकॉल प्रस्तुत किया है। हम पहले के एक कमरे का निर्माण एक, दो, तीन, चार, पांच और छह उंगली कारण α-पेचदार डीएनए बाध्यकारी अवशेषों में से प्रत्येक के प्रतिस्थापन के लिए, डीएनए बाध्य करने के लिए क्षमता की कमी है कि ZIF डोमेन, लेकिन कोशिकाओं 34 (चित्रा 1) में प्रोटीन देने में सक्षम हैं। एक दो उंगली ZIF डोमेन का उपयोग कर हेला कोशिकाओं में पन्ना GFP (EmGFP) के उत्पादन और पारगमन में वर्णित है। इस प्रोटोकॉल Escherichia कोलाई में घुलनशील अभिव्यक्ति और लगभग किसी भी स्तनधारी सेल प्रकार में सक्षम लगभग किसी भी प्रोटीन के लिए एक्स्टेंसिबल है। अपेक्षित परिणाम प्रदान की जाती हैं और इस प्रणाली के प्रदर्शन को अधिकतम करने के लिए रणनीतियों पर भी चर्चा कर रहे हैं।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. क्लोनिंग

  1. पीईटी-28 अभिव्यक्ति वेक्टर प्रणाली में क्लोन उप और अनुरोध (पीईटी-2 एफ-ZIF) पर उपलब्ध हैं किया गया है कि alanine-एवजी दो उंगली ZIF डोमेन के प्राप्त करते हैं। 34
  2. पीसीआर प्राइमरों के साथ प्लाज्मिड पन्ना-pBAD से EmGFP बढ़ाना 5 'XmaI-EmGFP (5'-GGAAATTG CCCGGG ATGGTGAGCAAGGGCGAGGAGCTGTTCAC -3'; बोल्ड में XMA मैं साइट) और 3 'SACI-EmGFP (5'-CGGATCT GAGCTC TTACTTGTACAGCTCGTCCATGCCGAG-3' ; बोल्ड में सैक मैं साइट)।
    1. टेम्पलेट डीएनए के 5 एनजी, 10x पोलीमरेज़ बफर के 10 μl, आसुत / विआयनीकृत पानी से बना एक Taq डीएनए पोलीमरेज़, 0.2 मिमी प्रत्येक dNTP की इकाइयों (यू) और शेष मात्रा के साथ एक 100 μl समाधान में प्रत्येक प्राइमर के 0.2 माइक्रोन का प्रयोग करें । साइकिल चालन की स्थिति का उपयोग करें: 5 मिनट के लिए 95 डिग्री सेल्सियस; 30 सेकंड के लिए 95 डिग्री सेल्सियस के 30 चक्र, 30 सेकंड के लिए 55 डिग्री सेल्सियस और 1 मिनट के लिए 72 डिग्री सेल्सियस; 10 मिनट के लिए 72 डिग्री सेल्सियस। जेल extracti द्वारा पीसीआर उत्पाद शुद्धपर और पेट 260 X 50 माइक्रोग्राम प्रति मिलीग्राम / मापने एक स्पेक्ट्रोफोटोमीटर का उपयोग डीएनए एकाग्रता का निर्धारण।
  3. डाइजेस्ट पीईटी-2 एफ-ZIF और प्रतिबंध के साथ EmGFP एन्कोडिंग डालने के डीएनए के एक माइक्रोग्राम प्रति प्रति एंजाइम की 10 यू का उपयोग कर 37 डिग्री सेल्सियस पर 3 घंटे के लिए सिफारिश की बफर में XMA मैं और सैक मैं एंजाइमों। ऐसे ethidium ब्रोमाइड के रूप में एक फ्लोरोसेंट intercalating डाई का उपयोग agarose जेल वैद्युतकणसंचलन ने डीएनए कल्पना।
  4. जेल निकालना किट से पचा डीएनए शुद्ध और ABS के 260 X 50 माइक्रोग्राम प्रति मिलीग्राम / मापने एक स्पेक्ट्रोफोटोमीटर द्वारा डीएनए एकाग्रता का निर्धारण।
  5. आरटी पर कम से कम एक घंटे के लिए टी -4 डीएनए ligase की एक यू का उपयोग कर पालतू पशु-2 एफ-ZIF के 50-100 एनजी में शुद्ध EmGFP एन्कोडिंग डीएनए ligate। एक डालने के लिए-वेक्टर दाढ़ अनुपात: सर्वश्रेष्ठ परिणामों के लिए, एक 6 का उपयोग कर बंधाव प्रतिक्रिया करते हैं।
  6. बर्फ पर किसी भी रासायनिक सक्षम XL -1 ब्लू Escherichia कोलाई कोशिकाओं के 50 μl पिघलना और 10-20 एनजी ligated पीईटी-2 एफ-ZIF-EmGFP के साथ धीरे मिश्रण।
  7. 3 के लिए बर्फ पर रखें0 मिनट। गर्मी झटका 90 सेकंड के लिए 42 डिग्री सेल्सियस पर मिश्रण और झटकों के साथ 37 डिग्री सेल्सियस पर 1 घंटे के लिए Catabolite दमन (समाज) के साथ सुपर इष्टतम शोरबा के 2 मिलीलीटर में कोशिकाओं को ठीक।
  8. 50 माइक्रोग्राम प्रति मिलीग्राम / केनामाइसिन के साथ एक lysogeny शोरबा (पौंड) अगर प्लेट पर वसूली संस्कृति के 100 μl बिखरा हुआ है और 37 डिग्री सेल्सियस पर हे / एन सेते हैं।
  9. अगले दिन, सुपर शोरबा (एसबी) या 50 माइक्रोग्राम प्रति मिलीग्राम / केनामाइसिन 37 डिग्री सेल्सियस पर लेग अगर थाली और संस्कृति ओ / एन से एक कॉलोनी से युक्त लेग संस्कृति के 6 मिलीलीटर टीका लगाना।
    नोट: कॉलोनी पीसीआर प्राइमरों 5 'XmaI-EmGFP और 3' SACI-EmGFP का उपयोग कर Miniprep करने से पहले सकारात्मक क्लोन की पहचान करने के लिए इस्तेमाल किया जा सकता है।
  10. Miniprep द्वारा पीईटी-2 एफ-ZIF-EmGFP शुद्ध और T7 प्रमोटर का उपयोग डीएनए अनुक्रमण द्वारा प्लाज्मिड की पुष्टि (5'-TAATACGACTCACTATAGGG-3 ')।

2. अभिव्यक्ति और शोधन

  1. रासायनिक सक्षम BL21 के 50 μl पिघलना बर्फ पर कोलाई कोशिकाओं और पी एल पीईटी-2 एफ-ZIF-EmGFP के 100 एनजी के साथ धीरे मिश्रणasmid। चरणों 1.7-1.8 में वर्णित के रूप में रूपांतरण।
  2. अगले दिन, एक ही कॉलोनी के साथ 50 माइक्रोग्राम प्रति मिलीग्राम / केनामाइसिन युक्त लेग माध्यम के 10 एमएल टीका लगाना और झटकों के साथ 37 डिग्री सेल्सियस पर हे / एन बढ़ता है।
  3. अगले दिन, 50 माइक्रोग्राम प्रति मिलीग्राम / केनामाइसिन, 0.2% ग्लूकोज और 100 माइक्रोन ZnCl 2 के साथ पूरक लेग माध्यम के 1 एल में हे / एन संस्कृति के 10 एमएल पतला। 0.8 के 600 एनएम (आयुध डिपो 600) में एक ऑप्टिकल घनत्व के झटकों के साथ 37 डिग्री सेल्सियस पर संस्कृति विकसित करने और 2 मिमी isopropyl-β-डी-1-thiogalactopyranoside (IPTG) के साथ प्रोटीन की अभिव्यक्ति के लिए प्रेरित। 4 डिग्री सेल्सियस पर 10 मिनट के लिए 5000 XG पर centrifugation द्वारा 37 डिग्री सेल्सियस पर विकास के 6 घंटा, फसल कोशिकाओं के बाद।
    नोट: प्रेरण शर्तों अत्यधिक चर रहे हैं और व्यक्त की जा रही प्रोटीन की स्थिरता पर निर्भर करते हैं। 0.8 की 600 तक पहुँच जाता है एक आयुध डिपो तक 600 आयुध डिपो में हर 30 मिनट पर नज़र रखें।
  4. Lysis बफर के 5 एमएल (50 मिमी Tris-एचसीएल, 500 मिमी NaCl में सेल गोली Resuspend, 100 माइक्रोन ZnCl 2, 1 मीटरएम dithiothreitol (डीटीटी), 1 मिमी 2 MgCl, 1 मिमी phenylmethylsulfonyl फ्लोराइड (PMSF) और 10 मिमी imidazole, पीएच 8.0)। निम्नलिखित सेटिंग के साथ sonication द्वारा बर्फ पर Lyse कोशिकाओं: 50% बिजली उत्पादन, / 10 सेकंड बंद अंतराल पर 5 सेकंड के साथ 4 मिनट प्रक्रिया का समय है। समाधान overheating से बचें।
  5. 4 डिग्री सेल्सियस पर 30 मिनट के लिए 25,000 XG पर सेल lysate अपकेंद्रित्र और एक ताजा संग्रह ट्यूब में सतह पर तैरनेवाला हस्तांतरण। सर्वोत्तम परिणामों के लिए, 4 डिग्री सेल्सियस पर सभी निम्न चरणों का प्रदर्शन करते हैं।
  6. एक कॉलम equilibrated नी NTA घोल का 1 मिलीलीटर के साथ पूर्व पैक के माध्यम से सतह पर तैरनेवाला चलाएँ। धोने बफर के 20 मिलीलीटर (50 मिमी Tris-एचसीएल, 500 मिमी NaCl, 100 माइक्रोन ZnCl 2, 1 मिमी डीटीटी, 1 मिमी 2 MgCl और 30 मिमी imidazole, पीएच 8.0) के साथ राल धो लें।
  7. 5 क्षालन बफर के मिलीलीटर (50 मिमी Tris-एचसीएल, 500 मिमी NaCl, 100 माइक्रोन ZnCl 2, 1 मिमी डीटीटी, 1 मिमी 2 MgCl, और 300 मिमी imidazole, पीएच 8.0) के साथ प्रोटीन elute।
  8. बफर भंडारण बफर के साथ eluted प्रोटीन (50 मिमी का आदान-प्रदानTris-एचसीएल, 500 मिमी NaCl, 100 माइक्रोन ZnCl 2, 1 मिमी डीटीटी, 1 मिमी 2 MgCl और 10% ग्लिसरॉल, पीएच 8.0) और निर्माता के निर्देशों के अनुसार centrifugation द्वारा एक स्पिन concentrator का उपयोग कम से कम 40 माइक्रोन के लिए प्रोटीन ध्यान।
  9. बीसीए या ब्रैडफोर्ड परख द्वारा प्रोटीन एकाग्रता का निर्धारण। 10 मिनट के लिए 95 डिग्री सेल्सियस पर 2 μl 2 × एसडीएस पृष्ठ लोडिंग डाई, फोड़ा साथ शुद्ध प्रोटीन की 2 μl मिक्स और फिर 4% पर प्रोटीन पवित्रता (चित्रा 2) का आकलन करने के लिए -20% Tris-Glycine एसडीएस पृष्ठ को हल।

3. प्रोटीन का भंडारण

  1. -80 डिग्री सेल्सियस पर तरल नाइट्रोजन और दुकान में केंद्रित प्रोटीन, फ्लैश फ्रीज विभाज्य। EmGFP संलयन प्रोटीन के लिए, प्रकाश से प्रोटीन की रक्षा के लिए एल्यूमीनियम पन्नी के साथ ट्यूब को कवर किया।
  2. दोहराया ठंड और प्रोटीन समाधान के विगलन से बचें। नोट: ZIF-दूसरे से जुड़ने प्रोटीन कम से कम एक महीने के लिए इन शर्तों के तहत स्थिर रहे हैं। अनुचित या> 4 माह भंडारण नेतृत्व कर सकते हैंप्रोटीन तेज़ी या EmGFP की photobleaching करने के लिए।

4. प्रोटीन पारगमन

  1. 10% से युक्त Dulbecco संशोधित ईगल मध्यम (DMEM) में हेला कोशिकाओं को बनाए रखने (वी / वी) भ्रूण गोजातीय सीरम (FBS) और 1% एंटीबायोटिक antimycotic 5% सीओ 2 के साथ एक पूरी तरह से humidified माहौल में 37 डिग्री सेल्सियस पर।
    नोट: कोशिकाओं को अधिक से अधिक 30 बार प्रोटीन पारगमन के लिए सिफारिश नहीं कर रहे passaged।
  2. प्री-कोट 25 डिग्री सेल्सियस पर 30 मिनट से 60 के लिए पाली lysine के 50 माइक्रोग्राम प्रति / एमएल के 500 μl के साथ एक 24 अच्छी तरह से थाली। अच्छी तरह से प्रति 2 × 10 5 कोशिकाओं के घनत्व पर एक 24 अच्छी तरह से थाली पर बीज कोशिकाओं। कोशिकाओं 80% के बीच -90% मिला हुआ हैं एक बार बोने के बाद 24 घंटे से कम, या, अच्छी तरह से प्रत्येक से मीडिया को दूर करने और पूर्व गर्म सीरम मुक्त DMEM के 500 μl (SFM) से धो लें।
  3. प्रत्येक अच्छी तरह से करने के लिए, SFM के 250 μl ZIF-EmGFP प्रोटीन के दो माइक्रोन और 100 माइक्रोन ZnCl दो युक्त जोड़ें। 1 घंटे के लिए 37 डिग्री सेल्सियस पर कोशिकाओं को सेते हैं। नोट: ZIF डोमेन के कोशिकाओं में प्रवेश जनसंपर्कimarily एक ऊर्जा पर निर्भर तंत्र है जो macropinocytosis, 34 के माध्यम से। इसलिए, कोशिकाओं कुशल प्रोटीन internalization के लिए 37 डिग्री सेल्सियस पर incubated किया जाना चाहिए।
  4. कैल्शियम और मैग्नीशियम से मुक्त के 500 μl के साथ तीन बार कोशिकाओं से मीडिया निकालें और धोने है Dulbecco फॉस्फेट बफर खारा हेपरिन की 0.5 मिलीग्राम / एमएल के साथ पूरक (DPBS)। नोट: हेपरिन बहाव के विश्लेषण को मुश्किल हो सकती है कि सतह बाध्य प्रोटीन को हटाने के लिए आवश्यक है।
  5. बढ़ाया प्रसव के लिए तीन गुना तक (वैकल्पिक) दोहराएँ उपचार।
  6. तुरंत दो मिनट के लिए 37 डिग्री सेल्सियस पर 0.05% trypsin-EDTA के साथ पाचन से धोने हेपरिन के बाद इलाज कोशिकाओं को अलग। 1% FBS के साथ पूरक DPBS के 0.5 मिलीलीटर में अलग कोशिकाओं फिर से निलंबित।
  7. Fluorescein आइसोथियोसाइनेट (FITC) चैनल (चित्रा 3) का उपयोग कर 35 प्रवाह cytometry द्वारा प्रत्येक नमूने की प्रतिदीप्ति तीव्रता को मापने। की आबादी स्थान के लिए आगे तितर बितर (FSC) और पक्ष तितर बितर (एसएससी) को समायोजित करेंविभिन्न गुणों के साथ आबादी एक दूसरे से हल कर रहे हैं कि यह सुनिश्चित करने पैमाने पर ब्याज,।
  8. प्रत्येक नमूने के लिए 10,000 जीने की घटनाओं लीजिए और केवल SFM के साथ इलाज उन कोशिकाओं को ZIF-EmGFP के साथ इलाज HELA कोशिकाओं से डेटा विश्लेषण सॉफ्टवेयर। 36 मानक के अनुसार प्रतिदीप्ति प्रवाह cytometry का उपयोग कर डेटा का विश्लेषण।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

दो उंगली ZIF-EmGFP संलयन प्रोटीन में व्यक्त किया जा सकता है कोलाई> 95% एकरूपता और उच्च पैदावार के साथ (> 25 मिलीग्राम / एमएल) (चित्रा 2)। सामान्य एक और दो उंगली में ZIF संलयन प्रोटीन जंगली प्रकार असंशोधित प्रोटीन के उन लोगों के लिए लगभग समान मात्रा में उत्पादन किया जा सकता है। हालांकि, कुछ संदर्भों में, पांच और छह उंगली ZIF संलयन प्रोटीन बहाव के अनुप्रयोगों के लिए पर्याप्त उच्च पैदावार में उत्पादन किया जा करने में असमर्थ हैं।

37 डिग्री सेल्सियस पर 90 मिनट के लिए हेला कोशिकाओं पर दो उंगली ZIF-EmGFP प्रोटीन के प्रत्यक्ष आवेदन EmGFP प्रतिदीप्ति (चित्रा 3A) में एक खुराक पर निर्भर वृद्धि हो जाती है। गंभीर, कोई प्रतिदीप्ति ZIF डोमेन के अभाव में मनाया जाता है। हम पहले से कोशिकाओं के लगभग 100% केवल 2 माइक्रोन दो उंगली ZIF-EmGFP प्रोटीन के साथ उपचार के बाद फ्लोरोसेंट रहे हैं कि मनाया, और ZIF संलयन प्रोटीन के साथ इलाज HELA कोशिकाओं में प्रोटीन सांद्रता में EmGFP प्रतिदीप्ति के लिए सकारात्मक रहे हैं कि के रूप में कम 0.25 के रूप में माइक्रोन (3B चित्रा)।

चित्र 1
चित्रा 1. संरचना और जस्ता उंगली प्रोटीन के अनुक्रम। एक एकल जस्ता उंगली (ZIF) डोमेन की (टॉप) क्रिस्टल संरचना। । Zn + 2 के साथ समन्वित संरक्षित Cys और उनके अवशेषों के पक्ष श्रृंखला आयन चिपक (PDB आईडी: 2I13) के रूप में दिखाया जाता है ZIF डोमेन के 37 (नीचे) अनुक्रम। तीर और सिलेंडरों क्रमश: Β-चादर और α-हेलिक्स माध्यमिक संरचनाओं का संकेत मिलता है। एलनाइन के साथ प्रतिस्थापित किया गया है कि α-पेचदार डीएनए बाध्यकारी अवशेषों गुलाबी डाला जाता है। सेल internalization के लिए मध्यस्थता करने के लिए भविष्यवाणी की सकारात्मक आरोप लगाया अवशेषों हल्के नीले रंग डाला जाता है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

"के लिए: रख-together.within पृष्ठ =" हमेशा "> चित्र 2
एक, दो, तीन और चार उंगली ZIF-EmGFP संलयन प्रोटीन। ZIF-EmGFP संलयन प्रोटीन में व्यक्त किया गया शुद्ध किया चित्रा 2. एसडीएस पृष्ठ कोलाई और नी NTA agarose राल द्वारा शुद्ध। Eluted प्रोटीन एक 4% -20% Tris-Glycine जेल का उपयोग एसडीएस पृष्ठ से शुद्धता के लिए विश्लेषण किया गया था। कोई महत्वपूर्ण गिरावट या ZIF-EmGFP संलयन प्रोटीन की truncations मनाया गया।

चित्र तीन
चित्रा 3. हेला कोशिकाओं में प्रोटीन वितरण ZIF की मध्यस्थता। दो उंगली ZIF-EmGFP प्रोटीन की मात्रा में वृद्धि के साथ इलाज HELA कोशिकाओं (ए) प्रतिदीप्ति तीव्रता। EmGFP प्रोटीन के साथ इलाज HELA कोशिकाओं अकेले अनुपचारित कोशिकाओं के साथ पूरी तरह से ओवरलैप। (बी) 2 माइक्रोन ओ के साथ लगातार इलाज किया HELA कोशिकाओं की सामान्यीकृत प्रतिदीप्ति तीव्रताएफ दो उंगली ZIF-EmGFP प्रोटीन। प्रतिदीप्ति तीव्रता फ्लो द्वारा निर्धारित किया गया था।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

इधर, सेल पारगम्य जस्ता उंगली (ZIF) डोमेन का उपयोग प्रोटीन वितरण के लिए एक कदम दर कदम प्रोटोकॉल प्रस्तुत किया है। ZIF डोमेन इनकार एंजाइमी कार्गो 34 की गतिविधि को कम नहीं करता है; उत्पादन और असंशोधित प्रोटीन के साथ मनाया उन लोगों के लिए लगभग समान पैदावार में प्रोटीन की शुद्धि के लिए अनुमति देता है; और पारंपरिक सेल मर्मज्ञ पेप्टाइड या प्रोटीन पारगमन डोमेन सिस्टम को पार करते क्षमता के साथ सेल प्रकार की एक विस्तृत श्रृंखला में प्रोटीन और एंजाइम परिवहन कर सकते हैं। साथ में, इन निष्कर्षों आवेदनों की एक विस्तृत श्रृंखला के लिए कोशिकाओं में प्रत्यक्ष प्रोटीन वितरण मध्यस्थता के लिए ZIF डोमेन की व्यापक क्षमता का संकेत मिलता है।

अधिकतम प्रोटीन वितरण पहले से अधिक से अधिक सकारात्मक चार्ज ले तीन और चार उंगली ZIF डोमेन की सरणियों बढ़ाया है कि इस तथ्य के बावजूद है, केवल एक दो उंगली ZIF डोमेन का उपयोग कर हासिल की थी। इन निष्कर्षों ZIF की मध्यस्थता सेल प्रविष्टि प्रभारी, इंक के अलावा अन्य कारकों से प्रभावित हो सकता है कि संकेत मिलता हैप्रोटीन स्थिरता या गठनात्मक कठोरता luding। ZIF डोमेन मध्यस्थता प्रोटीन वितरण भी ऊर्जा पर निर्भर हो पाया है और इस तरह के प्रोटीन के साथ इलाज सभी कोशिकाओं को 37 डिग्री सेल्सियस पर incubated की आवश्यकता है कि गया था। विभिन्न endocytic रास्ते, macropinocytosis के छोटे अणु inhibitors के उपयोग के माध्यम से, और एक हद तक कम caveolin निर्भर endocytosis के लिए, ZIF की मध्यस्थता सेल प्रवेश के लिए प्रमुख रास्ते होने के लिए निर्धारित किया गया। 34 विशेष रूप से, अन्य प्रोटीन पारगमन प्रणालियों के विपरीत, ZIF डोमेन हैं कुशलतापूर्वक, जुड़े macromolecular कार्गो की साइटोसोलिक प्रसव के उच्च स्तर पर मध्यस्थता करने endosomes भागने मजबूत प्रोटीन वितरण को प्राप्त करने के लिए इन डोमेन के संभावित रेखांकित करने में सक्षम।

हमारे अनुभव में, कोशिकाओं के बोने घनत्व प्रोटीन पारगमन के उच्च स्तर को प्राप्त करने के लिए एक महत्वपूर्ण कदम है। हम वे 80% -90% confluency तक पहुँचने के लिए एक बार कोशिकाओं के इलाज और पहले से मनाया अनुशंसा करते हैं कि> 95% confluency शो उप वरीयता प्राप्त कोशिकाओंइष्टतम पारगमन क्षमता, कम घनत्व (<50%) पर वरीयता प्राप्त कोशिकाओं में प्रोटीन प्रेरित विषाक्तता के लिए अतिसंवेदनशील होते हैं। महत्वपूर्ण बात है, उच्च टुकड़ी प्रवृत्तियों के साथ प्रकार की कोशिकाओं के लिए, सेल संस्कृति प्लेटों पाली lysine साथ पूर्व लेपित सिफारिश कर रहे हैं। पाली lysine नकारात्मक आरोप लगाया सेल सतह घटकों के साथ बातचीत electrostatic सेल के माध्यम से लगाव की सुविधा। प्रत्येक ZIF डोमेन के α-पेचदार डीएनए बाध्यकारी अवशेष डीएनए मान्यता के लिए किसी भी संभावित खत्म करने के लिए हटा दिया गया है हालांकि, ΒΒα ZIF डोमेन गुना स्थिर करने के लिए Zn के 2 + आयन के साथ समन्वय कि सिस्टीन और हिस्टडीन अवशेषों बरकरार रहेगा। इस प्रकार, हम किसी भी भंडारण बफर प्रोटीन अखंडता बनाए रखने के लिए ZnCl 2 के कम से कम 100 माइक्रोन के साथ पूरक हो कि सलाह देते हैं।

ZIF डोमेन पहले से सेल प्रकार की एक किस्म में प्रोटीन और एंजाइम देने के लिए दिखाया गया था हालांकि, ZIF वितरण की दक्षता में भी दोनों macromo पर निर्भर हो सकता हैlecular कार्गो और प्रोटीन एकाग्रता। उदाहरण के लिए, कोशिकाओं को दो उंगली ZIF-luciferase संलयन प्रोटीन के साथ इलाज किया कोशिकाओं दो उंगली के साथ व्यवहार किया है, जबकि उच्च सांद्रता में कम गतिविधि के साथ, 0.5 माइक्रोन प्रोटीन के साथ इलाज किया जब अधिकतम luminescence प्रदर्शित करने के लिए मनाया गया EmGFP प्रतिदीप्ति में एक खुराक पर निर्भर वृद्धि का प्रदर्शन तीव्रता 8.0 माइक्रोन प्रोटीन पर निर्भर है, और लगातार प्रोटीन उपचार पर। इसलिए हम सांद्रता की एक सीमा के पार एक अद्वितीय ZIF डोमेन संलयन की सेल मर्मज्ञ क्षमता का मूल्यांकन करने की सलाह देते हैं।

अभी तक का प्रदर्शन नहीं है, हालांकि अंत में, हम ZIF डोमेन वितरण कोशिकाओं में अणुओं की एक विविध सरणी देने में सक्षम एक अत्यंत लचीला मंच है, आशा करते हैं कि। डीएनए और आरएनए दोनों रासायनिक एक hydrolyzable लिंकर के माध्यम से ZIF डोमेन की सतह पर क्रियाशील, या क्षणिक ZIF डोमेन के encapsulation के द्वारा कोशिकाओं में ट्रांसफ़ेक्ट जा करने के लिए उदाहरण के लिए, यह संभव हो सकता है। इसके अतिरिक्त, efficiZIF प्रोटीन वितरण के ency आगे सतह प्रभारी अनुकूलन पर ध्यान केंद्रित तर्कसंगत डिजाइन के प्रयासों से बढ़ाया जा सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ भी नहीं है।

Acknowledgements

यह काम और ShanghaiTech विश्वविद्यालय, शंघाई, चीन (DP1CA174426 कार्लोस एफ Barbas करने के लिए) (जीएल करने के लिए) के राष्ट्रीय स्वास्थ्य संस्थान द्वारा समर्थित किया गया। आण्विक ग्राफिक्स PyMol का उपयोग कर उत्पन्न किया गया।

Materials

Name Company Catalog Number Comments
XmaI New England Biolabs R0180L
SacI New England Biolabs R0156L
Expand High Fidelity PCR system Roche 11759078001
dNTPs New England Biolabs N0446S
4%-20% Tris-Glycine Mini protein gels, 1.5 mm, 10 wells Life Technologies EC6028BOX
2x Laemmli Sample Buffer BioRad 161-0737
T4 DNA Ligase Life Technologies 15224-017
BL21 (DE3) Competent E. coli New England Biolabs C2527I
IPTG Thermo Scientific R0391
Zinc Chloride Sigma-Aldrich 208086-5G
Kanamycin Sulfate Fisher Scientific BP906-5
Glucose Sigma-Aldrich G8270-100G
Tris Base Fisher Scientific BP152-25
Sodium Chloride Sigma-Aldrich S9888-25G
DTT Fisher Scientific PR-V3151 
PMSF Thermo Scientific 36978
Ni-NTA Agarose Resin QIAGEN 30210
Glycerol Sigma-Aldrich G5516-500ML
Imidazole Sigma-Aldrich I5513-25G
Amicon Ultra-15 Centrifugal Filter Units EMO Millipore UFC900324
DMEM Life Technologies 11966-025
Fetal Bovine Serum Life Technologies 10437-028
Antibiotic-Antimycotic  Life Technologies 15240-062
24-Well Flat Bottom Plate Sigma-Aldrich CLS3527-100EA
Poly-Lysine Sigma-Aldrich P7280
DPBS, No Calcium, No Magnesium Life Technologies 21600010
Heparan Sulfate Sigma-Aldrich H4777
Trypsin Life Technologies 25300054
HeLa cells ATCC CCL-2
Nano Drop ND-1000 spectrophotometer  Thermo Fisher Scientific
QIAquick PCR Purification Kit QIAGEN 28104
QIAquick Gel Extraction Kit QIAGEN 28704

DOWNLOAD MATERIALS LIST

References

  1. Berg, A., Dowdy, S. F. Protein transduction domain delivery of therapeutic macromolecules. Curr. Opin. Biotechnol. 22, 888-893 (2011).
  2. Lindsay, M. A. Peptide-mediated cell delivery: application in protein target validation. Curr. Opin. Pharmacol. 2, 587-594 (2002).
  3. Luo, D., Saltzman, W. M. Synthetic DNA delivery systems. Nat. Biotechnol. 18, 33-37 (2000).
  4. Guo, X., Huang, L. Recent advances in nonviral vectors for gene delivery. Acc. Chem. Res. 45, 971-979 (2012).
  5. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  6. Frankel, A. D., Pabo, C. O. Cellular uptake of the tat protein from human immunodeficiency virus. Cell. 55, 1189-1193 (1988).
  7. Elliott, G., O'Hare, P. Intercellular trafficking and protein delivery by a herpesvirus structural protein. Cell. 88, 223-233 (1997).
  8. Derossi, D., Joliot, A. H., Chassaing, G., Prochiantz, A. The third helix of the Antennapedia homeodomain translocates through biological membranes. J. Biol. Chem. 269, 10444-10450 (1994).
  9. Smith, B. A., et al. Minimally cationic cell-permeable miniature proteins via alpha-helical arginine display. J. Am. Chem. Soc. 130, 2948-2949 (2008).
  10. Daniels, D. S., Schepartz, A. Intrinsically cell-permeable miniature proteins based on a minimal cationic PPII motif. J. Am. Chem. Soc. 129, 14578-14579 (2007).
  11. Karagiannis, E. D., et al. Rational design of a biomimetic cell penetrating peptide library. ACS Nan. 7, 8616-8626 (2013).
  12. Gao, S., Simon, M. J., Hue, C. D., Morrison, B., 3r,, Banta, S. An unusual cell penetrating peptide identified using a plasmid display-based functional selection platform. ACS Chem. Biol. 6, 484-491 (2011).
  13. Fuchs, S. M., Raines, R. T. Arginine grafting to endow cell permeability. ACS Chem. Biol. 2, 167-170 (2007).
  14. Cronican, J. J., et al. Potent delivery of functional proteins into mammalian cells in vitro and in vivo using a supercharged protein. ACS Chem. Biol. 5, 747-752 (2010).
  15. Panyam, J., Labhasetwar, V. Biodegradable nanoparticles for drug and gene delivery to cells and tissue. Adv. Drug Deliv. Rev. 55, 329-347 (2003).
  16. Zelphati, O., et al. Intracellular delivery of proteins with a new lipid-mediated delivery system. J. Biol. Chem. 276, 35103-35110 (2001).
  17. Kaczmarczyk, S. J., Sitaraman, K., Young, H. A., Hughes, S. H., Chatterjee, D. K. Protein delivery using engineered virus-like particles. Proc. Natl. Acad. Sci. U. S. A. 108, 16998-17003 (2011).
  18. Voelkel, C., et al. Protein transduction from retroviral Gag precursors. Proc. Natl. Acad. Sci. U. S. A. 107, 7805-7810 (2010).
  19. Sinha, V. R., Trehan, A. Biodegradable microspheres for protein delivery. J. Control Release. 90, 261-280 (2003).
  20. Liu, J., Gaj, T., Patterson, J. T., Sirk, S. J., Barbas, C. F. 3rd Cell-penetrating peptide-mediated delivery of TALEN proteins via bioconjugation for genome engineering. PLoS One. 9, e85755 (2014).
  21. Ramakrishna, S., et al. Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA. Genome Res. 24, 1020-1027 (2014).
  22. Fuchs, S. M., Raines, R. T. Polyarginine as a multifunctional fusion tag. Protein Sci. 14, 1538-1544 (2005).
  23. Mai, J. C., Shen, H., Watkins, S. C., Cheng, T., Robbins, P. D. Efficiency of protein transduction is cell type-dependent and is enhanced by dextran sulfate. J. Biol. Chem. 277, 30208-30218 (2002).
  24. Al-Taei, S., et al. Intracellular traffic and fate of protein transduction domains HIV-1 TAT peptide and octaarginine. Implications for their utilization as drug delivery vectors. Bioconjug. Chem. 17, 90-100 (2006).
  25. Jones, S. W., et al. Characterisation of cell-penetrating peptide-mediated peptide delivery. Br. J. Pharmacol. 145, 1093-1102 (2005).
  26. Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. Genome editing with engineered zinc finger nucleases. Nat. Rev. Genet. 11, 636-646 (2010).
  27. Carroll, D. Genome engineering with zinc-finger nucleases. Genetics. 188, 773-782 (2011).
  28. Guo, J., Gaj, T., Barbas, C. F. 3rd, 3rd, Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases. J. Mol. Biol. 400, 96-107 (2010).
  29. Gaj, T., Guo, J., Kato, Y., Sirk, S. J., Barbas, C. F. 3rd Targeted gene knockout by direct delivery of zinc-finger nuclease proteins. Nat. Methods. 9, 805-807 (2012).
  30. Gersbach, C. A., Gaj, T., Barbas, C. F. 3rd, 3rd, Synthetic zinc finger proteins: the advent of targeted gene regulation and genome modification technologies. Acc. Chem. Res. 47, 2309-2318 (2014).
  31. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  32. Perez-Pinera, P., Ousterout, D. G., Gersbach, C. A. Advances in targeted genome editing. Curr. Opin. Chem. Biol. 16, 268-277 (2012).
  33. Cronican, J. J., et al. A class of human proteins that deliver functional proteins into mammalian cells in vitro and in vivo. Chem. Biol. 18, 833-838 (2011).
  34. Gaj, T., Liu, J., Anderson, K. E., Sirk, S. J., Barbas, C. F., 3rd, Protein delivery using Cys2-His2 zinc-finger domains. ACS Chem. Biol. 9, 1662-1667 (2014).
  35. Radcliff, G., Jaroszeski, M. J. Basics of flow cytometry. Methods Mol. Biol. 91, 1-24 (1998).
  36. Mercer, A. C., Gaj, T., Sirk, S. J., Lamb, B. M., Barbas, C. F. 3rd Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors. ACS Synth. Biol. 3, 723-730 (2014).
  37. Segal, D. J., Crotty, J. W., Bhakta, M. S., Barbas, C. F. 3rd, Horton, N. C. Structure of Aart, a designed six-finger zinc finger peptide, bound to DNA. J. Mol. Biol. 363, 405-421 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats