Metoder för att undersöka den reglerande roll små RNA och Ribosomalt Beläggning av * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

LaMonte, G., Walzer, K. A., Lacsina, J., Nicchitta, C., Chi, J. T. Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum. J. Vis. Exp. (106), e53214, doi:10.3791/53214 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den genetiska variationen som ansvarar för sicklecell-allelen (HbS) möjliggör erytrocyter att motstå infektion av malariaparasiten P. falciparum. Den molekylära grunden för detta motstånd, som är känd för att vara multifaktoriell, förblir ofullständigt förstådd. Nyligen genomförda studier funnit att det differentiella uttrycket av erytrocyt mikroRNA, en gång translokerade i malariaparasiter, påverkar både genreglering och parasittillväxt. Dessa miRNAs senare visat sig hämma mRNA-translation genom att bilda en chimär RNA-transkript via 5 'RNA-fusion med diskreta undergrupper av parasit mRNA. Här, de tekniker som användes studera den funktionella roll och förmodade mekanism underliggande erytrocyt mikroRNA på genreglering och translationell potential P. falciparum, inklusive transfektion av modifierade syntetiska mikroRNA i värd erytrocyter, kommer att presenteras. Slutligen är en polysom ​​gradientmetoden användes för att bestämma graden av translation av dessa transkript. Tillsammans utgör dessa tekniker tillät oss att visa att de oreglerad nivåer av erytrocyter mikroRNA bidrar till cell inneboende malariamotståndet hos sickle erytrocyter.

Introduction

Malaria orsakas av apicomplexan parasiter av släktet Plasmodium, är den vanligaste mänskliga parasitsjukdom, globalt infekterar cirka 200 miljoner människor varje år och orsakar cirka 600.000 dödsfall 1. Av de fem Plasmodium arter som infekterar människor, den mest relevanta för mänskliga sjukdomar är P. falciparum och P. vivax, på grund av deras omfattande fördelningar och potential mot svår malaria komplikationer. Livscykeln för malariaparasiten kräver infektion av både myggor och människor. När en smittad mygga biter en människa, parasiterna färdas genom blodomloppet till levern, där en första omgång av replikering sker. Efter merozoiter bristning från värd hepatocyt, de infekterar närliggande röda blodkroppar, initiera antingen asexuell eller sexuell replikering. Asexuell etappen av replikering, som varar 48 timmar i P. falciparum, är i fokus för denna studie, eftersom det är både källan till de flesta malaria symtom och lätt rekapituleras in vitro.

Även om ett antal initiativ folkhälso, inklusive förbättrade anti-malaria terapier, något har minskat bördan av malaria globalt, den fortsatta utvecklingen av läkemedelsresistenta parasiter utgör ett problem för malariastyrningansträngningar. Ett område som kan föreslå nya behandlingsmetoder är studien om hur olika genetiska varianter ger resistens mot malaria. I malariaendemiska regioner, en mängd erytrocytparametrar polymorfismer är ganska vanligt 2,3. Dessa mutationer, med sickle-cell är kanske den mest framträdande, är ofta förknippade med betydande motstånd mot symptomatisk malariainfektion 4. De bakomliggande mekanismerna genom vilka de orsakar erytrocyter att motstå malariainfektion är ofullständigt känd. Parasiterade erytrocyter med hemoglobin mutationer är föremål för förstärkt fagocytos genom ökad cellulär styvhet och uttorkning, vilketär förknippad med minskad invasion av P. falciparum 5. HBC allelen påverkar också proteinuttryck på erytrocyter ytan och med ombyggnaden av cytoskelettet ytterligare hämma parasitutveckling 6,7. Slutligen P. falciparum växer dåligt i homozygot skäran (HBSS) erytrocyter 8,9 in vitro, vilket tyder på inneboende erytrocytparametrar faktorer av malaria motstånd. Trots att alla dessa mekanismer verkar spela en roll, de inte helt förklara mekanismerna bakom sicklecell resistens mot malaria.

En potentiell uppsättning erytrocytparametrar faktorer som förblir dåligt förstådda är den stora poolen av miRNA närvarande inom mogna erytrocyter. MicroRNAs är små icke-kodande RNA-sekvenser, 19-25 nt i storlek, som förmedlar translationen och / eller stabiliteten för mål-mRNA genom basparning inom 3 'UTR. De har varit inblandade i kontrollen av däggdjursimmunsvar, inklusive undertryckande of virusreplikation 10, och visade sig ge resistens mot virus i växter De har också visat att reglera flera erytrocytparametrar processer, inklusive erytropoes 11,12 och järn metabolism 13. Tidigare studier identifierade en riklig och varierande population av erytrocytparametrar miRNA, vars uttryck dramatiskt förändrat i HBSS erytrocyter 14,15. Eftersom mogna erytrocyter saknar aktiv transkription och translation, förblir den funktionella rollen för dessa erytrocyt miRNA oklar. Som betydande materialutbyte sker mellan värdcellen och P. falciparum under intraerythrocytic utvecklingscykeln (IDC) 16, var det spekulerats i att den förändrade miRNA profil inom HBS erytrocyter direkt kan bidra till cell inneboende malariamotstånd.

Dessa studier ledde slutligen till utvecklingen av en rörledning för att isolera, identifiera och funktionellt studera betydelsen av mänskliga miRNA inom mAlaria parasit, P. falciparum, vilket indikerade att de värd / mänskliga miRNA slutligen kovalent säkring och sedan translationellt undertrycka parasit mRNA-transkript 17. Detta gav ett exempel på de första tvär arter chimära transkript som bildas av trans-splitsning och implicerar att miRNA-mRNA fusion kan förekomma hos andra arter, inklusive andra parasiter. Alla trypanosom mRNA är trans skarvad med en skarvledare (SL) för att reglera separationen av polycistroniska transkript 18. Eftersom P. falciparum saknar ortologer för Dicer / Ago 19,20, är det möjligt att erytrocyter miRNAs kapa liknande SL maskiner i P. falciparum att integreras i målgener. Nyligen genomförda studier i P. falciparum har faktiskt indikerade närvaron av 5 'splitsledarsekvenser 21. Denna studie detaljer de metoder som ledde till upptäckten av människan parasit miRNA-mRNA fusionstranskript, inklusive både transcriptomic och översättnella regleringsmetoder. De övergripande målen för dessa metoder är att undersöka effekterna av små RNA i genreglering, fenotyper och översättnings potential P. falciparum-transkript.

Den ursprungliga identifiering av mänskliga-parasit chimära transkript åberopas användning av RNA-analystekniker, såsom realtids-PCR, transkriptom sekvensering och EST bibliotek fånga, som inkluderade både totalt och små RNA, snarare än att använda tekniker som endast isolerade små RNA. Isolera alla RNA tillsammans i en stor pool, i stället för separat, medgav identifiering av både translokerade humana små RNA i parasiten såväl som närvaron av dessa små RNA-sekvenser som en del av en större sekvens. Detta krävs då en analys av översättningen tillståndet hos dessa fusions mRNA för att fastställa de funktionella konsekvenserna av dessa fusioner.

Omfattande insatser för karakterisering av parasitens genom end transkriptom har lagt till förståelsen av parasitens biologi 22-25, är betydligt mindre känt om translationell reglering av mRNA transkriptom hela livscykel P. falciparum 26. Denna begränsade förståelse av parasitens proteomet har hindrat både förståelsen av parasitens biologi och förmågan att identifiera nya mål för nästa generation av anti-malarialäkemedel. Denna brist i förståelsen av parasitens cellbiologi har bestått i hög grad på grund av bristen på lämpliga metoder för att undersöka translationell reglering i P. falciparum. En nyligen papper beskrev användningen av ribosomala avtryck av P. falciparum att fastställa den globala översättningsstatus 21. En väletablerad mätning av translationell potential transkript är antalet associerade ribosomer bestäms av polysom ​​profilering. Men när denna teknik används till P. falciparum </ em>, är det omöjligt att återhämta sig de flesta polysomer och fångar främst monosomes. Nyligen har flera grupper 27,28 optimerad P. falciparum polysom ​​tekniker genom lysering av erytrocyter och parasiten samtidigt bevara polysomer och karakterisera det ribosomala beläggning och translationell potentialen hos dessa malariaparasiter under asexuell utveckling i värd röda blodkroppar 28.

Tillsammans står dessa metoder visar att den observerade fusion av humana miRNA och parasit mRNA modulerar parasit protein översättning av dessa fusions mRNA, vilket visades med hjälp av tidigare rapporterade metoder 27, och är en viktig faktor för malaria motstånd i HBA och HBSS erytrocyter 17. Dessa metoder skulle vara användbar i alla system som vill identifiera och funktionellt undersöka RNA splits händelser, vare sig dessa fusions RNA är inom P. falciparum eller andra eukaryota system.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1: Isolering av små dimensioner RNA från P. falciparum Under IDC

  1. Skaffa malariaparasiter i asexuell kultur 29.
    OBS! Krävs kultur storlek varierar beroende på den önskade tillämpningen, emellertid en 10 ml odling vid 3-5% parasitemi och 5% hematokrit ger gott RNA för realtids-PCR (RT-PCR). Tekniken var ursprungligen optimerat för asynkrona kulturer, men när specifika tidpunkter under infektionscykeln önskas, kan ringstegs parasiter synkroniseras genom sorbitol synkronisering senast 10-12 h efter invasion. Synkronisering bör upprepas efter en cykel (ca 48 h) 29.
  2. Pool-infekterade celler tillsammans (~ 5 x 10 9 RBCs vid 3-5% parasitemi) och fyll kall PBS till toppen av röret och centrifugera vid 800 xg under 5 min utan broms för att pelletisera de röda blodkropparna.
  3. Efter centrifugering, avlägsna supernatanten försiktigt med en aspire pipett fästtill ett vakuum, eftersom erytrocytiska pellets är lätt att rubba. Tvätta pelleten en gång med kall 1 x PBS.
  4. Resuspendera cellpelleten i kallt 0,15% saponin (i 1x PBS) och placera på is under 30 minuter.
  5. Centrifugera cellerna vid 1500 xg under 12 min vid 4 ° C, avlägsna supernatanten (som kommer att vara mörkt röd till färgen) och återsuspendera pelleten i kall PBS. Upprepa det här steget en gång.
    OBS: För att säkerställa att de mikroRNA närvarande var reflekterande av mikroRNA inom parasiter, och inte erytrocytiska kontamination, ett antal parasitisoleringsbetingelser testades: 1) saponin lys, 2) saponin lys kombinerat med RNasA behandling av värdcells miRNA och 3 ) Metyl-beta-cyklodextrin behandling för att avlägsna parasiten från värd erytrocyt. Alla behandlingar gav liknande resultat.
  6. Lyse den isolerade parasiten pellets med hjälp av de rekommenderade 600 il lysbuffert. Denna volym lysbuffert är tillräcklig för odlingar upp till ~ 30 ml vid 2% hematokrit och 5% parasitemi.
    OBS: För större parasitkulturer kan ökas denna volym. Det är viktigt att säkerställa fullständig lys av parasiten pelleten genom grundlig virvling under minst en minut. Också, för att underlätta extraktion, de lyserade proverna kan överföras till ett 1,7 ml mikrocentrifugrör.
  7. Addera 60 pl, eller 1/10 volym av lysbuffert användes i steg 6, av homogenat tillsats (2 M natriumacetat, pH 4).
  8. Lämna prover på is under 10 minuter.
  9. Lägg 600 pl, eller en volym som motsvarar den mängd lysbuffert tillsätts i steg 6, syra fenol kloroform till varje prov och skaka i 1 minut.
  10. Separera de vattenhaltiga och organiska faserna genom centrifugering av proverna vid 10 tusen xg under 5 minuter. Denna spin är längre än vad som föreslagits av satsen för att säkerställa att alla hemoglobin / hemozoin är i den organiska fasen.
  11. Samla upp den övre (vattenhaltiga) skiktet och överföra den till ett nytt rör. Upprepa steg 9 och 10 om vattenfasen är vit eller (mer troligt) brun färg, vilket tyder på protein förorening.
  12. Bestämma volymen av den resulterande supernatanten med pipett och sedan lägga till 1,25 volymer av 100% etanol (~ 800 | al) och blanda genom att vända 1,7 ml mikrocentrifugrör 5 gånger.
  13. Passera varje prov genom en tillgänglig RNA-bindande filterpatronen (flera olika av dessa är tillgängliga kommersiellt) genom antingen centrifugering vid 14 tusen xg i 1 min eller genom användning av en vakuumgrenröret.
  14. Tvätta filterpatronen med 700 ul av miRNA tvättbuffert 1 med hjälp av en mikro, spinning vid 14.000 xg under 1 minut.
  15. Tvätta filterpatronen med 500 pl tvättbuffert 2/3 två gånger genom centrifugering vid 14 tusen xg i 1 min vardera.
  16. Eluera RNA med 100 | il DEPC-vatten, som har förvärmts till 95 ° C, i två tvättar med 50 | j, l, centrifugering vid 14.000 xg i 1 min vardera. Mäta koncentrationen av RNA via UV-absorbans vid 260 nm.
    OBS: En RNA-gel (antingen TBE-urea akrylamid eller denaturering formaldehyd agarosgel) kan be används för att bedöma storleksfördelningen av de isolerade RNA.
    OBS: Detta RNA är lämplig för analys av microarray, RNA-sekvensering, northern blöt och ribonukleas-skyddsanalys.

2: Kvantifiering av små dimensioner RNA från P. falciparum Under IDC

  1. Bestäm koncentrationen av individuella prov som isolerats i steg 1 med användning av UV-spektrofotometri vid 260 nm.
  2. Generera realtid PCR-primers för önskade RNA-slag. För miRNA Enbart använde vi premade miRNA qPCR analyser, medan det för mRNA eller fusion miRNA-mRNA vi utformade primers för SYBR green. För fusions RNA, den framåtriktade primem var miRNA sekvensen själv (MIR-451: AAACCGTTACCATTACTGAGTT), medan det omvända var en gen-specifik primer ~ 100 bp nedströms av miRNA i mRNA-sekvensen (PKA-R: ATCGAACATGCTGTGAACAT).
  3. Gör cDNA från RNA-prov med hjälp av antingen en hårnål primer för miRNAs (använd 20-40 ng RNA) ensam eller slumpmässiga hexamerer för mRNA och / eller miRNA-mRNA fusions arter (med hjälp av ett mikrogram av RNA). Blanda RNA och primers under 5 minuter vid 65 ° C, kyl sedan till rumstemperatur. Efteråt till omvänt transkriptas mix (0,5 l omvänt transkriptas, 0,5 pl RNas-inhibitor, 1 pl dNTP (2,5 mM vardera), 4 pl 5x buffert, 2 pl 0,1 M DTT, 1 pl H2O).
    1. Kör prov på en termo kan detektera antingen SYBR Green eller TaqMan prober. SYBR grön kvantitativ PCR 30 för specifika gener drevs som ett 3-stegs PCR, 95 ° C under 15 sek, lägsta primerparning temperatur minus 5 ° C under 30 sek, och 68 ° C under 30 sek, i 40 cykler, med användning av en kommersiell SYBR gröna Master Mix. miRNA realtids-PCR kördes som en två-stegs PCR, 95 ° C under 15 sek och 60 ° C under 1 min, under 40 cykler.
    2. Kvantifiera analyser som använder den ΔΔCt metod och normalisera dem mot antingen Rab GTPas (PF08_0110) eller 18S rRNA 31.

3: Introduktionav små RNA i malariaparasiter

  1. Pellets 300 pl röda blodkroppar per transfektion (250 pl av RBC, ca 1,5 x 10 9 celler, i slutändan kommer att användas) i komplett malaria media genom centrifugering vid 800 xg under 5 min vid broms 1.
  2. Tvätta erytrocyterna två gånger med RPMI och återsuspendera i komplett cytomix (120 mM KCl; 0,15 mM CaCl2; 10 mM K 2 HPO 4 / KH 2 PO 4, pH 7,6; 25 mM HEPES, pH 7,6; 2 mM EGTA, pH 7,6; 5 mM MgCl2; pH justerat med KOH) vid 50% hematokrit efter centrifugering vid 800 xg under 5 min vid broms 1.
  3. Överföra celler till en 0,2 cm elektroporeringskyvett.
  4. Addera 10 ^ g, eller lämplig mängd, av anpassade syntetiska oligonukleotider till kyvetterna och suspendera kulturerna.
  5. Justera elektroporator till 310 V / 950 iF och leverera en puls till varje kuvett.
  6. Resuspendera 300 ul av de röda blodkropparna i kuvetten i förvärmda komplett malaria medier och plattan dem i plattor med 24 brunnar och inkubera vid 37 ° C i en lufttät behållare med malaria blodgas blandning (3% O2, 5% CO2).
  7. Efter 4 timmar, infektera transfekterade RBC med synkroniserade sena trofozoiter till en ungefärlig slut parasitemia på 1%.
  8. Lägg nyligen transfekterade RBC var 4-6 dagar infekterade kulturer och bestämma parasitemia% genom FACS med användning YoYo-1 färgning, enligt vad som anges i avsnitt 4.

4: Fastställande av Erytrocyt mikroRNA effekt på parasitinfektion Rate

  1. Ta 100 pl suspenderad kultur av mikropipett och placera det i en 1,7 ml mikrocentrifugrör. Tvätta två gånger med 1 ml 1 x PBS och centrifugera i en bordsmikrocentrifug genom centrifugering vid 800 xg under 5 minuter.
  2. Resuspendera pelleten i 1 ml av 0,025% glutaraldehyd. Inkubera prover för 20 min vid RT.
    OBS: prover kan förvaras här i flera veckor vid 4 ° C. Efteråt, pellets den infekterade RKand genom centrifugering vid 800 x g under 5 min. Tvätta två gånger med 1 ml 1 x PBS.
  3. Resuspendera pelleten i 1 ml av 0,015% saponin. Inkubera vid 4 ° C under 15 minuter. Pellets infected RBC genom centrifugering vid 800 xg under 5 minuter. Tvätta två gånger med 1 ml 1 x PBS. Repeat.4.3. Resuspendera cellerna i 1 ml 1 x PBS innehållande 1 pl (1,000X) DNA-fläck.
  4. Bestäm graderna parasitemi på en flödescytometer, vid 488 nM excitation och ~ 530 nM (FL-1) utsläpp.
  5. Först grind flödescytometern baserad på FSC och SSC för att fokusera på RBC. Mät sedan graderna parasitemi (infekterade RBC) i gated RBC genom fluorescens i FL-1 kanal.
    OBS: senare skede parasiter är 10X mer fluorescerande än tidigare skede parasiter, och ~ 100X över oinfekterade RBC. Också, uppsamling vid låg hastighet tenderar att minska buller. Slutligen har denna strategi jämförts med 3 H-hypoxantin inkorporering och Giemsa färgning, både som tidigare rapporterats 13, och alla tekniker GAVe liknande resultat.

5: Biotin-märkning och Eluering av miRNA-mRNA Fusion produkter

  1. Direkt beställa anpassade syntetiska RNA-oligonukleotider med destiobiotin (DB) kovalent kopplade till 5 'änden.
  2. Transfektera oinfekterade RBC med destiobiotin-konjugerat (DB) miRNA och omodifierad miRNA (negativ kontroll), såsom indikeras i steg 3.
  3. Infect transfekterade RBCs med P. falciparum parasiter till en start parasitemi av 0,5% (steg 1,1).
  4. Utdrag parasit RNA 4 dagar (96 h) senare som beskrivs ovan i steg 1.
  5. Inkubera 10 ug av parasit-RNA med 50 ^ packade streptavidinpärloma, sattes via mikropipett, och roterar på ett mikrocentrifugrör rotator för en timme vid 4 ° C.
  6. Pellets pärlorna vid 800 xg under 30 sekunder och tvätta med 20 mM KCl och 1/1000 RNas hämmare.
  7. Eluera RNA från pärlorna genom konkurrens med 2 mM biotin och med 200 pl RNA capture elueringsbuffert (20 mM KCl, 1/1, 000 RNas-inhibitor och 2 mM biotin) vid 4 ° C över natten med rotation.
  8. Bestämma graden av anrikning av indikerade P. falciparum-transkript med användning av SYBR Green QRT-PCR och mikroRNA anrikning (positiv kontroll) genom TaqMan qPCR såsom indikeras i steg 2.

6: polysom ​​Separation att Bestäm Ribosomalt Beläggning av P. falciparum

  1. Placera 5 ml 15% sackaroslösning (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 | iM cykloheximid, 1 mM DTT, 1 mM PMSF, 40 E / ml RNas-inhibitor, och 15% sackaros ) in i en SW41 ultracentrifugrör (14 x 89 mm).
  2. Med användning av en 5 ml spruta, tillsätt 5 ml 50% sackaroslösning (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 | iM cykloheximid, 1 mM DTT, 1 mM PMSF, 40 E / ml RNas hämmare och 50% sackaros) under 15% sackaros med hjälp av en lång stålnål, sedan bort nålen.
  3. Efter 2 h, långsamt luta röret tillbaka upprätt och överföra röret till is, så att den kan svalna under minst 15 min före provladdning (steg 14).
  4. Samla tillräckligt Plasmodium infekterade blodstadiet kultur att generera 100-500 pg av totalt RNA, eller uppskattningsvis en 100 ml asynkron kultur vid 3-5% parasitemi. Lägg 1/10: e att volym odlingsmedium innehållande 10x (2 mM) cykloheximid (CHX) och inkubera vid 37 ° C under 10 minuter.
    1. Pellet kulturer genom centrifugering vid 500 x g under 7 min med centrifugen (broms 1), tvätta sedan två gånger med rumstemperatur 1x PBS innehållande 200 | iM CHX. Resuspendera parasitkulturer i 1x PBS innehållande 200 iM CHX och förvara på is.
    Skatta volymen av RBC pelleten. Lägg lysbuffert (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 | iM CHX, 1 mM DTT, 1 mM PMSF, 40 E / ml RNas-inhibitor, 1% (volym / volym) IGEPAL CA -630, och 0,5% (vikt / volym) DOC) till RBC pelleten till en slutlig volym av 4,25 ml. Inkubera lysatet vid 4 ° C under 10 minuter under rotation.
  5. Överför lysatet till mikrocentrifugrör och centrifugera sedan proverna i en mikrocentrifug vid 16.000 xg och 4 ° C i 10 minuter.
  6. Förbered sackaros kuddar genom pipettering 1,25 ml kall 0,5 M sackaroskudde lösning (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 | iM cykloheximid, 1 mM DTT, 1 mM PMSF, 40 E / ml RNas inhibitor och 0,5 M sackaros) i en SW55 ultracentrifugrör (13 x 51 mm).
  7. Skikt försiktigt 3,75 ml lysat supernatanten (från steg 7) på toppen av den sackaroskudde med användning av en spruta och liten (~ 27) gauge nål. Store återstående lysatet (~ 500 l) vid -80 ° C för att extrahera den totala RNA-nivåer, som anges i avsnitt 1.
  8. Ladda proverna i en ultracentrifugrotor, pre-kylda till 4 ° C, som kan hålla 13,2 ml rör. Centrifugera proverna vid 366 tusen xg och 4 ° C under 146 minuter.
  9. Med hjälp av en pipett, överför supernatanten till en 15 ml koniska rör. Förvara supernatanten vid -80 ° C för RNA isolering av fri (obunden av ribosomer) RNA.
  10. Resuspendera ribosomen pelleten i 500 pl ribosomen resuspensionsbuffert (400 mM kaliumacetat, 25 mM kalium HEPES, pH 7,2, 15 mM magnesiumacetat, 200 | iM cykloheximid, 1 mM DTT, 1 mM PMSF, och 40 U / ml RNas-inhibitor) genom att pipettera under 5 min.
  11. Centrifugera proverna i en mikrocentrifug vid 16.000 xg och 4   ° C i 10 minuter.
  12. Samtidigt som gradient från steg # 4 på is, ta bort Parafilm, sedan försiktigt lager ribosomen upphängning på toppen av gradienten using en spruta och liten (~ 27) nål.
  13. Fyll på röret i en i förväg kyld ultracentrifug rötor och centrifugera de laddade gradienter vid 200 tusen xg och 4 ° C under 180 minuter. När spin är klar centrifug butik gradienter vid 4 ° C tills redo att lasta på fraktionatorn.
  14. Ladda en tom ultracentrifugrör in gradienten fraktionatorn (detta kan vara ett rör som används i en tidigare körning), tvätta sedan med RNas-fritt vatten under 5 min vid 100 x 10 hastighet.
  15. Under tvättningen i steg 6.16, ställa in känsligheten för UV absorbansdetektor. En bra utgångspunkt känslighet är 0,2, men detta kan komma att behöva justeras i senare körs beroende på A 254 signalen (som varierar beroende på parasitnummer etc.).
  16. När detektorkänslighet är inställd, ställ baslinjen signalen till noll medan vatten strömmar genom detektorn.
  17. Efter tvättning av fraktionssamlaren, vända vätskeflödet tills linjerna är tomma och sedan remove den tomma ultracentrifugrör.
  18. Kör 60% sackaroslösning genom fraktione tills det kommer ut nålen apparaten.
  19. Sätt röret med den första gradienten på toppen av laddningskammaren och dra tätningen, noga med att inte åt för hårt. Därefter, tränga igenom botten av röret med nålen.
  20. Återställ vätskeströmningshastigheten till 12,5 x 10 (styrd av flödeshastigheten reglaget på framsidan av pumpen), ställ sedan in den automatiska fraktionssamlare för att samla in 18 sek fraktioner (~ 330 | il / fraktion) i mikrocentrifugrör.
  21. Start framåt flöde av 60% sackaroslösning.
  22. När den första droppe av gradientlösningen faller in i mikrocentrifugrör omedelbart påbörja både fraktionsuppsamling och liveinspelning av A 254-signalen.
  23. När en kraftig nedgång observeras i A 254-signalen, motsvarande gränsytan mellan 50% och 60% sackaroslösningar, stoppa både vätskeflödet och A 254
  24. Förvara gradientfraktioner vid -80   ° C för senare användning.
  25. Omvänd vätskeflödet på 100 x 10 hastighet tills 60% sackaroslösning tömmer ur ultracentrifugrör.
  26. Om det finns ytterligare gradienter att fraktionera, ta bort den tomma ultracentrifugrör från laddningskammaren och starta om från steg 6,21. Om alla prover är klara, tvätta apparaten som utfördes i steg 6.16 och 6.19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Global profilering av mänskliga mikroRNA i P. falciparum

De tekniker som presenteras här användes för att extrahera mikroRNA från parasiter i en mängd olika förhållanden. En sak att notera är att RNA-extraktioner för oinfekterade RBC utfördes som anges i 32, vilket ofta fungerat som en referenspunkt för de uppgifter mikroRNA som presenteras i både den här artikeln och den ursprungliga studien 29. Dessa tidigare studier visade också att HBSS erytrocyter hade betydligt högre nivåer av vissa miRNA, MIR-451 i synnerhet. Teknikerna ovan angivna var tillräckliga för att påvisa förändringar i miRNA överflöd i HBS (HBA eller HBSS) infekterar parasiter. RNA-prov extraherades enligt ovan och normaliseras mot 18S rRNA. Parasitprov från HBSS RBC, till exempel, visar en betydande ökning av halterna av flera mikroRNA, inklusive miR-451 (Figur 1). Upptaget av miRNA från värd erythrocyte är också i linje med tidigare studier 34,35.

Transfektion av HbAA erytrocyter med miR-451 ökade HbAA miR-451 till nivåer som liknar HBSS erytrocyter (Figur 1). Flödescytometri användes sedan för att mäta parasitinfektion, för att bedöma effekten av miRNA sloka på parasittillväxt. Baserat på detta, HbAA erytrocyter transfekterade med miR-451, MIR-223 och MIR-181a tillsammans med en ssDNA oligo, undersöktes var för effekterna av mikroRNA vid parasittillväxt. Transfektion av ssDNA eller MIR-181a hade ingen effekt på parasitemi (figur 2A - D), medan transfektion med MIR-451 minskas markant parasitemi, som skulle kunna mildras endast genom sam-transfektering av en antisens-MIR-451-oligo.

Blockering av mikroRNA genom transfektion av 2'-O-Me antisens mikroRNA visade en växelverkan. HBSS erytrocyter, med naturligt högre MIR-451 nivåer, transfekterades med antisens miR-451 eller 2'-O-metyl-oligonukleotider (Figur 3). Hämning av miR-451 ökade parasit tillväxt i både HBSS erytrocyter (Figur 3C - F). Parasit procentsatser beräknades från åtminstone 3 oberoende transfektioner, då i genomsnitt och presenteras som faldig förändring i förhållande till HBSS tillväxt (Figur 3F).

Tillfångatagandet av miRNA-mRNA fusions RNA från biotin infångningsanalys

Efter transfektion av 5'-destiobiotin-miR-451 (5'Db-miR-451) och 5'Db-miR-181, enligt vad som anges i metoder 5 §, det konstaterades att den observerade miRNA sekvensen har sitt ursprung i mänsklig microRNA. QRT-PCR-analys indikerade att transfektion av 5'Db-miR-451 resulterade i anrikning av PKA-R-fusionstranskript (Figur 4).

Polysom ​​separation för att bestämma den ribosomala beläggning av P. falciparum

tält "> En typisk A 254 spår visas i figur 5A (med norra bekräftelse av rRNA innehåll i figur 5B), med fraktionen tätheten ökar från vänster till höger i diagrammet (dvs. lättare fraktioner till vänster). Den initiala A 254 är ganska hög på grund av absorbans av hemoglobin i de tidiga fraktionerna, men snabbt sjunker till baslinjen. Den första lilla toppen motsvarar den lilla ribosomala subenheten (40S), följt snabbt av den andra toppen, som är något större och motsvarar den stora ribosomala subenheten (60S). Den tredje toppen, som i allmänhet är den största för P. falciparum, motsvarar monosome toppen (80S). På grund av sin höjd, bör 80S användas som en guide för att ställa in känsligheten för UV-detektor för efterföljande körningar (steg 6.17). Dessutom, på grund av storleken på 80S topp, är det vanligt att 60S signal till oskärpa som en "skuldra" i början av monosome toppen, om både 60S och 80Ssignaler är stora.

Efter monosome topp är de toppar som motsvarar polysomer. Varje successiv topp representerar en polysom ​​fraktion representerar progressivt större antal av ribosomer (2, 3, 4, etc). Varje polysom ​​toppen är också mindre än föregående topp, minskar i höjd med 2-3 gånger med varje successiv polysom ​​nummer. Typiska körningar kommer att möjliggöra upplösning av polysomer består av 5-7 ribosomer, men upplösning på upp till en 9-mer polysom ​​har observerats i vissa körningar med en stor mängd utgångsmaterial. Högre ordningens polysomer komponera resten av spår, och kan inte lösas under dessa gradientbetingelser.

Figur 1
Figur 1: MIR-451 är förhöjda i HBSS erytrocyter Intraparasitic miR-451 nivåer, som bestäms genom realtids-PCR och normaliserad mot 18S rRNA från parasiter isolerade från den angivna.erytrocyt typer. Värdena är medelvärde ± SE.

Figur 2
Figur 2: Överuttryck av miR-451 i normal erytrocyter hämmar parasittillväxt (A - C) Representativa FACS tomter anger infektionhastigheter, som andel av total RBC, anges med m1, för de visade erytrocyt typer.. (D) Kompositinfektionhastigheter som härrör från FACS och normaliserade mot otransfekterade HbAA RBC. Värden i panelen AC är representativa FACS tomter medan D är medelvärde ± SE.

Figur 3
Figur 3:. Hämning av miR-451 i sicklecell erytrocyter höjer parasit tillväxt (A - E) Representativa FACS tomter anger infektionhastigheter, som andel av total RBC, anges med m1, för det visade erythrocyte typer. (F) Kompositinfektionhastigheter som härrör från FACS och plottade som ett normaliserat värde mot otransfekterade HbAA RBC. Värden i panelen AE är representativa FACS tomter, är F medelvärde ± SE.

Figur 4
Figur 4: Transfektion av miR-451 berikar för PKA-R-fusionstranskript och visar att smält miRNA är erytrocytiska ursprung Anrikning av de angivna destiobiotin-konjugerad miRNA-mRNA fusionstranskript som har fångats av streptavidin.. Värden mättes med hjälp av realtids-PCR och avsattes som ett relativt värde jämfört med icke-transfekterade parasiter. Värdena är medelvärde ± SE.

Figur 5
Figur 5:. Parasit ribosomer kan isoleras via sackarosgradient (A - B) Example spår av en polysom ​​profil utvinns ur Plasmodium falciparum. (A) Spår av en polysom ​​profil utvinns ur Plasmodium falciparum, med 40S, 60S, 80S och polysom ​​toppar (med # s anger antalet ribosomer förknippade) visas. (B) Northern blöt av 18S och 28S rRNA över ribosomala fraktionerna. Värdena är medelvärde ± SE.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

HbS är en av de vanligaste hemoglobin varianter i malaria endemiska områden, till stor del därför att det ger skydd mot svår malaria orsakad av P. falciparum. Teknikerna som behövs för att karaktärisera betydelsen av mänskliga mikroRNA i genreglering hos P. falciparum beskrivs hela detta manuskript. Genom extraktion av totalt RNA på ett sådant sätt att omfatta alla små RNA, och genom att utföra en relativt enkel parasit lys förfarande, dessa fusions RNA kunde identifieras genom en mängd oberoende tekniker.

Dessa steg är relativt enkelt, men är känsliga för problem och förorening, om inte följs på rätt sätt. Under parasitens extraktion, är det viktigt att utföra saponin lys för att avlägsna kontaminerande värd erytrocyter. Detta gäller i synnerhet under saponin lys steget i RNA-isolering. Mirna komponenten i värd röda blodkroppar är flera tiopotenser greater än av parasiten, delvis på grund flesta röda blodkroppar är oinfekterade, så det är viktigt att ta bort så mycket erytrocytiska förorening som möjligt. Det är också viktigt att upprätthålla malaria kultur i en sund och riktig scen (om det krävs en viss punkt i infektionscykeln) att få en korrekt miRNA profil. På samma sätt, under fenol-kloroformextraktion, är det mycket viktigt att se till att vattenfaserna är tydliga och, om inte, upprepa fenol-kloroformextraktion för att undvika eventuella kvarvarande kontaminering.

Även i destiobiotin fånga experimentet är det viktigt att eluera med ett överskott av biotin och att använda ett minimum av streptavidinpärloma, så att korrekt specifik eluering. Elueringen av bundna RNA genom konkurrens med biotin, snarare än fullständig denaturering av pärlorna själva, tjänade till att dramatiskt minska bakgrunds RNA anrikning. Slutligen, var destiobiotin fånga experimentet markerat ens ett viktigt sätt att visa hur dessa miRNA fångades, men flera andra tekniker användes också i tidigare studier att visa dessa fusions RNA, såsom Northern blöts och ribonukleas skyddsanalyser 29. Sådana metoder för att använda de transfekterade mikroRNA att hämta de modifierade transkript kan ha en bredare tillämpning, såsom rening av tillhörande proteinkomplex som kan medierar transport och bearbetning av de transfekterade miRNA.

Medan olika genomet hela tillvägagångssätt har använts för att studera malaria proteom och transkriptom 22-25, finns det några metoder för att globalt undersöka translationell reglering i P. falciparum 21,26. Detta metodologiska begränsning utesluter global analys av translationell reglering i P. falciparum. En av de vanligaste experimentella metoder för att studera translationell reglering är polysom ​​profilering, som bedömer övergripande översättningal-aktivitet baserat på ribosomerna lastats på specifika mRNA av intresse. Beskrivs i detta manuskript är en optimerad polysom ​​profilering metod för användning i malariaparasiter som lyserar både infekterade erytrocyter och parasiten inom. Tidigare metoder inte återhämta sig de flesta polysomer och gjorde det verkar som om malariaparasiter inte har betydande populationer av polysomer. Användningen av en lysbuffert med en hög koncentration av kaliumacetat och magnesium gjort det möjligt att lysera både röda blodkroppar och parasiter samtidigt solubilisera membranbundna ribosomer för att medge infångning av intakta polysomer.

Detta kostnadseffektiv metod för ribosomal rening och profilering kommer att bidra till att överbrygga klyftan i befintlig kunskap mellan malaria transkriptom och proteom och möjliggör analys av den translationella delstaten P. genomet hela falciparum. Denna metod har använts för att jämföra översättningen tillståndet i tidigt och sent stadium BLood skede parasiter 28, som är tätt har samordnat genuttryck. Data på den ribosomala lastning av transkript kan lätt erhållas och analyseras för att bestämma densiteten av ribosomer på specifika mRNA. Dessutom, när kombinerat med sorbitol synkronisering, förändringar i ribosomala densitet kan användas för att fastställa hur översättning regleras hela parasiten livscykel. Isolering av ribosomer som använder denna metod kräver en stor mängd av kultur, som tyvärr begränsar de olika stadierna i malarialivscykeln i vilket den kan utföras. Den stora mängden insatsmaterial kommer också att begränsa dess användning både in vitro laboratorie stammar av Plasmodium falciparum, och kan begränsa dess användbarhet till andra smittsamma organismer. Alla som använder detta förfarande kommer också att kunna screena för gener som visar ovanliga översättningsprofiler, i synnerhet transkript som inte är associerade med ribosomer, vilket återspeglar alternativa former av genreglering. Slutligen,detta tillvägagångssätt gör det möjligt för oss att utvärdera hur nya malariamedel påverkar protein översättning och för att identifiera översättningsbaserade mekanismer för läkemedelsresistens. Denna rörledning har stor användbarhet i att identifiera och bestämma den post-transkriptionell reglering i många experimentella system.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
REAGENTS-All reagents must be RNAse-free.
Diethyl pyrocarbonate Sigma D5758 DEPC
DEPC-treated water (see REAGENT SETUP)
Yoyo-1 DNA fluorescent dye Thermo Fisher
Gene Pulser II electroporator Bio-Rad
0.2 cm Electroporation cuvettes
4 M potassium acetate Mallinckrodt 6700
2 M potassium HEPES Sigma H0527 pH 7.2
1 M magnesium acetate Sigma M-2545
1 M dithiothreitol Research Products International D11000 DTT
100 mM phenylmethylsulfonate fluoride Sigma P7626 PMSF, dissolved in isopropanol
10% (v/v) Igepal CA-630 Sigma-Aldrich I3021
10% (w/v) sodium deoxycholate Sigma D-6750 DOC
Cycloheximide Sigma C-7698 CHX
Sucrose Mallinckrodt 8360-04
RNAseOUT (Invitrogen, cat. no. 100000840) Invitrogen 100000840
RPMI-1640 w/ L-glutamine Cellgro 10-040-CV
10% AlbuMAX I Invitrogen 11020-039 w/v in sterile water
Gentamicin Gibco 15750-060
HT supplement (100x) (Invitrogen, cat. no. 11067030)
45% (w/v) sucrose (Sigma, cat no. G8769)
1 M HEPES buffer (Gibco, cat. no. 15630-080)
1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)
Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)
Glass slides (VWR, cat. no. 48311-702)
Giemsa stain (50X) (VWR, cat no. m708-01)
mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).
5' Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)
Biotin powder (Sigma-Aldrich)
1 M Potassium Chloride
Streptavidin Sepharose High Performance Beads (GE Healthcare)
Ribosome resuspension buffer (see REAGENT SETUP)
Lysis buffer (see REAGENT SETUP)
15% (w/v) sucrose gradient solution (see REAGENT SETUP)
50% (w/v) sucrose gradient solution (see REAGENT SETUP)
0.5 M sucrose cushion (see REAGENT SETUP)
60% (w/v) sucrose chase solution (see REAGENT SETUP)
Plasmodium cell culture media (see REAGENT SETUP)
RNA capture Wash Buffer (see REAGENT SETUP)
RNA Elution Buffer (see REAGENT SETUP)
REAGENT SETUP
Solutions
Plasmodium cell culture media
500 ml RPMI-1640 w/ L-glutamine
0.5 ml gentamicin
5 ml HT supplement
2.5 ml 45% glucose
25 ml 10% AlbuMAX I
12.5 ml 1 M HEPES
Sterile filter with 0.2 mm vacuum filter flask.
Plasmodium cell culture media containing 10x CHX
Same recipe as Plasmodium cell culture media above, with the addition of:
2 mM cycloheximide
Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter. 
1x PBS containing cycloheximide
Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.
Ribosome resuspension buffer
400 mM potassium acetate
25 mM potassium HEPES, pH 7.2
15 mM magnesium acetate
200 mM cycloheximide (add fresh)
1 mM DTT (add fresh)
1 mM PMSF (add fresh)
40 U/ml RNaseOUT (add fresh)
Lysis buffer
Same recipe as ribosome resuspension buffer above, with the addition of:
1% (v/v) Igepal CA-630
0.5% (w/v) DOC
Sucrose solutions
Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:
15% (w/v) sucrose to make 15% sucrose gradient solution
50% (w/v) sucrose to make 50% sucrose gradient solution
0.5 M sucrose to make 0.5 M sucrose cushion
As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.
The 60% sucrose chase solution requires only sucrose and water, no other components
60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution
RNA Capture Wash Buffer
20 mM  KCl
5 unit/ml Rnase Out (Invitrogen)
RNA Capture Elution Buffer
Same recipe as RNA Capture Wash Buffer, with the addition of:
2 mM Biotin
EQUIPMENT
SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)
SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)
Ultra-ClearTM ½ x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)
Polyallomer 9/16 x 3 ½ in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)
L8-80M ultracentrifuge (Beckman)
Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)
1 ml syringe with 27 G½ needle (Becton Dickinson, cat no. 309623)
5 ml syringe (Becton Dickinson, cat. no. 309646)
Parafilm
Tube rotator, end-over-end
Microcentrifuge, refrigerated
Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)
TracerDAQ (Measurement Computing)
Eppendorf 5810R centrifuge
Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)

DOWNLOAD MATERIALS LIST

References

  1. World Health Organization. World Malaria Report. (2014).
  2. Livincstone, F. B. Malaria and human polymorphisms. Annu Rev Genet. 5, 33-64 (1971).
  3. Nagel, R. L., Roth, E. F. Malaria and red cell genetic defects. Blood. 74, 1213-1221 (1989).
  4. Aidoo, M., et al. Protective effects of the sickle cell gene against malaria morbidity and mortality. Lancet. 359, 1311-1312 (2002).
  5. Tiffert, T., et al. The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum. Blood. 105, 4853-4860 (2005).
  6. Fairhurst, R. M., et al. Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 435, 1117-1121 (2005).
  7. Cyrklaff, M., et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 334, 1283-1286 (2011).
  8. Friedman, M. J. Erythrocytic mechanism of sickle cell resistance to malaria. Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).
  9. Pasvol, G., Weatherall, D. J., Wilson, R. J. Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria. Nature. 274, 701-703 (1978).
  10. Lecellier, C. H., et al. A cellular microRNA mediates antiviral defense in human cells. Science. 308, 557-560 (2005).
  11. Niu, Q. W., et al. Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nature biotechnology. 24, 1420-1428 (2006).
  12. Zhao, G., Yu, D., Weiss, M. J. MicroRNAs in erythropoiesis. Curr Opin Hematol. 17, 155-162 (2010).
  13. Lee, Y. T., et al. LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo. Blood. 122, 1034-1041 (2013).
  14. Sangokoya, C., Doss, J. F., Chi, J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS genetics. 9, e1003408 (2013).
  15. Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS ONE. 3, e2360 (2008).
  16. Sangokoya, C., Telen, M. J., Chi, J. T. microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116, 4338-4348 (2010).
  17. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic acids research. 29, 850-853 (2001).
  18. Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryotic cell. 2, 830-840 (2003).
  19. Baum, J., et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic acids research. 37, 3788-3798 (2009).
  20. Hall, N., et al. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. 307, 82-86 (2005).
  21. Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. Genome-wide regulatory dynamics of translation in the asexual blood stages. eLife. 3, (2014).
  22. Oehring, S. C., et al. Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum. Genome biology. 13, R108 (2012).
  23. Lasonder, E., et al. Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry. Nature. 419, 537-542 (2002).
  24. Bozdech, Z., et al. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS biology. 1, E5 (2003).
  25. Gardner, M. J., et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 419, 498-511 (2002).
  26. Zhang, M., Joyce, B. R., Sullivan, W. J. Jr., Nussenzweig, V. Translational control in Plasmodium and toxoplasma parasites. Eukaryotic cell. 12, 161-167 (2013).
  27. Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. Polysome profiling of the malaria parasite Plasmodium falciparum. Molecular and biochemical parasitology. 179, 42-62 (2011).
  28. Bunnik, E. M., et al. Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum. Genome biology. 14, R128 (2013).
  29. LaMonte, G., et al. Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance. Cell host & microbe. 12, 187-199 (2012).
  30. Lambros, C., Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. The Journal of parasitology. 65, 418-420 (1979).
  31. Bourgeois, N., et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).
  32. Abruzzo, L. V., et al. Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data. Biotechniques. 38, 785-792 (2005).
  33. Sangokoya, C., LaMonte, G., Chi, J. T. Isolation and characterization of microRNAs of human mature erythrocytes. Methods in molecular biology. 667, 193-203 (2010).
  34. Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. Analysis of short RNAs in the malaria parasite and its red blood cell host. FEBS Lett. 580, 5185-5188 (2006).
  35. Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection. Malar J. 7, 47 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics