Методы по расследованию регулирующей роли малых РНК и рибосомного размещения в * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

LaMonte, G., Walzer, K. A., Lacsina, J., Nicchitta, C., Chi, J. T. Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum. J. Vis. Exp. (106), e53214, doi:10.3791/53214 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Генетический вариант ответственность за серповидно-клеточная аллеля (ОБД) позволяет эритроциты сопротивляться инфекции паразита малярии, P. тропической. Молекулярная основа этого сопротивления, которая, как известно, многофакторный, остается полностью понимали. Последние исследования показали, что дифференциальное выражение эритроцитов микроРНК, когда перемещается в малярийных паразитов, влияют как на регуляции генов и рост паразита. Эти микроРНК были позже ингибируют перевод мРНК путем формирования химерных РНК, с помощью 5 'РНК слияния с сдержанный подмножеств паразитов мРНК. Вот, методы, которые были использованы для изучения функциональной роли и предполагаемые механизм, лежащий микроРНК эритроцитов на регуляции генов и поступательного потенциала P. тропической, в том числе трансфекции модифицированных синтетических микроРНК в принимающих эритроцитов, будут подробно. Наконец, метод полисом градиент используется для определения степени TRAnslation этих транскриптов. Вместе эти методы позволили продемонстрировать, что Нарушение регуляции уровней эритроцитов микроРНК способствует клеточной внутреннее сопротивление малярии серповидных эритроцитов в.

Introduction

Малярия, вызванная apicomplexan паразитов рода Plasmodium, является наиболее распространенным паразитарным заболеванием человека, в глобальном масштабе заражения примерно 200 миллионов человек каждый год, и в результате чего вокруг 600.000 смертей 1. Из пяти видов Plasmodium, которые заражают людей, наиболее актуальными для человека заболевания П. тропической и П. трехдневной, из-за их широкого распределения и потенциал для серьезных осложнений малярии. Жизненный цикл малярийного паразита требует инфекции обоих комаров и человека. При запуске зараженного комариных укусов человека, паразиты путешествовать через кровоток в печени, где первоначальный раунд репликации. После разрыва Мерозоиты принимающей гепатоцитов, они заражают окружающих эритроциты, инициируя либо бесполым или сексуального репликации. Неполовой этап репликации, которая длится 48 ч в P. тропической, находится в центре внимания данного исследования, так как она является одновременно источником большей MalАрия симптомы и легко воспроизводятся в лабораторных условиях.

В то время как ряд инициатив в области общественного здравоохранения, в том числе улучшенные противомалярийных терапии, которые несколько снижается бремя малярии в глобальном масштабе, продолжающееся появление устойчивых к лекарствам паразитов представляет проблему для усилий по борьбе с малярией. Одной из областей, которые могут предложить новые терапевтические подходы является изучение того, как различные генетические варианты придают устойчивость к малярии. В эндемичных по малярии районах, разнообразие эритроцитов полиморфизмов довольно часто 2,3. Эти мутации, с серповидно-клеточная, возможно, наиболее заметным, часто связаны со значительным сопротивлением начала инфекции симптоматическое малярии 4. Основные механизмы, с помощью которых они вызывают эритроциты сопротивляться инфекции малярии полностью понял. Пораженных эритроцитов с мутациями гемоглобина подлежат расширенной фагоцитоза путем расширения сотовой жесткости и обезвоживания, котороесвязано со снижением вторжения P. Falciparum 5. НВс аллель влияет также экспрессию белка на поверхности эритроцитов и ремоделирования цитоскелета, далее, ингибирующих развитие паразита 6,7. Наконец, П. тропической плохо растет в гомозиготном серп (ОБД) эритроцитов 8,9 в пробирке, предлагая внутренние факторы эритроцитарных сопротивления малярии. Тем не менее, в то время как все эти механизмы, кажется, играют роль, они не в полной мере объяснить механизмы, лежащие серпа устойчивости клеток к малярии.

Одним из потенциальных набор эритроцитарных факторов, которые остаются плохо понятыми является большой бассейн микроРНК, присутствующего в зрелые эритроциты. Микро небольшие некодирующие РНК, 19-25 нт в размерах, которые опосредуют перевод и / или стабильность мРНК мишеней с помощью спаривания оснований в пределах 3 'UTR. Они были вовлечены в контроле млекопитающих иммунные реакции, в том числе подавление OF репликации вируса 10 и было показано, придают устойчивость к вирусам растений Они также показали, чтобы регулировать несколько эритроцитарных процессы, в том числе эритропоэза 11,12 и метаболизма железа 13. Предыдущие исследования выявили богатый и разнообразный население эритроцитов микроРНК, чьи выражение резко изменили в ОБД эритроцитов 14,15. Так зрелые эритроциты не имеют активного транскрипцию и трансляцию, функциональная роль этих эритроцитов микроРНК, остается неясным. Как значительный материальный обмен происходит между клетки-хозяина и P. тропической во время intraerythrocytic цикла развития (IDC) 16, было предположение, что изменили профиль микроРНК в HbS эритроцитов может непосредственно способствовать устойчивости малярии клеток-внутренняя.

Эти исследования, в конечном счете привело к развитию трубопровода для выделения, идентификации и функционально исследовать роль человеческого микроРНК в мAlaria паразит, П. тропической, которые показали, что эти хозяева / человека микроРНК, в конечном счете, ковалентно предохранитель, а затем поступательно подавить паразит мРНК стенограммы 17. Это дало пример первых межвидовой химерных транскриптов, образованных транс-сплайсинга и подразумевает, что эта микроРНК-мРНК синтез может происходить в других видах, в том числе других паразитов. Все трипаносом мРНК транс-сплайсинга с сплайсинга лидера (SL), чтобы регулировать разделение полицистронных транскриптов 18. Так P. тропической не хватает ортологи для Dicer / назад 19,20, вполне возможно, что микроРНК эритроцитов захватить подобный SL машины в P. тропической интегрироваться в генов-мишеней. Последние исследования в P. тропической есть на самом деле указывает на наличие 5 «ведущих сращивания последовательностей 21. Это исследование подробно методы, которые привели к открытию человека паразит микроРНК-мРНК синтеза транскриптов, в том числе и транскриптомных и translaметоды регулирования ные. Общие цели этих методов, чтобы исследовать влияние малых РНК в регуляции генов, фенотипы и перевода потенциала P. Falciparum стенограммы.

Начальная идентификация химерных транскриптов человека паразит полагаться использования методов анализа РНК, таких как ПЦР в реальном времени, транскриптома последовательности и EST захвата библиотеки, в которую вошли как общая и малые РНК, а не с помощью методов, которые только изолированные малые РНК. Разделительный все РНК в одном большом бассейне, а не по отдельности, позволило идентифицировать как перемещаются человека малых РНК в паразита, а также наличие этих небольших последовательностей РНК, как часть более крупной последовательности. Это то требуется анализ перевода состояния этих мРНК синтеза для определения функциональных последствий этих слияний.

В то время как активные усилия по характеристике генома А.Н. паразитад транскриптомный добавили к пониманию биологии паразита 22-25, намного меньше известно о трансляционной регуляции транскриптома мРНК через жизненного цикла P. тропической 26. Это ограниченное понимание протеома паразита препятствовало и понимание биологии паразита и способность идентифицировать новые цели для следующего поколения противомалярийных терапии. Этот разрыв в понимании клеточной биологии паразита сохраняется в значительной степени из-за отсутствия адекватных методов для исследования трансляционной регулирование в P. тропической. Одним из последних бумаги описано применение рибосомальной футпринтинга Р. тропической определить глобальный статус 21 перевода. Один хорошо известны измерения поступательного потенциала транскриптов количество связанных рибосом, определяемых полисом профилирования. Однако, когда этот метод применяется к P. тропической </ EM>, она не в состоянии восстановить большинство полисом и захватывает преимущественно monosomes. Недавно несколько групп 27,28 оптимизировали П. Falciparum методы полисом лизированием эритроцитов и паразитов одновременно сохранить полисом и рибосом характеризуют размещение и поступательное потенциал этих малярийных паразитов во время их бесполого развития в принимающих эритроцитов 28.

В совокупности, эти методы показывают, что наблюдаемый слияние человека микроРНК и мРНК паразитов модулирует перевод паразит белка слияния этих мРНК, которая была продемонстрирована с использованием сообщалось ранее методы 27, и является основным фактором, определяющим сопротивление малярии в Hbas и ССРХ эритроцитов 17. Эти методы будут полезны в любой системе, глядя на выявление и функционально исследовать РНК сплайсинга события, являются ли эти РНК слитые в пределах P. тропической или другие эукариотические системы.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1: Выделение малого размера РНК из P. В тропической IDC

  1. Получить малярийных паразитов в бесполого культуры 29.
    ПРИМЕЧАНИЕ: Требуемый размер культура будет варьироваться в зависимости от желаемого применения; Однако культура 10 мл при 3-5% паразитемии и 5% гематокрита обеспечивает достаточное РНК для ПЦР в реальном времени (RT-PCR). Этот метод был первоначально оптимизирован для асинхронных культур, но когда конкретные моменты времени в течение цикла инфекции желательно, кольцо-этап паразиты не могут быть синхронизированы с помощью синхронизации сорбит не позднее, чем 10-12 ч после вторжения. Синхронизация должна быть повторена после одного цикла (примерно 48 ч) 29.
  2. Бассейн зараженные клетки вместе (~ 5 х 10 9 БС на 3-5% паразитемии) и заполнить холодной PBS в верхней части трубки и центрифуги при 800 мкг в течение 5 мин без тормоза для осаждения эритроцитов.
  3. После центрифугирования, удаления супернатанта тщательно с использованием аспирационной пипетки прикрепленв вакууме, так как эритроцитарного гранулы легко сместить. Вымойте гранул еще раз холодной 1x PBS.
  4. Ресуспендируют осадок клеток в холодную 0,15% сапонина (в 1x PBS) и место на льду в течение 30 мин.
  5. Центрифуга клеток при 1500 мкг в течение 12 мин при 4 ° С, супернатант удалить (который будет темно-красного цвета) и ресуспендируют осадок в холодной PBS. Повторите этот шаг еще раз.
    ПРИМЕЧАНИЕ: Для того, чтобы убедиться, что микроРНК присутствовали отражает микроРНК внутри паразитов, а не эритроцитарная загрязнение, ряд условий изоляции паразитов были протестированы: 1) сапонин лизис, 2) сапонин лизиса в сочетании с РНКазы лечения микроРНК клеток-хозяев и 3 ) метил-бета-циклодекстрин лечение, чтобы удалить паразита от принимающей эритроцитов. Все процедуры дали сходные результаты.
  6. Lyse изолированный паразит осадок с использованием рекомендованных 600 мкл буфера для лизиса. Этот объем лизирующего буфера является достаточным для культур до ~ 30 мл на 2% гематокрита и 5% паразитемии.
    ПРИМЕЧАНИЕ: Для больших культур паразита, этот объем может быть увеличен. Важно, чтобы обеспечить полный лизис паразита гранул путем тщательного встряхивания в течение не менее 1 мин. Кроме того, для простоты извлечения, лизированные образцы могут быть переданы в 1,7 мл микроцентрифужных трубки.
  7. Добавить 60 мкл, или 1/10 объема буфера для лизиса, используемого на стадии 6, гомогената добавки (2 М ацетата натрия, рН 4).
  8. Оставьте образцы на льду в течение 10 мин.
  9. Добавить 600 мкл, или объем, равный сумме буфера для лизиса добавляют на стадии 6, кислотного фенола choloroform к каждому образцу и вихря в течение 1 мин.
  10. Отдельные водной и органической фаз центрифугированием образцов при 10000 х г в течение 5 мин. Это спин больше, чем это следует из комплекта для обеспечения что все гемоглобина / hemozoin в органической фазе.
  11. Собирают верхний (водный) слой и перенести его в свежую пробирку. Повторите шаги 9 и 10, если водную фазу белый или (что более вероятно) коричневого цвета, что указывает на проЗагрязнение Тейн.
  12. Определить объем полученного супернатанта с помощью пипетки, а затем добавить 1,25 объемов 100% этанола (~ 800 мкл) и перемешивают путем переворачивания 1,7 мл микроцентрифужных трубки 5 раз.
  13. Pass каждого образца через предоставленной РНК-связывающего патрона фильтра (несколько различных которых являются коммерчески доступными) либо центрифугированием при 14000 х г в течение 1 мин или с помощью вакуумного коллектора.
  14. Вымойте картридж фильтра с 700 мкл промывочного буфера микроРНК 1, с использованием микроцентрифужную, спиннинг в 14000 мкг в течение 1 мин.
  15. Вымойте картридж фильтра с 500 мкл промывочного буфера 2/3 раза путем центрифугирования при 14000 мкг в течение 1 мин каждый.
  16. Элюировать РНК 100 мкл DEPC-воды, предварительно нагретой до 95 ° С, в двух промываний 50 мкл, центрифугировали при 14000 х г в течение 1 мин каждый. Измерение концентрации РНК с помощью УФ-поглощению при 260 нм.
    ПРИМЕЧАНИЕ: РНК гель (или КЭ-мочевины акриламида или денатурации формальдегида в агарозном геле) можно бе используется для оценки распределения по размерам изолированных РНК.
    ПРИМЕЧАНИЕ: Эта РНК подходит для анализа микрочипов, РНК-последовательности, северной пятно и защиты рибонуклеазы анализа.

2: Количественный малогабаритных РНК из P. В тропической IDC

  1. Определить концентрацию отдельных образцов, выделенного на стадии 1, с использованием УФ-спектрофотометрии при 260 нм.
  2. Генерировать в реальном времени ПЦР-праймеров для желательных видов РНК. Для микроРНК в одиночку, мы использовали предварительно сделанные микроРНК КПЦР анализов, а для мРНК или слияния микроРНК-мРНК мы разработали праймеров дл SYBR-зеленый. Для РНК синтеза, прямой праймер был сама последовательность микроРНК (MIR-451: AAACCGTTACCATTACTGAGTT), в то время как обратная представлял собой ген-специфического праймера ~ 100 п.н. ниже по потоку от микроРНК в последовательности мРНК (ПКА-R: ATCGAACATGCTGTGAACAT).
  3. Сделать кДНК из образцов РНК с использованием либо шпильки грунтовки для микроРНК (используйте 20-40 нг РНК) в одиночку или случайных гексамеров для мРНК и / или микроРНКвиды -мРНК синтеза (с использованием 1 мкг РНК). Смешайте РНК и праймеров в течение 5 мин при 65 ° С, затем охлаждают до комнатной температуры. После добавления обратной транскриптазы смесь (0,5 мкл обратной транскриптазы, 0,5 мкл ингибитора РНКазы, 1 мкл дНТФ (2,5 мм), каждый 4 мкл 5х буфера, 2 мкл 0,1 М ДТТ, 1 мкл H 2 O).
    1. Запуск образцов на амплификаторе способной обнаруживать либо Sybr зеленые или TaqMan зондов. SYBR Green количественной ПЦР 30 для специфических генов проводили в 3-стадии ПЦР, 95 ° С в течение 15 секунд, низкой праймера температуры отжига минус 5 ° С в течение 30 сек и 68 ° С в течение 30 сек, в течение 40 циклов, с использованием коммерческий SYBR зеленый мастер смеси. микроРНК ПЦР в реальном времени проводили в двустадийной ПЦР, 95 ° C в течение 15 сек и 60 ° С в течение 1 мин, 40 циклов.
    2. Количественно анализов, используя метод ΔΔCt и нормализовать их против любого Раб ГТФ (PF08_0110) или 18S рРНК 31.

3: Введениемалых РНК в малярийных паразитов

  1. Гранул 300 мкл эритроцитов в трансфекции (250 мкл эритроцитов, приблизительно 1,5 · 10 9 клеток, в конечном счете, будет использоваться) в полной среде малярии центрифугированием при 800 х г в течение 5 мин при тормоза 1.
  2. Вымойте эритроцитов дважды RPMI и ресуспендируют в полной cytomix (120 мМ KCl; 0,15 мМ CaCl 2, 10 мМ К 2 НРО 4 / KH 2 PO 4, рН 7,6; 25 мМ HEPES, рН 7,6; 2 мМ EGTA, рН 7,6; 5 мМ MgCl 2, рН доводили с помощью КОН) при 50% гематокрита после центрифугирования при 800 х г в течение 5 мин при тормоза 1.
  3. Передача клеток в 0,2 см кювету для электропорации.
  4. Добавить 10 мкг, или соответствующее количество, пользовательских синтетических олигонуклеотидов в кювет и ресуспендируйте культур.
  5. Отрегулируйте электропоратора 310 В / 950 мкФ и доставить импульс в каждую кювету.
  6. Ресуспендируют 300 мкл эритроцитов в кювете в подогретого полной MalAria носитель и пластины их в 24-луночных планшетах и инкубируют при 37 ° С в герметичном контейнере с газовой смеси крови малярии (3% O 2, 5% СО 2).
  7. Через 4 часа, заражают трансфицированных БС с синхронизированными конце трофозоиты к приближенному окончательного паразитемии 1%.
  8. Добавить недавно трансфицированных эритроцитов каждые 4-6 дней, чтобы инфицированных культур и определить% паразитемии по FACS, используя YoYo-1 окрашивание, как указано в разделе 4.

4: Определение эритроцитов микроРНК воздействие на паразитарная инфекция Оценить

  1. Возьмите 100 мкл ресуспендированного культуры от микропипетки и место в 1,7 мл микроцентрифужных трубки. Дважды промывали 1 мл PBS и 1x центрифуге в настольной микроцентрифуге центрифугированием при 800 х г в течение 5 мин.
  2. Ресуспендируют осадок в 1 мл 0,025% глутаральдегида. Инкубируйте образцы в течение 20 мин при комнатной температуре.
    Примечание: образцы могут храниться здесь в течение нескольких недель при 4 ° С. Впоследствии, осаждения зараженный RБЦ центрифугированием при 800 х г в течение 5 мин. Вымойте дважды 1 мл PBS 1x.
  3. Ресуспендируют осадок в 1 мл 0,015% сапонина. Инкубируйте при 4 ° С в течение 15 мин. Гранулы инфицированных эритроцитов путем центрифугирования при 800 х г в течение 5 мин. Вымойте дважды 1 мл PBS 1x. Repeat.4.3. Ресуспендируют клеток в 1 мл PBS, содержащий 1x 1 мкл (1,000X) пятно ДНК.
  4. Определить степени паразитемии на цитометра, при 488 нМ и возбуждении ~ 530 нм (FL-1) выбросов.
  5. Во-первых, ворота поток цитометр на основе FSC и SSC, чтобы сосредоточиться на эритроциты. Затем измерьте степени паразитемии (инфицированные эритроцитов) в закрытом РБК по флуоресценции в Флорида-1 канала.
    ПРИМЕЧАНИЕ: позднем этапе паразиты 10X более чем люминесцентные ранней стадии паразитов, и ~ 100X выше неинфицированных эритроцитов. Кроме того, собирая при низкой скорости имеет тенденцию к снижению шума. Наконец, этот подход был по сравнению с 3 H-гипоксантин регистрации и окрашивания Гимза, и как сообщалось ранее 13, и все методы GAVэлектронной аналогичные результаты.

5: Биотин-тегов и Элюция микроРНК-мРНК Fusion Продукция

  1. Непосредственно заказать заказ синтетических РНК олигонуклеотидов с desthiobiotin (dB-), ковалентно связанные с 5'-конца.
  2. Трансфекции незараженных БС с Desthiobiotin-конъюгированного (dB-) микроРНК и микроРНК (немодифицированного отрицательный контроль), как указано в шаге 3.
  3. Инфекция трансфицированных БС с P. тропической Паразиты в исходное паразитемией 0,5% (шаг 1.1).
  4. Выписка паразита РНК 4 дней (96 часов) затем, как описано выше, в шаге 1.
  5. Инкубируют 10 мкг РНК паразитов с 50 мкл стрептавидин упакованных шариков, добавляли через микропипетки, и вращаются на микроцентрифужных трубки ротатор в течение 1 часа при 4 ° С.
  6. Гранул бусы на 800 мкг в течение 30 сек и промыть 20 мМ KCl и 1/1000 РНКазы ингибитора.
  7. Элюировать РНК из бисера конкуренции с 2 мМ биотина и с 200 мкл буфера для элюции РНК захвата (20 мМ KCl, 1/1, 000 РНКазы ингибитора и 2 мМ биотин) в 4 ° С в течение ночи с вращением.
  8. Определить степень обогащения указанного P. Falciparum стенограммы использованием SYBR зеленый Qrt-PCR, и микроРНК обогащения (положительный контроль) по TaqMan КПЦР, как указано в шаге 2.

6: полисом Разделение чтобы определить, рибосомных заполняемость P. тропической

  1. Поместите 5 мл 15% раствора сахарозы (400 мМ ацетата калия, 25 мМ HEPES калия, рН 7,2, 15 мМ ацетата магния, 200 мкМ циклогексемида, 1 мМ ДТТ, 1 мМ PMSF, 40 ед / мл РНКазы ингибитор, и 15% сахарозы ) в SW41 ультрацентрифужную пробирку (14 х 89 мм).
  2. Используя 5 мл шприц, добавляют 5 мл 50% раствора сахарозы (400 мМ ацетата калия, 25 мМ HEPES калия, рН 7,2, 15 мМ ацетата магния, 200 мкМ циклогексемида, 1 мМ ДТТ, 1 мМ PMSF, 40 ед / мл РНКазы Ингибиторы и 50% сахарозы) под 15% сахарозы, используя длинный стальной иглы, а затем удалить иглу.
  3. Через 2 ч, медленно наклоните трубу обратно в вертикальном положении и передачи трубки лед, позволяя ему остыть в течение не менее 15 мин до нагружения образца (шаг 14).
  4. Сбор достаточно Plasmodium стадии культуру -infected крови для генерации 100-500 мкг общей РНК, или примерно 100 мл асинхронной культуре, в 3-5% паразитемии. Добавить 1/10 объема этого культуральной среде, содержащей 10-кратный (2 мм) циклогексимид (CHX) и инкубируют при 37 ° С в течение 10 мин.
    1. Гранул культуры центрифугированием при 500g в течение 7 мин с центрифугой (тормоза 1), а затем дважды промывали комнатной температуре 1X PBS, содержащий 200 мкм СНХ. Ресуспендируют паразитов культур в 1x PBS, содержащие 200 мкм СНХ и хранить на льду.
    Расчетный объем осадка РБК. Добавить буфера для лизиса (400 мМ ацетат калия, 25 мМ HEPES калия, рН 7,2, 15 мМ ацетата магния, 200 мкМ CHX, 1 мМ ДТТ, 1 мМ PMSF, 40 ед / мл РНКазы ингибитор, 1% (об / об) IGEPAL СА -630, и 0,5% (вес / объем) DOC) к осадку эритроцитов до конечного объема 4,25 мл в. Выдержите лизата на 4 ° C в течение 10 мин при вращении.
  5. Передача лизата с микропробирок, а затем центрифуги образцов в микроцентрифуге при 16000 х г и 4 ° C в течение 10 мин.
  6. Подготовка сахарозы подушки с помощью пипетки 1,25 мл холодного 0,5 М раствора сахарозы подушке (400 мМ ацетата калия, 25 мМ HEPES калия, рН 7,2, 15 мМ ацетата магния, 200 мкМ циклогексимид, 1 мМ ДТТ, 1 мМ PMSF, 40 ед / мл РНКазы Ингибитор и 0,5 М сахарозы) в SW55 ультрацентрифужную пробирку (13 х 51 мм).
  7. Тщательно слой 3,75 мл лизата надосадочной жидкости со стадии (7) в верхней части сахарозы подушке с помощью шприца и небольшое (~ 27) иглы калибра. Storэлектронной остальные лизат (~ 500 мкл) при -80 ° С для получения общего уровня РНК, как указано в разделе 1.
  8. Загрузка образцов в ультрацентрифужную ротора, предварительно охлажденной до 4 ° С, что может держать 13,2 мл трубки. Центрифуга образцов при 366000 х г и 4 ° С в течение 146 мин.
  9. С помощью пипетки, передача супернатант в 15 мл коническую трубку. Хранить надосадочную жидкость при температуре -80 ° С в течение выделения РНК свободных (несвязанных рибосомами) РНК.
  10. Ресуспендируют рибосом осадок в 500 мкл рибосомного буфера ресуспендирования (400 мМ ацетата калия, 25 мМ HEPES калия, рН 7,2, 15 мМ ацетата магния, 200 мкМ циклогексимид, 1 мМ ДТТ, 1 мМ PMSF, и 40 Ед / мл РНКазы ингибитора) с помощью пипетки в течение 5 мин.
  11. Центрифуга образцы в микроцентрифуге при 16000 мкг и 4   ° C в течение 10 мин.
  12. При поддержании градиент от Шаг # 4 на льду, удалить парафильмом, затем осторожно слой рибосомы подвески в верхней части градиента USIнг шприц и небольшой (~ 27) игла.
  13. Загрузка трубку в предварительно охлажденный ультрацентрифугирования ротора и центрифуги загруженные градиенты при 200000 х г и 4 ° С в течение 180 мин. Когда спина будет завершена, магазин центрифугируют градиенты на 4 ° С до готовности загрузить на ректификационной колонне.
  14. Загрузка пустую трубку в Ультрацентрифуга градиента ректификационной колонны (это может быть труба используется в предыдущем запуске), затем промыть РНКазы воды в течение 5 мин при 100 х 10 скорости.
  15. Во время стирки на этапе 6.16, установить чувствительность детектора УФ-поглощению. Хорошей отправной чувствительность 0,2, но это может должны быть скорректированы в дальнейшем бежит в зависимости от аналого 254 сигнала (который изменяется в зависимости от количества паразитов, и т.д.).
  16. После того, как чувствительность детектора установлен, установить базовый сигнал к нулю, а вода течет через детектор.
  17. После промывки коллектора фракций, обратный поток жидкости до линии не пусты, а затем бэрОве пустой Ультрацентрифуга трубку.
  18. Запуск 60% раствор сахарозы через ректификационную колонну, пока не выходит из устройства иглы.
  19. Вставьте пробирку первый градиент в верхней части загрузочной камеры и затяните уплотнение, стараясь не затягивайте. Затем проколоть дно трубки с иглой.
  20. Сброс скорости потока жидкости до 12,5 х 10 (контролируемой ручки управления скоростью потока на передней части насоса), а затем установить автоматизированную коллектор фракций для сбора фракций 18 сек (~ 330 мкл / фракция) в микроцентрифужных труб.
  21. Пуск вперед поток 60% раствора сахарозы.
  22. Когда первая капля градиента раствора падает в микроцентрифужных трубки, сразу же начинают сбор фракций как и живой записи аналого 254 сигнала.
  23. После того, как резкое падение наблюдается в А-254 сигнала, соответствующего интерфейса между 50% и 60% растворов сахарозы, как остановить поток текучей среды, и 254
  24. Храните градиентных фракций при -80   ° C для дальнейшего использования.
  25. Обратный поток жидкости при 100 х 10 скорость до 60% раствор сахарозы не впадает из ультрацентрифужную трубки.
  26. Если есть дополнительные градиенты для фракционирования, удалить пустую ультрацентрифужную пробирку из загрузочной камеры и перезапустить с шага 6.21. Если все образцы будут завершены, мыть аппарат как было выполнено с шагом 6,16 и 6,19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Глобальный профилирование человека микроРНК в P. тропической

Методы, представленные здесь, были использованы для извлечения микроРНК от паразитов в различных условиях. Одна вещь, чтобы отметить, что РНК извлечения для неинфицированных эритроцитов проводили, как указано в 32, который часто служил в качестве точки отсчета для данных микроРНК, представленных в этой статье как и оригинального исследования 29. Эти предыдущие исследования также показали, что ОБД эритроциты обладают гораздо большими уровни определенных микроРНК, Мир-451, в частности. Методы, указанные выше, были достаточно, чтобы показать изменения в микроРНК изобилия в HbS (HBA или HBSS), заражающих паразитов. Образцы РНК экстрагировали, как указано выше, и нормализованы в отношении рРНК 18S. Parasite образцы из ОБД эритроцитов, например, не показывают значительное увеличение уровня нескольких микроРНК, в том числе микроРНК-451 (рис 1). Поглощение микроРНК от принимающей erythrocyte также согласуется с предыдущими исследованиями, 34,35.

Трансфекция HbAA эритроцитов с микроРНК-451 увеличился HbAA Мир-451 до уровня аналогичных ССРХ эритроцитов (рис 1). Проточная цитометрия затем был использован для измерения паразитов инфекции, с тем чтобы оценить эффект микроРНК транслокации при росте паразита. Основываясь на том, что HbAA эритроциты трансфектированные Мир-451, микроРНК-223 и Мир-181A, наряду с олиго оцДНК, были рассмотрены за последствия микроРНК По рост паразита. Трансфекция одноцепочечной или Мир-181A не было никакого влияния на паразитемия (рис 2А - D), а трансфекции микроРНК-451 заметно снижается паразитемией, которые могут быть смягчены только со-трансфекции антисмысловую микроРНК-451 олиго.

Блокирование микроРНК путем трансфекции 2'-О-Me антисмысловых микроРНК показали, взаимное влияние. ОБД эритроциты, с естественно высших Мир 451-уровня, трансфецировали антисмысловыми микроРНК-451 или 2'-О-метил олигонуклеотидов (рисунок 3). Ингибирование микроРНК-451 увеличился рост паразита в обоих ССРХ эритроцитов (рис 3C - F). Parasite проценты были рассчитаны по крайней мере, 3 независимых трансфекции, затем усредняются и представлены в виде кратного изменения по отношению к росту ССРХ (рис 3F).

Захват микроРНК-мРНК синтеза РНК на биотин захвата анализа

После трансфекции 5'-desthiobiotin-MIR-451 (5'Db-Мир-451) и 5'Db-Мир-181, как указано в разделе 5 методов, было установлено, что наблюдаемая последовательность микроРНК возникла с человека микроРНК. Анализ Qrt-ПЦР показал, что трансфекция 5'Db-MIR-451 в результате обогащения слитых транскриптов ПКА-R (рисунок 4).

Полисом разделение для определения рибосомной занятость P. тропической

палатка "> а Типичный 254 след показано на рисунке (с северной подтверждения содержания рРНК на рис 5B), с плотностью доля увеличивается слева направо на графике (т.е. более легкие фракции слева). Первоначальная А 254 достаточно высока из-за поглощения гемоглобином в начале фракций, но быстро падает до исходного уровня. Первый небольшой пик соответствует малой субъединицы рибосомы (40S), затем быстро второго пика, который немного больше, и соответствует большой рибосомальной субъединицы (60S). Третий пик, который, как правило, самый большой за П. малярийного, соответствует пику monosome (80S). Благодаря своей высоте, 80S должны быть использованы в качестве руководства для регулировки чувствительности детектора УФ для последующих запусков (Шаг 6.17). Кроме того, из-за размера пика 80S, он является общим для 60-х сигнал, чтобы размыть как "плечо" в начале пика monosome, если оба 60S 80S иСигналы большой.

После пика monosome являются пики, соответствующие полисом. Каждый последующий пик представляет собой фракцию, представляющую полисом постепенно большее число рибосом (2, 3, 4 и т.д.). Каждый пик полисом также меньше, чем в предыдущем пике, уменьшая по высоте на 2-3 раза с каждым последующим номером полисом. Типичные работает позволит разрешение полисом, состоящих из 5-7 рибосом, хотя разрешение до 9-мерного полисом было отмечено в некоторых трасс с большим количеством исходного материала. Высшие полисом заказа составляют оставшуюся часть следа, и не может быть решен в рамках этих градиентных условиях.

фигура 1
Рисунок 1: МиР-451 повышен в ОБД эритроцитов Intraparasitic микроРНК-451 уровней, как это определено ПЦР в реальном времени и нормализуется против 18S рРНК, от паразитов, выделенных из указывается.типы эритроцитов. Значения среднее ± SE.

фигура 2
Рисунок 2: Повышенная экспрессия микроРНК-451 в нормальном эритроцитов тормозит рост паразита (А - С) Типичные участки FACS, указывающие уровень инфицирования, в процентах от общего РБК, обозначены М1, за показанные типов эритроцитов.. (D) Композитные уровень заболеваемости, полученные от FACS и нормированные против нетрансфицированных HbAA эритроцитов. Значения в панели переменного тока являются представительными FACS участки, а D является среднее ± SE.

Рисунок 3
Рисунок 3:. Ингибирование микроРНК-451 в серпа эритроцитов клеток повышает рост паразита (A - E) Представитель FACS участков, указывающие уровень инфицирования, в процентах от общего РБК, обозначены М1, за проявленный ERythrocyte типа. (F) Композитный уровень заболеваемости, полученные от FACS и построенные как нормализованное значение от нетрансфицированных HbAA эритроцитов. Значения в панели AE являются представительными FACS участки, значит, Р ± SE.

Рисунок 4
Рисунок 4: Трансфекцию микроРНК-451 обогащает для термоядерных транскриптов ПКА-R и показывает, что слитый микроРНК является эритроцитарная происхождения Обогащение указанных desthiobiotin-сопряженных микроРНК-мРНК синтеза транскриптов, которые были захвачены стрептавидином.. Значения были измерены с помощью ПЦР в реальном времени и нанесены в виде относительной величины по сравнению с не-трансфицировали паразитов. Значения среднее ± SE.

Рисунок 5
Рисунок 5:. Паразитов рибосомы может быть выделен с помощью градиента сахарозы (A - B) Exampле следы профиль полисом, извлеченной из малярийного плазмодия. (А) След профиль полисом, извлеченной из малярийного плазмодия, с 40S, 60S, 80S и полисом пиков (с #s указанием количества рибосом, связанных) отображается. (B), Северная блот 18S рРНК 28S и по рибосомных фракций. Значения среднее ± SE.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

HbS является одним из наиболее распространенных вариантов гемоглобина в эндемичных районах малярия, главным образом потому, что обеспечивает защиту от тяжелой малярии, вызванной P. тропической. Методы, необходимые, чтобы охарактеризовать роль человека микроРНК в регуляции генов Р. тропической подробно всей этой рукописи. Посредством извлечения общей РНК таким образом, чтобы включать в себя все малые РНК, и путем выполнения относительно простой процедуры паразит лизиса, эти РНК слитые смогли быть определены с помощью различных независимых методов.

Эти шаги относительно проста, но чувствительны к проблемам загрязнения и, если не соблюдаются должным образом. Во время извлечения паразита, важно для выполнения сапонина лизис удалить загрязнения хост эритроцитов. Это особенно верно в течение сапонин лизиса этапе выделения РНК. МикроРНК компонент принимающих красных кровяных клеток, в несколько порядков гля большей, чем паразита, в части из-за большинства эритроцитов будучи инфицированы, поэтому очень важно, чтобы удалить как можно больше эритроцитарного загрязнения, как это возможно. Важно также, чтобы сохранить культуру малярии в здоровом и правильном этапе (если конкретная точка в цикле инфекции требуется), чтобы получить точный профиль микроРНК. Точно так же, во время извлечения фенола и хлороформа, это жизненно важно, чтобы убедиться, что водные фазы ясны и, если нет, повторите добычу фенол-хлороформ, чтобы избежать оставшиеся загрязнения.

Кроме того, в эксперименте захвата desthiobiotin, важно, чтобы элюировать с избытком биотин и использовать минимум стрептавидином бусин, с тем чтобы обеспечить надлежащую конкретный элюирование. Вымывание связанных РНК посредством конкуренции с биотин, а не полной денатурации гранул сами, служил резко сократить обогащение фон РНК. Наконец, была подчеркнута эксперимент захвата desthiobiotinS один важный способ, чтобы продемонстрировать, как эти микроРНК были захвачены, но несколько другие методы также были использованы в предыдущих исследованиях, чтобы продемонстрировать эти РНК слияния, такие как пятна и северных анализа защиты рибонуклеазы 29. Такие способы применения трансфицированных микроРНК, чтобы получить модифицированные транскрипты может иметь более широкое применение, например, при очистке белковых комплексов, связанных, которые могут опосредовать перенос и обработку трансфицированных микроРНК.

В то время как различные геномные подходы были использованы для изучения протеома малярии и транскриптом 22-25, есть несколько методов, в глобальном масштабе изучить поступательное регулирование в P. тропической 21,26. Этот методологический ограничение исключает глобального анализа поступательного регулирования в P. тропической. Одним из наиболее распространенных экспериментальных подходов к изучению регулирование поступательное является полисом профилирование, который оценивает общую переводаль активность основана на рибосомах, нанесенных на специфических мРНК, представляющих интерес. Подробное в этой рукописи является оптимизированная методом профилирования полисом для использования в малярийных паразитов, которые лизирует как зараженный эритроцитов и паразита в. Предыдущие методы не восстановить большинство полисом и сделал это кажется, как будто малярийные паразиты не имеют существенные популяции полисом. Использование буфера для лизиса с высокой концентрацией ацетата калия и магния позволило лизировать как эритроциты и паразитов, а солюбилизации мембраносвязанных рибосом, чтобы захват интактных полисом.

Это экономически эффективный способ очистки рибосомальной и профилирования поможет преодолеть разрыв в знаниях между транскриптома малярии и протеома и включить генома анализ поступательного состоянии P. тропической. Этот подход был использован для сравнения перевода состояние ранней и поздней стадии бэтап LOOD паразитов 28, которые плотно координируется генной экспрессии. Данные о рибосомной загрузки транскриптов могут быть легко получены и проанализированы для определения плотности рибосом на специфических мРНК. Кроме того, в сочетании с синхронизацией сорбит, изменения в рибосомной плотности может быть использована для установления, как перевод регулируется по всей паразитом жизненного цикла. Выделение рибосом с использованием этого подхода требует большого количества культуры, которые, к сожалению ограничивает этапы жизненного цикла малярии, в котором она может быть выполнена. Большое количество исходного материала будет также ограничить его использование как в пробирке в лаборатории штаммов малярийного плазмодия, и может ограничить его применимость к другим инфекционным организмов. Любое использование этой процедуры также будет в состоянии проверять генов, которые показывают необычные профили перевода, в частности стенограмм, которые не связаны с рибосомами, отражая альтернативные способы регуляции генов. В заключение,этот подход позволит нам оценить, насколько новые противомалярийные средства влияют трансляции белка и определить механизмы перевода на основе лекарственной устойчивости. Этот трубопровод имеет большую полезность в выявлении и определении пост-транскрипционной регуляции во многих экспериментальных системах.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
REAGENTS-All reagents must be RNAse-free.
Diethyl pyrocarbonate Sigma D5758 DEPC
DEPC-treated water (see REAGENT SETUP)
Yoyo-1 DNA fluorescent dye Thermo Fisher
Gene Pulser II electroporator Bio-Rad
0.2 cm Electroporation cuvettes
4 M potassium acetate Mallinckrodt 6700
2 M potassium HEPES Sigma H0527 pH 7.2
1 M magnesium acetate Sigma M-2545
1 M dithiothreitol Research Products International D11000 DTT
100 mM phenylmethylsulfonate fluoride Sigma P7626 PMSF, dissolved in isopropanol
10% (v/v) Igepal CA-630 Sigma-Aldrich I3021
10% (w/v) sodium deoxycholate Sigma D-6750 DOC
Cycloheximide Sigma C-7698 CHX
Sucrose Mallinckrodt 8360-04
RNAseOUT (Invitrogen, cat. no. 100000840) Invitrogen 100000840
RPMI-1640 w/ L-glutamine Cellgro 10-040-CV
10% AlbuMAX I Invitrogen 11020-039 w/v in sterile water
Gentamicin Gibco 15750-060
HT supplement (100x) (Invitrogen, cat. no. 11067030)
45% (w/v) sucrose (Sigma, cat no. G8769)
1 M HEPES buffer (Gibco, cat. no. 15630-080)
1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)
Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)
Glass slides (VWR, cat. no. 48311-702)
Giemsa stain (50X) (VWR, cat no. m708-01)
mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).
5' Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)
Biotin powder (Sigma-Aldrich)
1 M Potassium Chloride
Streptavidin Sepharose High Performance Beads (GE Healthcare)
Ribosome resuspension buffer (see REAGENT SETUP)
Lysis buffer (see REAGENT SETUP)
15% (w/v) sucrose gradient solution (see REAGENT SETUP)
50% (w/v) sucrose gradient solution (see REAGENT SETUP)
0.5 M sucrose cushion (see REAGENT SETUP)
60% (w/v) sucrose chase solution (see REAGENT SETUP)
Plasmodium cell culture media (see REAGENT SETUP)
RNA capture Wash Buffer (see REAGENT SETUP)
RNA Elution Buffer (see REAGENT SETUP)
REAGENT SETUP
Solutions
Plasmodium cell culture media
500 ml RPMI-1640 w/ L-glutamine
0.5 ml gentamicin
5 ml HT supplement
2.5 ml 45% glucose
25 ml 10% AlbuMAX I
12.5 ml 1 M HEPES
Sterile filter with 0.2 mm vacuum filter flask.
Plasmodium cell culture media containing 10x CHX
Same recipe as Plasmodium cell culture media above, with the addition of:
2 mM cycloheximide
Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter. 
1x PBS containing cycloheximide
Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.
Ribosome resuspension buffer
400 mM potassium acetate
25 mM potassium HEPES, pH 7.2
15 mM magnesium acetate
200 mM cycloheximide (add fresh)
1 mM DTT (add fresh)
1 mM PMSF (add fresh)
40 U/ml RNaseOUT (add fresh)
Lysis buffer
Same recipe as ribosome resuspension buffer above, with the addition of:
1% (v/v) Igepal CA-630
0.5% (w/v) DOC
Sucrose solutions
Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:
15% (w/v) sucrose to make 15% sucrose gradient solution
50% (w/v) sucrose to make 50% sucrose gradient solution
0.5 M sucrose to make 0.5 M sucrose cushion
As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.
The 60% sucrose chase solution requires only sucrose and water, no other components
60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution
RNA Capture Wash Buffer
20 mM  KCl
5 unit/ml Rnase Out (Invitrogen)
RNA Capture Elution Buffer
Same recipe as RNA Capture Wash Buffer, with the addition of:
2 mM Biotin
EQUIPMENT
SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)
SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)
Ultra-ClearTM ½ x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)
Polyallomer 9/16 x 3 ½ in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)
L8-80M ultracentrifuge (Beckman)
Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)
1 ml syringe with 27 G½ needle (Becton Dickinson, cat no. 309623)
5 ml syringe (Becton Dickinson, cat. no. 309646)
Parafilm
Tube rotator, end-over-end
Microcentrifuge, refrigerated
Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)
TracerDAQ (Measurement Computing)
Eppendorf 5810R centrifuge
Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)

DOWNLOAD MATERIALS LIST

References

  1. World Health Organization. World Malaria Report. (2014).
  2. Livincstone, F. B. Malaria and human polymorphisms. Annu Rev Genet. 5, 33-64 (1971).
  3. Nagel, R. L., Roth, E. F. Malaria and red cell genetic defects. Blood. 74, 1213-1221 (1989).
  4. Aidoo, M., et al. Protective effects of the sickle cell gene against malaria morbidity and mortality. Lancet. 359, 1311-1312 (2002).
  5. Tiffert, T., et al. The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum. Blood. 105, 4853-4860 (2005).
  6. Fairhurst, R. M., et al. Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 435, 1117-1121 (2005).
  7. Cyrklaff, M., et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 334, 1283-1286 (2011).
  8. Friedman, M. J. Erythrocytic mechanism of sickle cell resistance to malaria. Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).
  9. Pasvol, G., Weatherall, D. J., Wilson, R. J. Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria. Nature. 274, 701-703 (1978).
  10. Lecellier, C. H., et al. A cellular microRNA mediates antiviral defense in human cells. Science. 308, 557-560 (2005).
  11. Niu, Q. W., et al. Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nature biotechnology. 24, 1420-1428 (2006).
  12. Zhao, G., Yu, D., Weiss, M. J. MicroRNAs in erythropoiesis. Curr Opin Hematol. 17, 155-162 (2010).
  13. Lee, Y. T., et al. LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo. Blood. 122, 1034-1041 (2013).
  14. Sangokoya, C., Doss, J. F., Chi, J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS genetics. 9, e1003408 (2013).
  15. Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS ONE. 3, e2360 (2008).
  16. Sangokoya, C., Telen, M. J., Chi, J. T. microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116, 4338-4348 (2010).
  17. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic acids research. 29, 850-853 (2001).
  18. Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryotic cell. 2, 830-840 (2003).
  19. Baum, J., et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic acids research. 37, 3788-3798 (2009).
  20. Hall, N., et al. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. 307, 82-86 (2005).
  21. Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. Genome-wide regulatory dynamics of translation in the asexual blood stages. eLife. 3, (2014).
  22. Oehring, S. C., et al. Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum. Genome biology. 13, R108 (2012).
  23. Lasonder, E., et al. Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry. Nature. 419, 537-542 (2002).
  24. Bozdech, Z., et al. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS biology. 1, E5 (2003).
  25. Gardner, M. J., et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 419, 498-511 (2002).
  26. Zhang, M., Joyce, B. R., Sullivan, W. J. Jr., Nussenzweig, V. Translational control in Plasmodium and toxoplasma parasites. Eukaryotic cell. 12, 161-167 (2013).
  27. Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. Polysome profiling of the malaria parasite Plasmodium falciparum. Molecular and biochemical parasitology. 179, 42-62 (2011).
  28. Bunnik, E. M., et al. Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum. Genome biology. 14, R128 (2013).
  29. LaMonte, G., et al. Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance. Cell host & microbe. 12, 187-199 (2012).
  30. Lambros, C., Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. The Journal of parasitology. 65, 418-420 (1979).
  31. Bourgeois, N., et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).
  32. Abruzzo, L. V., et al. Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data. Biotechniques. 38, 785-792 (2005).
  33. Sangokoya, C., LaMonte, G., Chi, J. T. Isolation and characterization of microRNAs of human mature erythrocytes. Methods in molecular biology. 667, 193-203 (2010).
  34. Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. Analysis of short RNAs in the malaria parasite and its red blood cell host. FEBS Lett. 580, 5185-5188 (2006).
  35. Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection. Malar J. 7, 47 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics