Protein livraison directe aux cellules de mammifères en utilisant la cellule perméable Cys
1Departments of Chemistry and Cell and Molecular Biology, The Scripps Research Institute, 2Shanghai Institute for Advanced Immunochemical Studies, ShanghaiTech University
* These authors contributed equally

Published 3/25/2015
0 Comments
  CITE THIS  SHARE 
Biology

You must be subscribed to JoVE to access this content.

Fill out the form below to receive a free trial:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit," you agree to our policies.

 

Summary

Domaines à doigt de zinc sont intrinsèquement perméable cellule et capable de médier la délivrance de protéines dans une large gamme de types de cellules de mammifères. Ici, un protocole étape par étape détaillé pour la mise en œuvre de la technologie à doigt de zinc pour la livraison de protéine intracellulaire est présenté.

Cite this Article

Copy Citation

Gaj, T., Liu, J. Direct Protein Delivery to Mammalian Cells Using Cell-permeable Cys2-His2 Zinc-finger Domains. J. Vis. Exp. (97), e52814, doi:10.3791/52814 (2015).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

Très stratégies de prestation de protéines efficaces et polyvalents sont essentiels pour beaucoup la recherche fondamentale et les applications thérapeutiques. La livraison directe des protéines purifiées dans les cellules représente l'une des méthodes les plus sûres et les plus faciles pour atteindre cet objectif. 1,2 Contrairement aux stratégies qui se appuient sur ​​l'expression des gènes à partir d'acides nucléiques, 3-5 délivrance de protéines ne pose pas de risque de mutagenèse insertionnelle, est indépendante de la transcription / machinerie de traduction cellulaire et permet pour un effet immédiat. Cependant, le manque de méthodes simples et généralisables pour doter l'activité pénétrant dans les cellules sur des protéines confond régulièrement leur entrée directe dans les cellules. Les méthodes actuelles pour faciliter la délivrance de protéines intracellulaires sont basés sur l'utilisation d'origine naturelle ou conçus 08.06 peptides de pénétration cellulaire, 12.9 domaines de transduction suralimentés, 13,14 nanoparticules, des liposomes 15 et 16 particules pseudo-virales 17,18 19 Malheureusement, plusieurs de ces approches sont entravés par de faibles taux d'absorption cellulaire, 20,21 mauvaise stabilité, 22 par inadvertance spécificité de type cellulaire, 23 bas endosomales échappement propriétés 24 et la toxicité. 25 En outre, beaucoup de protéines technologies de transduction de réduire la bioactivité des protéines livrés. 14

Notre laboratoire précédemment démontré que la nucléase en doigt de zinc (ZFN) protéines - restriction endonucléases chimérique constitué d'un Cys 2 -His deux doigt de zinc protéine de liaison à l'ADN programmable et le domaine de clivage de l'endonucléase de restriction FokI 26-28 - sont intrinsèquement Cell- perméable. 29 Cette activité pénétrant les cellules-surprenant se est révélée être une propriété intrinsèque du domaine en doigt de zinc conçu sur mesure, une plate-forme de liaison à l'ADN qui a émergé comme un outil puissant pour génome ciblé eningé-, 30-32 et est considéré comme le résultat de la constellation de six résidus chargés positivement sur ​​la surface de la protéine. En effet, plusieurs protéines de liaison à l'ADN, y compris c-Jun et N-DEK ont été démontré qu'ils possèdent une capacité innée à traverser les membranes cellulaires. 33 Plus récemment, notre laboratoire élargi sur ces résultats et a démontré que l'activité pénétrant dans les cellules du zinc doigt (ZiF) domaines pourraient être mises à profit pour la livraison de protéine intracellulaire. Fusion génétique soit des domaines de ZIF une ou deux doigts à la cargaison de protéine spécifique conduit à l'absorption efficacité qui dépassaient de nombreux systèmes de livraison classiques de peptides de pénétration cellulaire. 34 Plus particulièrement, la livraison ZiF médiation n'a pas compromis l'activité de fret enzymatique fusionné et facilité des niveaux élevés de livraison cytosolique. Collectivement, ces résultats démontrent le potentiel du domaine ZiF pour faciliter la prestation efficace et facile de protéines, et potentiellement plus divers types de macromolécules, dans les cellules.

Ici, un protocole étape par étape détaillées sur la façon de mettre en œuvre la technologie ZIF pour la distribution des protéines dans les cellules de mammifères sont présentées. Nous avons déjà construit une suite de un, deux, trois, quatre, cinq et six doigt des domaines ZIF qui ne ont pas la capacité de lier l'ADN, en raison de la substitution de chacun des résidus de liaison à l'ADN α-hélicoïdale, mais sont capables de délivrer des protéines dans des cellules 34 (figure 1). La production et la transduction de Emerald GFP (EmGFP) dans des cellules HeLa en utilisant un domaine ZiF deux doigt est décrite. Ce protocole est extensible à presque ne importe quelle protéine soluble capable d'expression dans Escherichia coli et presque ne importe quel type de cellule de mammifère. Les résultats attendus sont fournis et des stratégies pour maximiser la performance de ce système sont également discutés.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Clonage

  1. Obtenir deux doigts domaines ZIF substitution alanine qui ont été sous-clonés dans le système de vecteur d'expression pET-28 et sont disponibles sur demande (PET-2F-ZiF). 34
  2. Amplifier par PCR à partir du plasmide EmGFP Emerald-pBAD avec les amorces 5 'Xmal-EmGFP (5'-CCCGGG GGAAATTG ATGGTGAGCAAGGGCGAGGAGCTGTTCAC-3'; Xmal place en gras) et 3 'Sacl-EmGFP (5'-CGGATCT TTACTTGTACAGCTCGTCCATGCCGAG GAGCTC-3' ; Sac I site en gras).
    1. Utilisez 5 ng d'ADN matrice, 10 ul de tampon 10X de la polymérase, une unités (U) de Taq ADN polymerase, 0,2 mM de chaque dNTP et 0,2 uM de chaque amorce dans une solution de 100 pi avec le volume restant constitué d'eau distillée / désionisée . Utiliser les conditions de cyclisme: 95 ° C pendant 5 min; 30 cycles de 95 ° C pendant 30 sec, 55 ° C pendant 30 sec et 72 ° C pendant 1 min; 72 ° C pendant 10 min. Purifier le produit PCR par gel extractiet à déterminer la concentration d'ADN en utilisant un spectrophotomètre mesurant Abs 260 x 50 ug / ml.
  3. Digest pET-2F-ZiF et l'insert codant EmGFP avec les enzymes de restriction Xmal et Sac I dans le tampon recommandé pendant 3 heures à 37 ° C en utilisant 10 U d'enzyme par 1 ug d'ADN. Visualiser l'ADN par électrophorèse sur gel d'agarose en utilisant un colorant d'intercalation fluorescent, tel que le bromure d'éthidium.
  4. Purifier l'ADN digéré par le kit d'extraction sur gel et déterminer la concentration d'ADN par un spectrophotomètre mesurant Abs 260 x 50 ug / ml.
  5. Ligaturer l'ADN codant EmGFP purifié dans 50 à 100 ng de pET-2F-ZiF en utilisant 1 U de T4 DNA Ligase pendant au moins 1 h à température ambiante. Pour de meilleurs résultats, effectuer la réaction de ligature en utilisant un rapport de 6: 1 insert-à-vecteur molaire.
  6. Thaw 50 pi de toute cellules XL-1 coli Bleu Escherichia chimiquement compétentes sur la glace et mélanger doucement avec 10-20 ng d'ligaturé pET-2F-ZiF-EmGFP.
  7. Gardez sur la glace pendant 30 min. choc thermique le mélange à 42 ° C pendant 90 secondes et récupérer les cellules dans 2 ml de bouillon de Super optimale avec la répression catabolique (SOC) pendant 1 heure à 37 ° C avec agitation.
  8. Étaler 100 pi de la culture de récupération sur un bouillon de lysogénie (LB) plaque de gélose avec 50 ug / ml de kanamycine et incuber O / N à 37 ° C.
  9. Le lendemain, inoculer 6 ml de Super Broth (SB) ou à la culture LB contenant 50 pg / ml de kanamycine avec une colonie de la plaque de gélose LB et la culture O / N à 37 ° C.
    Remarque: colonie PCR en utilisant les amorces 5 'Xmal-EmGFP et 3' Sacl-EmGFP pourrait être utilisée pour identifier des clones positifs avant Miniprep.
  10. Purifier pET-2F-ZiF-EmGFP par miniprep et confirmer plasmide par séquençage d'ADN en utilisant le promoteur T7 (5'-TAATACGACTCACTATAGGG-3 ').

2. Expression et purification

  1. Décongeler 50 pi de chimiquement compétente BL21 E. coli cellules sur la glace et mélanger doucement avec 100 ng de PET-2F-ZiF-EmGFP plasmid Transformez comme décrit dans les étapes 1.7 à 1.8.
  2. Le lendemain, inoculer 10 ml de milieu LB contenant 50 ug / ml de kanamycine avec une colonie unique et faire croître O / N à 37 ° C avec agitation par secousses.
  3. Le jour suivant, les diluer 10 ml de culture O / N dans 1 L de milieu LB additionné de 50 pg / ml de kanamycine, 0,2% de glucose et 100 uM ZnCl2. Cultiver la culture à 37 ° C avec agitation par secousses à une densité optique à 600 nm (DO600) de 0,8 et induire l'expression de la protéine avec 2 mM d'isopropyl-β-D-1-thiogalactopyranoside (IPTG). Après 6 heures de croissance à 37 ° C, les cellules de récolte par centrifugation à 5000 xg pendant 10 min à 4 ° C.
    Nota: conditions d'induction sont très variables et dépendent de la stabilité des protéines est exprimé. Surveiller la DO 600 toutes les 30 minutes jusqu'à ce qu'une DO 600 de 0,8 soit atteint.
  4. Remettre en suspension le culot cellulaire dans 5 ml de tampon de lyse (50 mM Tris-HCl, 500 mM de NaCl, 100 uM de ZnCl2, 1 mM dithiothréitol (DTT), 1 mM de MgCl2, 1 mM de fluorure de phénylméthylsulfonyle (PMSF) et de l'imidazole 10 mM, pH 8,0). Lyse des cellules sur la glace par ultrasons avec le réglage suivant: sortie de puissance de 50%, 4 min temps de processus avec 5 sec sur / 10 sec éteint intervalles. Éviter la surchauffe de la solution.
  5. Centrifuger le lysat cellulaire à 25 000 xg pendant 30 min à 4 ° C et transférer le surnageant dans un nouveau tube de collecte. Pour de meilleurs résultats, effectuer toutes les étapes suivantes à 4 ° C.
  6. Exécuter le surnageant à travers une colonne pré-garnie de 1 ml d'une suspension équilibrée de Ni-NTA. Laver la résine avec 20 ml de tampon de lavage (50 mM de Tris-HCl, 500 mM de NaCl, 100 uM de ZnCl2, 1 mM de DTT, 1 mM MgCl 2 et 30 mM d'imidazole, pH 8,0).
  7. Eluer la protéine avec 5 ml de tampon d'élution (50 mM de Tris-HCl, 500 mM de NaCl, 100 uM de ZnCl2, 1 mM de DTT, 1 mM de MgCl2, et 300 mM d'imidazole, pH 8,0).
  8. Tampon échanger la protéine est éluée avec un tampon de stockage (50 mMTris-HCl, 500 mM de NaCl, 100 uM de ZnCl2, 1 mM de DTT, 1 mM de MgCl2 et 10% de glycerol, pH 8,0) et on concentre la protéine à au moins 40 uM en utilisant un concentreur centrifuge par centrifugation selon les instructions du fabricant.
  9. Déterminer la concentration de protéines par BCA ou dosage de Bradford. Mélanger 2 ul de protéines purifiées avec 2 pi 2 × SDS-PAGE colorant de charge, faire bouillir à 95 ° C pendant 10 min, puis résoudre le 4% à 20% de Tris-Glycine SDS-PAGE pour évaluer la pureté de la protéine (figure 2).

3. Protéines de stockage

  1. Aliquoter la protéine concentrée, gel rapide dans l'azote liquide et conserver à -80 ° C. Pour les protéines de fusion EmGFP, couvrir le tube de papier d'aluminium pour protéger la protéine de la lumière.
  2. Évitez congélation et décongélation de la solution de protéine répétée. Remarque: protéines ZiF fusionnés sont stables dans ces conditions pendant au moins un mois. Ou> 4 stockage inapproprié de mois peut conduireà la précipitation des protéines ou des EmGFP photoblanchiment.

4. Protéines de transduction

  1. Maintenir des cellules HeLa dans du milieu de Eagle modifié par Dulbecco (DMEM) contenant 10% (v / v) de sérum bovin fœtal (FBS) et 1% d'antibiotique-antimycotique à 37 ° C dans une atmosphère complètement humidifiée avec 5% de CO 2.
    Note: Les cellules des passages plus de 30 fois ne sont pas recommandés pour la protéine de transduction.
  2. Pré-enduire une plaque à 24 puits avec 500 ul de 50 ug / ml de poly-lysine pendant 30 à 60 min à 25 ° C. cellules de semences sur une plaque de 24 puits à une densité de 2 x 10 5 cellules par puits. À 24 h après le semis, ou une fois les cellules sont entre 80% -90% de confluence, retirer les supports de chaque puits et laver avec 500 pi de DMEM sans sérum préchauffé (AFD).
  3. Pour chaque puits, ajouter 250 pi de GDF contenant 2 uM de la protéine ZiF-EmGFP et 100 uM ZnCl 2. Incuber les cellules à 37 ° C pendant 1 heure. Remarque: ZIF domaines pénètrent dans les cellules primarily travers macropinocytose, 34 qui est un mécanisme dépendant de l'énergie. Par conséquent, les cellules doivent être incubées à 37 ° C pendant une internalisation efficace de la protéine.
  4. Retirez le support de cellules et laver trois fois avec 500 ul de calcium et sans magnésium tamponnée au phosphate salin de Dulbecco (DPBS) supplémenté avec 0,5 mg / ml d'héparine. Remarque: L'héparine est nécessaire pour éliminer la protéine liée à la surface qui pourraient compliquer les analyses en aval.
  5. (Facultatif) Les traitements répétés jusqu'à trois fois pour une meilleure exécution.
  6. Isoler les cellules traitées immédiatement après l'héparine lavage par digestion avec 0,05% de trypsine-EDTA à 37 ° C pendant 2 min. Remettre en suspension les cellules détachées dans 0,5 ml de DPBS supplémenté avec 1% de FBS.
  7. Mesurer l'intensité de fluorescence de chaque échantillon par cytométrie de flux en utilisant le canal 35 l'isothiocyanate de fluorescéine (FITC) (figure 3). Réglez la diffusion vers l'avant (FSC) et la diffusion latérale (SSC) à placer la population deintérêt à l'échelle, en assurant que les populations ayant des propriétés différentes sont réglées l'une de l'autre.
  8. Recueillir 10 000 événements en direct pour chaque échantillon et d'analyser les données en utilisant la cytométrie en flux analyse des données logiciel. 36 Normaliser la fluorescence de cellules HeLa traitées avec ZiF-EmGFP à ces cellules traitées seulement avec GDF.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Deux doigts protéines de fusion ZiF-EmGFP peuvent être exprimées dans E. coli avec> 95% d'homogénéité et des rendements élevés (> 25 mg / ml) (Figure 2). En général, un ou deux doigts protéines de fusion ZIF peuvent être produites en quantités presque identiques à celles de type sauvage protéine non modifiée. Toutefois, dans certains contextes, des protéines de fusion ZiF cinq et six doigts ne peuvent pas être produits avec des rendements suffisamment élevés pour les applications en aval.

L'application directe de la protéine à deux doigts ZiF-EmGFP sur des cellules HeLa pendant 90 min à 37 ° C conduit à une augmentation dose-dépendante de la fluorescence EmGFP (figure 3A). Critique, aucune fluorescence ne est observée en l'absence du domaine ZiF. Nous avons déjà observé que presque 100% des cellules sont fluorescentes uniquement après traitement avec 2 uM de protéine à deux doigts ZiF-EmGFP, et que les cellules HeLa traitées avec ZiF protéine de fusion sont positifs pour EmGFP fluorescence à des concentrations protéiques aussi faibles que 0,25 uM (figure 3B).

Figure 1
Figure 1. Structure et séquence de la protéine à doigt de zinc. Structure (Haut) Cristal d'un seul doigt de zinc (ZiF) domaine. Les chaînes latérales de la Cys conservés et ses résidus coordonnés avec le Zn 2+ sont présentés comme des bâtons (APB ID: 2I13). 37 (Bas) Séquence du domaine ZiF. Les flèches et les cylindres indiquent Β feuilles et α-hélice structures secondaires, respectivement. Les résidus de liaison à l'ADN α-hélicoïdale qui ont été substitués par de l'alanine sont mis en surbrillance rose. Résidus chargés positivement prévus à la médiation internalisation cellulaire sont mis en évidence en bleu clair. Se il vous plaît cliquer ici pour voir une version plus grande de cette figure.

"Fo: keep-together.within-page =" always "> Figure 2
Figure 2. SDS-PAGE purifiées à un, deux, trois et quatre doigts protéines de fusion ZiF-EmGFP. Protéines de fusion ZiF-EmGFP ont été exprimées dans E. coli et purifié par Ni-NTA agarose résine. La protéine éluée a été analysé pour la pureté par SDS-PAGE en utilisant un gel à 20% Tris-Glycine 4%. Aucune dégradation ou des troncatures de protéines de fusion ZiF-EmGFP significative n'a été observée.

Figure 3
Figure 3. ZiF médiée par la délivrance de protéines dans des cellules HeLa. (A) intensité de la fluorescence des cellules HeLa traitées avec des quantités croissantes de deux doigts protéines ZiF-EmGFP. Des cellules HeLa traitées avec la protéine EmGFP seul chevauchent entièrement avec des cellules non traitées. (B) normalisée d'intensité de fluorescence de cellules HeLa traitées successivement avec 2 uM of deux doigts protéines ZiF-EmGFP. L'intensité de fluorescence a été déterminée par cytométrie de flux.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ici, un protocole étape par étape, pour la délivrance de protéines à doigt de zinc en utilisant (ZiF domaines cellulaires) perméable est présentée. Le domaine ZiF ne réduit pas l'activité enzymatique de la cargaison 34 condensé; permet la production et la purification de protéines avec des rendements pratiquement identiques à celles observées avec la protéine non modifiée; et peut transporter des protéines et des enzymes dans un large éventail de types de cellules avec des rendements qui dépassent peptidiques ou protéiques systèmes de domaines de transduction de pénétration cellulaire traditionnelles. Ensemble, ces résultats indiquent le vaste potentiel des domaines ZIF pour la médiation de livraison directe des protéines dans les cellules pour une large gamme d'applications.

La délivrance de protéines maximale a déjà été réalisé en utilisant seulement un domaine de ZiF deux doigts, malgré le fait que étendu tableaux de trois et quatre doigts domaines ZIF porter une plus grande charge positive. Ces résultats indiquent que l'entrée de la cellule ZiF médiation pourrait être influencée par des facteurs autres que de la charge, incLUDING stabilité de la protéine ou de la rigidité conformationnelle. La délivrance de protéines médiée par ZiF domaine se est également avéré être dépendant de l'énergie et exige donc que toutes les cellules traitées avec la protéine sont incubées à 37 ° C. Grâce à l'utilisation des inhibiteurs de petites molécules de différentes voies d'endocytose, macropinocytose, et dans une moindre mesure cavéoline endocytose dépendante, étaient déterminés à être les principales voies d'entrée des cellules ZiF médiation. 34 Notamment, contrairement à d'autres systèmes de protéine de transduction, domaines ZIF sont capable de se échapper des endosomes efficacement la médiation des niveaux élevés de délivrance cytosolique de la cargaison macromoléculaire condensé, ce qui souligne le potentiel de ces domaines pour la réalisation de la prestation de protéine solide.

Dans notre expérience, la densité de semis de cellules est une étape critique pour atteindre des niveaux élevés de la protéine de transduction. Nous recommandons de traiter les cellules une fois qu'ils atteignent 80% -90% de confluence et précédemment observé que les cellules ensemencées à> 95% de confluence spectacle souscapacité de transduction optimale, tandis que les cellules ensemencées à faible densité (<50%) sont sensibles à la toxicité induite par la protéine. Il est important, pour des types de cellules ayant des tendances élevées de détachement, des plaques de culture de cellules pré-revêtues de poly-lysine sont recommandés. Poly-lysine facilite la fixation des cellules par des interactions électrostatiques avec des composants chargés négativement de la surface cellulaire. Bien que les résidus de chaque domaine ZiF liaison à l'ADN hélice α ont été supprimées afin d'éliminer toute possibilité de reconnaissance de l'ADN, les résidus cysteine ​​et histidine qui coordonnent avec l'ion Zn pour stabiliser le domaine pli ΒΒα ZiF restent intacts. Ainsi, nous recommandons que tout tampon de stockage être complété par au moins 100 M de ZnCl 2 à maintenir l'intégrité de la protéine.

Bien que le domaine ZiF a été précédemment montré pour délivrer des protéines et des enzymes en une variété de types de cellules, l'efficacité de la délivrance ZiF pourrait également dépendre de la tant macromoléculaire cargaison et la concentration en protéines. Par exemple, les cellules traitées avec deux doigts protéine de fusion ZiF-luciférase ont été observés pour afficher luminescence maximale lorsqu'ils sont traités avec 0,5 uM de protéine, avec diminution de l'activité à des concentrations plus élevées, tandis que les cellules traitées avec deux doigts EmGFP présentaient une augmentation dose-dépendante de la fluorescence intensité jusqu'à 8,0 uM de protéine, et de protéines lors de traitements consécutifs. Nous recommandons donc l'évaluation de la capacité de pénétration cellulaire de chaque domaine ZiF fusion unique à travers une gamme de concentrations.

Enfin, bien que pas encore démontré, nous prévoyons que la livraison ZiF de domaine est une plateforme très flexible, capable de fournir un large éventail de macromolécules dans les cellules. Par exemple, il peut être possible à la fois pour l'ADN et l'ARN à être fonctionnalisées chimiquement sur la surface du domaine ZiF via un lieur hydrolysable, ou transfectées de manière transitoire dans des cellules par encapsulation de domaines ZIF. En outre, le efficirence de livraison de protéines ZiF pourrait être renforcée par des efforts de conception rationnels axés sur l'optimisation de la charge de surface.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs ne ont rien à divulguer.

Acknowledgements

Ce travail a été soutenu par les Instituts nationaux de la santé (DP1CA174426 à Carlos F. Barbas) et l'Université ShanghaiTech, Shanghai, Chine (à JL). Graphiques moléculaires ont été générés en utilisant PyMol.

Materials

Name Company Catalog Number Comments
XmaI New England Biolabs R0180L
SacI New England Biolabs R0156L
Expand High Fidelity PCR system Roche 11759078001
dNTPs New England Biolabs N0446S
4%-20% Tris-Glycine Mini protein gels, 1.5 mm, 10 wells Life Technologies EC6028BOX
2x Laemmli Sample Buffer BioRad 161-0737
T4 DNA Ligase Life Technologies 15224-017
BL21 (DE3) Competent E. coli New England Biolabs C2527I
IPTG Thermo Scientific R0391
Zinc Chloride Sigma-Aldrich 208086-5G
Kanamycin Sulfate Fisher Scientific BP906-5
Glucose Sigma-Aldrich G8270-100G
Tris Base Fisher Scientific BP152-25
Sodium Chloride Sigma-Aldrich S9888-25G
DTT Fisher Scientific PR-V3151 
PMSF Thermo Scientific 36978
Ni-NTA Agarose Resin QIAGEN 30210
Glycerol Sigma-Aldrich G5516-500ML
Imidazole Sigma-Aldrich I5513-25G
Amicon Ultra-15 Centrifugal Filter Units EMO Millipore UFC900324
DMEM Life Technologies 11966-025
Fetal Bovine Serum Life Technologies 10437-028
Antibiotic-Antimycotic  Life Technologies 15240-062
24-Well Flat Bottom Plate Sigma-Aldrich CLS3527-100EA
Poly-Lysine Sigma-Aldrich P7280
DPBS, No Calcium, No Magnesium Life Technologies 21600010
Heparan Sulfate Sigma-Aldrich H4777
Trypsin Life Technologies 25300054
HeLa cells ATCC CCL-2
Nano Drop ND-1000 spectrophotometer  Thermo Fisher Scientific
QIAquick PCR Purification Kit QIAGEN 28104
QIAquick Gel Extraction Kit QIAGEN 28704

DOWNLOAD MATERIALS LIST

References

  1. Berg, A., Dowdy, S. F. Protein transduction domain delivery of therapeutic macromolecules. Curr. Opin. Biotechnol. 22, 888-893 (2011).
  2. Lindsay, M. A. Peptide-mediated cell delivery: application in protein target validation. Curr. Opin. Pharmacol. 2, 587-594 (2002).
  3. Luo, D., Saltzman, W. M. Synthetic DNA delivery systems. Nat. Biotechnol. 18, 33-37 (2000).
  4. Guo, X., Huang, L. Recent advances in nonviral vectors for gene delivery. Acc. Chem. Res. 45, 971-979 (2012).
  5. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  6. Frankel, A. D., Pabo, C. O. Cellular uptake of the tat protein from human immunodeficiency virus. Cell. 55, 1189-1193 (1988).
  7. Elliott, G., O'Hare, P. Intercellular trafficking and protein delivery by a herpesvirus structural protein. Cell. 88, 223-233 (1997).
  8. Derossi, D., Joliot, A. H., Chassaing, G., Prochiantz, A. The third helix of the Antennapedia homeodomain translocates through biological membranes. J. Biol. Chem. 269, 10444-10450 (1994).
  9. Smith, B. A., et al. Minimally cationic cell-permeable miniature proteins via alpha-helical arginine display. J. Am. Chem. Soc. 130, 2948-2949 (2008).
  10. Daniels, D. S., Schepartz, A. Intrinsically cell-permeable miniature proteins based on a minimal cationic PPII motif. J. Am. Chem. Soc. 129, 14578-14579 (2007).
  11. Karagiannis, E. D., et al. Rational design of a biomimetic cell penetrating peptide library. ACS Nan. 7, 8616-8626 (2013).
  12. Gao, S., Simon, M. J., Hue, C. D., Morrison, B., 3r,, Banta, S. An unusual cell penetrating peptide identified using a plasmid display-based functional selection platform. ACS Chem. Biol. 6, 484-491 (2011).
  13. Fuchs, S. M., Raines, R. T. Arginine grafting to endow cell permeability. ACS Chem. Biol. 2, 167-170 (2007).
  14. Cronican, J. J., et al. Potent delivery of functional proteins into mammalian cells in vitro and in vivo using a supercharged protein. ACS Chem. Biol. 5, 747-752 (2010).
  15. Panyam, J., Labhasetwar, V. Biodegradable nanoparticles for drug and gene delivery to cells and tissue. Adv. Drug Deliv. Rev. 55, 329-347 (2003).
  16. Zelphati, O., et al. Intracellular delivery of proteins with a new lipid-mediated delivery system. J. Biol. Chem. 276, 35103-35110 (2001).
  17. Kaczmarczyk, S. J., Sitaraman, K., Young, H. A., Hughes, S. H., Chatterjee, D. K. Protein delivery using engineered virus-like particles. Proc. Natl. Acad. Sci. U. S. A. 108, 16998-17003 (2011).
  18. Voelkel, C., et al. Protein transduction from retroviral Gag precursors. Proc. Natl. Acad. Sci. U. S. A. 107, 7805-7810 (2010).
  19. Sinha, V. R., Trehan, A. Biodegradable microspheres for protein delivery. J. Control Release. 90, 261-280 (2003).
  20. Liu, J., Gaj, T., Patterson, J. T., Sirk, S. J., Barbas, C. F. 3rd Cell-penetrating peptide-mediated delivery of TALEN proteins via bioconjugation for genome engineering. PLoS One. 9, e85755 (2014).
  21. Ramakrishna, S., et al. Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA. Genome Res. 24, 1020-1027 (2014).
  22. Fuchs, S. M., Raines, R. T. Polyarginine as a multifunctional fusion tag. Protein Sci. 14, 1538-1544 (2005).
  23. Mai, J. C., Shen, H., Watkins, S. C., Cheng, T., Robbins, P. D. Efficiency of protein transduction is cell type-dependent and is enhanced by dextran sulfate. J. Biol. Chem. 277, 30208-30218 (2002).
  24. Al-Taei, S., et al. Intracellular traffic and fate of protein transduction domains HIV-1 TAT peptide and octaarginine. Implications for their utilization as drug delivery vectors. Bioconjug. Chem. 17, 90-100 (2006).
  25. Jones, S. W., et al. Characterisation of cell-penetrating peptide-mediated peptide delivery. Br. J. Pharmacol. 145, 1093-1102 (2005).
  26. Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. Genome editing with engineered zinc finger nucleases. Nat. Rev. Genet. 11, 636-646 (2010).
  27. Carroll, D. Genome engineering with zinc-finger nucleases. Genetics. 188, 773-782 (2011).
  28. Guo, J., Gaj, T., Barbas, C. F. 3rd, 3rd, Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases. J. Mol. Biol. 400, 96-107 (2010).
  29. Gaj, T., Guo, J., Kato, Y., Sirk, S. J., Barbas, C. F. 3rd Targeted gene knockout by direct delivery of zinc-finger nuclease proteins. Nat. Methods. 9, 805-807 (2012).
  30. Gersbach, C. A., Gaj, T., Barbas, C. F. 3rd, 3rd, Synthetic zinc finger proteins: the advent of targeted gene regulation and genome modification technologies. Acc. Chem. Res. 47, 2309-2318 (2014).
  31. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  32. Perez-Pinera, P., Ousterout, D. G., Gersbach, C. A. Advances in targeted genome editing. Curr. Opin. Chem. Biol. 16, 268-277 (2012).
  33. Cronican, J. J., et al. A class of human proteins that deliver functional proteins into mammalian cells in vitro and in vivo. Chem. Biol. 18, 833-838 (2011).
  34. Gaj, T., Liu, J., Anderson, K. E., Sirk, S. J., Barbas, C. F., 3rd, Protein delivery using Cys2-His2 zinc-finger domains. ACS Chem. Biol. 9, 1662-1667 (2014).
  35. Radcliff, G., Jaroszeski, M. J. Basics of flow cytometry. Methods Mol. Biol. 91, 1-24 (1998).
  36. Mercer, A. C., Gaj, T., Sirk, S. J., Lamb, B. M., Barbas, C. F. 3rd Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors. ACS Synth. Biol. 3, 723-730 (2014).
  37. Segal, D. J., Crotty, J. W., Bhakta, M. S., Barbas, C. F. 3rd, Horton, N. C. Structure of Aart, a designed six-finger zinc finger peptide, bound to DNA. J. Mol. Biol. 363, 405-421 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats