Métodos para investigar el papel de Regulación de pequeños ARN ribosomal y ocupación de * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

LaMonte, G., Walzer, K. A., Lacsina, J., Nicchitta, C., Chi, J. T. Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum. J. Vis. Exp. (106), e53214, doi:10.3791/53214 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La variación genética responsable para el alelo de células falciformes (HbS) permite a los eritrocitos para resistir la infección por el parásito de la malaria, P. falciparum. La base molecular de esta resistencia, que se sabe que es multifactorial, sigue siendo incompleta entendido. Estudios recientes han encontrado que la expresión diferencial de microRNAs de eritrocitos, una vez trasladadas en parásitos de la malaria, afectan tanto a la regulación de genes y el crecimiento del parásito. Estos miRNAs se muestran más adelante para inhibir la traducción del ARNm mediante la formación de un transcrito de ARN quimérico a través de 5 'de fusión de ARN con subconjuntos discretos de mRNAs de parásitos. Aquí, las técnicas que se utilizaron para estudiar el papel funcional y la posible existencia de mecanismo microRNAs eritrocitos subyacentes en la regulación de genes y el potencial de la traducción de P. falciparum, incluyendo la transfección de microRNAs sintéticos modificados en los eritrocitos de acogida, se detallará. Finalmente, un método de gradiente de polisomas se utiliza para determinar la extensión de translation de estas transcripciones. En conjunto, estas técnicas nos han permitido demostrar que los niveles de microARN dysregulated eritrocitos contribuyen a la resistencia a la malaria de células intrínseca de los eritrocitos falciformes.

Introduction

La malaria, causada por parásitos apicomplexan del género Plasmodium, es la enfermedad parasitaria humana más común, infectando a nivel mundial unos 200 millones de personas cada año y causa alrededor de 600.000 muertes 1. De las cinco especies de Plasmodium que infectan a los seres humanos, los más relevantes para las enfermedades humanas son P. falciparum y P. vivax, debido a sus distribuciones generalizadas y el potencial de complicaciones graves de malaria. El ciclo de vida del parásito de la malaria requiere la infección de ambos mosquitos y seres humanos. Cuando un mosquito infectado pica a un humano, los parásitos viajan a través del torrente sanguíneo hasta el hígado, donde se produce una ronda inicial de la replicación. Después de merozoitos ruptura del hepatocito anfitrión, que infectan los glóbulos rojos cercanos, iniciando la replicación sea asexual o sexual. La etapa asexual de replicación, que tiene una duración de 48 horas en P. falciparum, es el foco de este estudio, ya que es a la vez la fuente de la mayoría malsíntomas aria y se recapitulan fácilmente in vitro.

Si bien una serie de iniciativas de salud pública, incluyendo la mejora de los tratamientos contra la malaria, han reducido un poco la carga de la malaria a nivel mundial, la continua aparición de parásitos resistentes a los fármacos presenta un problema para los esfuerzos de control de la malaria. Una de las áreas que pueden sugerir nuevos enfoques terapéuticos es el estudio de cómo las diversas variantes genéticas confieren resistencia a la malaria. En las regiones donde la malaria es endémica, una variedad de polimorfismos eritrocitarios son bastante comunes 2,3. Estas mutaciones, con células falciformes siendo quizás el más destacado, a menudo se asocian con la resistencia sustancial a la aparición de la infección de la malaria sintomática 4. Los mecanismos subyacentes por los que causan los eritrocitos para resistir la infección por malaria se conocen por completo. Eritrocitos parasitados con mutaciones de hemoglobina están sujetos a una mayor fagocitosis través rigidez celular mejorada y deshidratación, queestá asociada con la invasión disminuido en P. falciparum 5. El alelo HbC también afecta a la expresión de proteínas en la superficie de los eritrocitos y con la remodelación del citoesqueleto, inhibiendo aún más el desarrollo del parásito 6,7. Por último, P. falciparum crece mal dentro falciformes homocigóticos (HBSS) eritrocitos 8,9 in vitro, lo que sugiere factores eritrocitarios intrínsecas de resistencia a la malaria. Sin embargo, aunque todos estos mecanismos parecen jugar un papel, no explican plenamente los mecanismos detrás de la resistencia de células falciformes a la malaria.

Un conjunto potencial de los factores eritrocitarios que permanecen poco conocida es la gran reserva de miARN presentes dentro de los eritrocitos maduros. Los microARNs son pequeños RNAs no codificantes, 19-25 de nt en tamaño, que median la traducción y / o estabilidad del ARNm diana por emparejamiento de bases dentro de la 3 'UTR. Ellos han sido implicados en el control de la respuesta inmune de mamíferos, incluyendo el o supresiónla replicación del virus f 10, y fueron demostrado que confieren resistencia a virus en plantas Ellos también se han demostrado que regulan varios procesos eritrocitarios, incluyendo la eritropoyesis 11,12 y metabolismo del hierro 13. Estudios previos identificaron una población abundante y diversa de miRNAs eritrocítica, cuya expresión se alteró dramáticamente en HbSS eritrocitos 14,15. Puesto que los eritrocitos maduros carecen de la transcripción y la traducción activa, el papel funcional de estos miRNAs eritrocitos sigue siendo poco clara. Como se produce el intercambio de material significativa entre la célula huésped y P. falciparum durante el ciclo de desarrollo intraeritrocitaria (IDC) 16, se especuló que el perfil de miARN alterado dentro de los eritrocitos HbS puede contribuir directamente a la resistencia a la malaria de células intrínseca.

Estos estudios condujeron en última instancia al desarrollo de una tubería para aislar, identificar y funcionalmente estudiar el papel de los genes miARN humano dentro de la mparásito alaria, P. falciparum, que indicaron que los anfitriones / miRNAs humanos en última instancia, de forma covalente de fusibles y luego reprimir traslación transcripciones de ARNm parásito 17. Esto proporcionó un ejemplo de las primeras especies cruzadas transcripciones quiméricos formados por trans-empalme e implica que esta fusión miARN-mRNA podría estar ocurriendo en otras especies, incluyendo otros parásitos. Todos los ARNm tripanosoma son trans-empalmados con un empalme-líder (SL) para regular la separación de polycistronic transcripciones 18. Desde P. falciparum carece ortólogos para Dicer / Ago 19,20, es posible que los miRNAs eritrocitos secuestran SL maquinaria similar en P. falciparum para integrar en los genes diana. Estudios recientes en P. falciparum tiene, de hecho, indica la presencia de secuencias líder 5 'de empalme 21. Este estudio detalla los métodos que llevaron al descubrimiento de transcripciones de fusión-humanos parásito miARN-mRNA, incluyendo tanto transcriptómica y translatécnicas de regulación cionales. Los objetivos generales de estos métodos son para investigar los efectos de los pequeños RNAs en la regulación de genes, fenotipos y traducción potencial de P. transcripciones falciparum.

La identificación inicial de los transcritos quiméricos humanos parásito se basó en el uso de técnicas de análisis de ARN, tales como PCR en tiempo real, la secuenciación del transcriptoma y EST captura de biblioteca, que incluía tanto totales y pequeños RNAs, en lugar de utilizar técnicas que sólo aislados pequeños RNAs. Aislamiento de RNA todos juntos en una piscina grande, en lugar de por separado, permitió la identificación de ambos translocados pequeños RNAs humanos en el parásito, así como la presencia de estas pequeñas secuencias de ARN como parte de una secuencia más grande. Esto entonces requiere un análisis del estado traducción de estos mRNAs de fusión para determinar las consecuencias funcionales de estas fusiones.

Mientras que los grandes esfuerzos en la caracterización de un genoma del parásitod transcriptoma han añadido a la comprensión de la biología del parásito 22-25, mucho menos se sabe acerca de la regulación de la traducción del ARNm transcriptoma en todo el ciclo de vida de P. falciparum 26. Esta comprensión limitada del proteoma del parásito ha dificultado tanto la comprensión de la biología del parásito y la capacidad de identificar nuevos objetivos para la próxima generación de terapias contra la malaria. Esta brecha en la comprensión de la biología celular del parásito ha persistido en gran parte debido a la falta de técnicas adecuadas para investigar la regulación de traducción en P. falciparum. Un artículo reciente describe el uso de la huella ribosomal de P. falciparum para determinar el estado de la traducción mundial 21. Una medida bien establecida de potencial de traslación de las transcripciones es el número de ribosomas asociados determinados por polisomas perfilado. Sin embargo, cuando se aplica esta técnica para P. falciparum </ em>, no es capaz de recuperar la mayoría de los polisomas y captura predominantemente monosomas. Recientemente, varios grupos han optimizado 27,28 P. técnicas polysome falciparum por lisis de los eritrocitos y parásitos simultáneamente para preservar los polisomas y caracterizar la ocupación ribosomal y el potencial de la traducción de estos parásitos de la malaria durante su desarrollo asexual en las células rojas de acogida 28.

Colectivamente, estos métodos demuestran que la fusión observado de mRNAs miARN y parásitos humanos modula la traducción de proteínas del parásito de esos mRNAs de fusión, que se demostró utilizando métodos reportados previamente 27, y es un importante factor determinante de la resistencia a la malaria en HbAS y HbSS eritrocitos 17. Estos métodos podrían ser útiles en cualquier sistema en busca de identificar y funcionalmente explorar eventos de empalme de ARN, ya se trate de los ARN de fusión están a P. falciparum u otros sistemas eucariotas.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1: Aislamiento de ARN de pequeño tamaño de P. falciparum Durante la IDC

  1. Obtener parásitos de la malaria en la cultura asexual 29.
    NOTA: El tamaño de la cultura requerida variará en función de la aplicación deseada; sin embargo, un cultivo de 10 ml a 3-5% de parasitemia y 5% de hematocrito proporciona un amplio ARN para PCR en tiempo real (RT-PCR). La técnica se optimizó inicialmente para cultivos asíncronos, pero cuando se desean puntos temporales específicos durante el ciclo de infección, los parásitos de anillo etapa se puede sincronizar mediante la sincronización de sorbitol no más tarde de 10 a 12 horas después de la invasión. La sincronización debe repetirse después de un ciclo (aproximadamente 48 horas) 29.
  2. Células infectadas piscina juntos (~ 5 x 10 9 RBCs a 3-5% de parasitemia) y llenar PBS frío a la parte superior del tubo y centrifugar a 800 xg durante 5 min sin freno para sedimentar las células rojas.
  3. Después de la centrifugación, eliminar el sobrenadante cuidadosamente con una pipeta de aspiración, que se adjuntaa un vacío, ya que el pellet eritrocítica es fácil de desprender. Lavar el pellet una vez más con 1x PBS frío.
  4. Resuspender pellet celular en frío 0,15% de saponina (en 1X PBS) y el lugar en hielo durante 30 min.
  5. Las células se centrifuga a 1500 xg durante 12 min a 4 ° C, eliminar el sobrenadante (que será de color rojo oscuro) y el pellet se resuspende en PBS frío. Repita este paso una vez más.
    NOTA: Con el fin de garantizar que los microRNAs presentes eran reflejo de microRNAs dentro de los parásitos, y no contaminación eritrocítica, una serie de condiciones de aislamiento de parásitos fueron probados: 1) lisis de saponina, 2) la lisis de saponina combinada con el tratamiento RNaseA de miRNAs célula huésped y 3 ) metil-beta-ciclodextrina tratamiento para eliminar el parásito de la acogida eritrocitos. Todos los tratamientos dieron resultados similares.
  6. Lyse la aislada pellet parásito utilizando los recomendados 600 l de tampón de lisis. Este volumen de tampón de lisis es suficiente para cultivos hasta ~ 30 ml a 2% de hematocrito y 5% de parasitemia.
    NOTA: Para los cultivos de parásitos más grandes, este volumen puede ser aumentada. Es importante para asegurar la lisis completa de la pastilla parásito por agitación a fondo durante al menos 1 min. Además, para facilitar la extracción, las muestras lisadas se pueden transferir a un tubo de microcentrífuga de 1,7 ml.
  7. Añadir 60 l, o 1/10 de volumen de tampón de lisis utilizado en el paso 6, de aditivo homogeneizado (acetato de sodio 2 M, pH 4).
  8. Deja muestras en hielo durante 10 min.
  9. Añadir 600 l, o un volumen igual a la cantidad de tampón de lisis añadido en el paso 6, de ácido fenol cloroformo a cada muestra y agitar durante 1 min.
  10. Se separan las fases acuosa y orgánica por centrifugación de las muestras a 10.000 xg durante 5 min. Este giro es más largo que el sugerido por el kit para garantizar que toda la hemoglobina / hemozoin está en la fase orgánica.
  11. Recoger el (acuosa) de la capa superior y la transfiere a un tubo nuevo. Repita los pasos 9 y 10 si la fase acuosa es de color blanco o (más probable) de color marrón, lo que sugiere procontaminación de proteína.
  12. Determinar el volumen del sobrenadante resultante mediante una pipeta y luego añadir 1,25 volúmenes de etanol 100% (~ 800 l) y mezclar invirtiendo el tubo de microcentrífuga de 1,7 ml 5 veces.
  13. Pase cada muestra a través de un cartucho de filtro de unión al ARN proporcionado (varios diferente de los cuales son comercialmente disponible) ya sea por centrifugación a 14.000 xg durante 1 min o mediante el uso de un colector de vacío.
  14. Lavar el cartucho de filtro con 700 l de la miRNA Wash Buffer 1 utilizando una microcentrífuga, girando a 14.000 xg durante 1 min.
  15. Lavar el cartucho de filtro con 500 l de tampón de lavado 3/2 dos veces por centrifugación a 14.000 xg durante 1 minuto cada uno.
  16. Eluir ARN con 100 l de agua DEPC, que ha sido precalentado a 95 ºC, en dos lavados de 50 l, centrifugando a 14.000 xg durante 1 min cada uno. Medir la concentración de ARN mediante la absorbancia UV a 260 nm.
    NOTA: Un gel de ARN (ya sea TBE-urea acrilamida o desnaturalización en gel de agarosa formaldehído) pueden be utilizó para evaluar la distribución de tamaños de los ARN aislados.
    NOTA: Este ARN es adecuado para el análisis de microarrays, ARN-secuencia, el norte de mancha y el ensayo de protección de ribonucleasa.

2: La cuantificación de ARN de pequeño tamaño de P. falciparum Durante la IDC

  1. Determinar la concentración de las muestras individuales aisladas en el paso 1 mediante espectrofotometría UV a 260 nm.
  2. Generar cebadores de PCR en tiempo real para las especies de ARN deseadas. Para miARN solos, hemos utilizado ensayos miARN qPCR prefabricados, mientras que para los ARNm o fusión de los genes miARN-mRNA hemos diseñado cebadores para la SYBR verde. Para los ARN de fusión, el cebador directo fue la secuencia de los genes miARN en sí (miR-451: AAACCGTTACCATTACTGAGTT), mientras que lo contrario era un cebador de ~ 100 pb específico de gen aguas abajo de los genes miARN en la secuencia de ARNm (PKA-R: ATCGAACATGCTGTGAACAT).
  3. Hacer ADNc a partir de las muestras de ARN utilizando un cebador de horquilla de miRNAs (utilizar 20-40 ng de ARN) sola o hexámeros aleatorios para ARNm y / o miRNAespecie de fusión-mRNA (utilizando 1 g de ARN). Mezclar ARN y cebadores durante 5 min a 65 ° C, después se enfría a temperatura ambiente. Después, agregue la mezcla de la transcriptasa inversa (0,5 l transcriptasa inversa, 0,5 l inhibidor de RNasa, 1 mu l dNTPs (2,5 mM cada uno), 4 l 5x tampón, 2 l 0,1 M de TDT, 1 l H2O).
    1. Las muestras se ejecutan en un termociclador capaz de detectar cualquiera de SYBR verde o sondas TaqMan. SYBR verde PCR cuantitativa 30 para genes específicos se ejecuta como un 3-etapa de PCR, 95 ° C durante 15 seg, más baja temperatura de hibridación del cebador menos 5 ° C durante 30 seg, y 68 ° C durante 30 segundos, durante 40 ciclos, utilizando una SYBR comercial mezcla maestra verde. miRNA-PCR en tiempo real se ejecuta como una PCR de dos etapas, 95 ° C durante 15 seg y 60 ° C durante 1 min, durante 40 ciclos.
    2. Cuantificar ensayos utilizando el método ΔΔCt y normalizarlos en contra de cualquiera de Rab GTPasa (PF08_0110) o 18S rRNA 31.

3: Introducciónde los pequeños RNAs en malaria parásitos

  1. Pellet 300 l de glóbulos rojos por transfección (250 l de glóbulos rojos, aproximadamente 1,5 x 10 9 células, se utilizará en última instancia) en medio completo malaria por centrifugación a 800 xg durante 5 min a 1 de freno.
  2. Lavar los eritrocitos dos veces con RPMI y resuspender en Cytomix completa (120 mM KCl; 0,15 mM CaCl 2; 10 mM K 2 HPO 4 / KH 2 PO 4, pH 7,6; 25 mM HEPES, pH 7,6; 2 mM EGTA, pH 7,6; 5 mM de MgCl 2; pH ajustado con KOH) al 50% de hematocrito después de la centrifugación a 800 xg durante 5 min a 1 de freno.
  3. Transferir las células a una cubeta de electroporación de 0,2 cm.
  4. Añadir 10 g, o apropiadas cantidad, de oligonucleótidos sintéticos personalizada a las cubetas y resuspender las culturas.
  5. Ajuste el electroporador a 310 V / 950 mF y entregar un pulso a cada cubeta.
  6. Resuspender los 300 l de glóbulos rojos dentro de la cubeta en pre-calentado mal completamedios aria y placa en placas de 24 pocillos y se incuba a 37 ° C en un recipiente hermético con la mezcla de gases en sangre malaria (3% O 2, 5% de CO 2).
  7. Después de 4 h, infectar a los glóbulos rojos transfectadas con trofozoítos finales sincronizados a una parasitemia final aproximada de 1%.
  8. Añadir glóbulos rojos recién transfectadas cada 4-6 días para los cultivos infectados y determinar el% de parasitemia por FACS utilizando YoYo-1 tinción, como se indica en la sección 4.

4: Determinación de eritrocitos Efecto microRNAs Al Parásito Infección Rate

  1. Tomar 100 l de la cultura resuspendido por micropipeta y colocar en un tubo de 1,7 ml de microcentrífuga. Lavar dos veces con 1 ml de PBS 1x y se centrifuga en una microcentrífuga de mesa por centrifugación a 800 xg durante 5 min.
  2. Resuspender pellet en 1 ml de 0,025% de glutaraldehído. Incubar las muestras durante 20 min a RT.
    NOTA: Las muestras se pueden almacenar aquí por varias semanas a 4 ° C. Después, sedimentar los infectados RBC por centrifugación a 800 xg durante 5 min. Lavar dos veces con 1 ml de PBS 1x.
  3. Resuspender pellet en 1 ml de 0,015% de saponina. Se incuba a 4 ° C durante 15 min. Pellet infectado glóbulos rojos mediante centrifugación a 800 xg durante 5 min. Lavar dos veces con 1 ml de PBS 1x. Repeat.4.3. Resuspender las células en 1 ml de 1x PBS que contenía 1 l (1.000X) tinción de ADN.
  4. Determinar los grados de parasitemia en un citómetro de flujo, a 488 nm de excitación y 530 nM ~ (FL-1) de emisión.
  5. En primer lugar, la puerta del citómetro de flujo basado en el FSC y SSC para centrarse en los glóbulos rojos. A continuación, medir el grado de parasitemia (GR infectados) en el RBC cerrada por fluorescencia en el canal FL-1.
    NOTA: después parásitos etapa son 10 veces más fluorescente de parásitos en etapas iniciales, y ~ 100X anterior glóbulos rojos no infectados. Además, la recogida a baja velocidad tiende a reducir el ruido. Finalmente, este enfoque ha sido comparado con el 3-H hipoxantina incorporación y tinción Giemsa, tanto como se informó anteriormente 13, y todas las técnicas de gave resultados similares.

5: La biotina-etiquetado y elución de miARN-mRNA Fusion Productos

  1. Directamente ordenar oligonucleótidos sintéticos de encargo de ARN con destiobiotina (DB) unidos covalentemente al extremo 5 '.
  2. Transfectar glóbulos rojos infectados con conjugado-destiobiotina (Db-) miARN y miARN no modificada (control negativo), tal como se indica en el paso 3.
  3. Infectar los glóbulos rojos transfectadas con P. falciparum parásitos a una parasitemia de partida de 0,5% (paso 1.1).
  4. Extracto de ARN parásito 4 días (96 horas) más tarde como se describe anteriormente en el paso 1.
  5. Incubar 10 g de ARN parásito con 50 l envasados ​​perlas de estreptavidina, añadido a través de micropipeta, y girar en un rotador tubo de microcentrífuga durante 1 hora a 4 ° C.
  6. Sedimentar las perlas a 800 xg durante 30 seg y se lava con 20 mM KCl y 1 / 1.000 inhibidor de RNasa.
  7. Eluir RNAs de las perlas por la competencia con biotina 2 mM y 200 con tampón de elución de captura de RNA l (20 mM de KCl, 1/1, 000 Inhibidor de RNasa y 2 mM biotina) en 4 ° C durante la noche con rotación.
  8. Determinar el grado de enriquecimiento del indicado P. transcripciones falciparum utilizando SYBR verde QRT-PCR, y el enriquecimiento de microARN (control positivo) por TaqMan qPCR como se indica en el paso 2.

6: Separación polisomas para determinar el Ribosomal ocupación de P. falciparum

  1. Coloque solución de sacarosa al 5 ml de 15% (mM de acetato 400 de potasio, HEPES de potasio 25 mM, pH 7,2, acetato de magnesio 15 mM, 200 mM cicloheximida, 1 mM de DTT, 1 mM PMSF, inhibidor de RNasa 40 U / ml, y 15% de sacarosa ) en un tubo de ultracentrífuga SW41 (14 x 89 mm).
  2. Usando una jeringa de 5 ml, añadir solución de sacarosa al 5 ml de 50% (mM de acetato 400 de potasio, HEPES de potasio 25 mM, pH 7,2, acetato de magnesio 15 mM, 200 mM cicloheximida, 1 mM de DTT, 1 mM PMSF, 40 U / ml de RNasa inhibidor, y el 50% de sacarosa) por debajo de la sacarosa 15% utilizando una aguja de acero largo, a continuación, retire la aguja.
  3. Después de 2 horas, lentamente incline el tubo de nuevo en posición vertical y transferir el tubo en hielo, lo que permite que se enfríe durante al menos 15 minutos antes de la carga de la muestra (paso 14).
  4. Reunir suficiente sangre infectado con Plasmodium cultura etapa para generar 100 a 500 g de ARN total, o aproximadamente un 100 ml cultura asíncrona al 3-5% de parasitemia. Añadir 1/10 que el volumen de medio de cultivo que contiene 10x (2 mM) cicloheximida (CHX) y se incuba a 37 ° C durante 10 min.
    1. Culturas precipitado mediante centrifugación a 500 xg durante 7 minutos con la centrífuga (freno 1), a continuación, se lavan dos veces con PBS 1x temperatura ambiente que contiene 200 mM CHX. Resuspender las culturas del parásito en 1x PBS que contenía 200 mM CHX y almacenar en hielo.
    Estimar el volumen del sedimento de RBC. Añadir tampón de lisis (mM acetato de potasio 400, HEPES de potasio 25 mM, pH 7,2, acetato de magnesio 15 mM, 200 CHX mu M, 1 mM de DTT, 1 mM PMSF, 40 U / inhibidor de RNasa ml, 1% (v / v) IGEPAL CA -630, y 0,5% (w / v) DOC) al sedimento de RBC a un volumen final de 4,25 ml. Incubar el lisado a 4 ° C durante 10 min mientras se gira.
  5. Transferir el lisado a tubos de microcentrífuga, y centrifugar las muestras en una microcentrífuga a 16.000 xg y 4 ° C durante 10 min.
  6. Preparar cojines de sacarosa pipeteando 1,25 ml de la solución de colchón de sacarosa fría 0,5 M (mM de acetato 400 de potasio, HEPES de potasio 25 mM, pH 7,2, acetato de magnesio 15 mM, 200 mM cicloheximida, 1 mM de DTT, 1 mM PMSF, 40 U / ml de RNasa inhibidor, y 0,5 M de sacarosa) en un tubo de ultracentrífuga SW55 (13 x 51 mm).
  7. La capa cuidadosamente 3,75 ml de sobrenadante de lisado (del paso 7) en la parte superior del colchón de sacarosa utilizando una jeringa y pequeño (~ 27) aguja de calibre. Store lisado restante (~ 500 l) a -80 ° C para extraer los niveles de ARN total, como se indica en el apartado 1.
  8. Cargar las muestras en un rotor de ultracentrífuga, pre-refrigerada a 4 ° C, que puede contener 13,2 ml tubos. Centrifugar las muestras a 366.000 xg y 4 ° C durante 146 min.
  9. Con una pipeta, transferir el sobrenadante a un tubo cónico de 15 ml. Almacenar el sobrenadante a -80 ° C para el aislamiento de ARN de libres (no unida por los ribosomas) ARN.
  10. Resuspender el precipitado ribosoma en 500 l de tampón de resuspensión ribosoma (mM de acetato 400 de potasio, HEPES de potasio 25 mM, pH 7,2, acetato de magnesio 15 mM, 200 mM cicloheximida, 1 mM de DTT, 1 mM PMSF, y 40 U / inhibidor de RNasa ml) pipeteando durante 5 min.
  11. Centrifugar las muestras en una microcentrífuga a 16.000 xg y 4   ° C durante 10 min.
  12. Mientras se mantiene el gradiente desde el paso # 4 en el hielo, retire el Parafilm, a continuación, la capa cuidadosamente la suspensión ribosoma en la parte superior de la usi gradienteng una jeringa y pequeñas (~ 27) aguja de calibre.
  13. Cargar el tubo en un rotor de ultracentrífuga pre-enfriada y centrifugar los gradientes a 200.000 xg cargados y 4 ° C durante 180 min. Cuando se completa el giro, almacenar centrifugó a 4 gradientes ° C hasta que esté listo para cargar en el fraccionador.
  14. Carga de un tubo de ultracentrífuga desembocan en el fraccionador gradiente (esto puede ser un tubo utilizado en una carrera anterior), luego lave con RNasa libre de agua durante 5 minutos a 100 x 10 velocidades.
  15. Durante el lavado en el paso 6.16, ajustar la sensibilidad del detector de absorbancia UV. Una buena sensibilidad de partida es 0,2, pero esto puede tener que ajustarse en adelante corre dependiendo de la señal A 254 (que varía basada en el número de parásitos, etc.).
  16. Una vez que la sensibilidad del detector se fija, ajuste la señal de referencia a cero mientras que el agua fluye a través del detector.
  17. Después de lavar el colector de fracciones, revertir el flujo de fluido hasta que las líneas están vacías y luego remove el tubo de ultracentrífuga vacía.
  18. Ejecutar solución de sacarosa al 60% a través de la columna de fraccionamiento hasta que sale del aparato de la aguja.
  19. Inserte el tubo que contiene el primer gradiente en la parte superior de la cámara de carga y apriete el sello, con cuidado de no apretar demasiado. Entonces, perforar la parte inferior del tubo con la aguja.
  20. Cambiar la velocidad de flujo de fluido a 12,5 x 10 (controlado por la perilla de control de velocidad de flujo en la parte frontal de la bomba), a continuación, establecer el colector de fracciones automático para recoger las fracciones 18 seg (~ 330 l / fracción) en tubos de microcentrífuga.
  21. Comience hacia adelante de flujo de la solución de sacarosa al 60%.
  22. Cuando la primera gota de la solución de gradiente de gotas en el tubo de microcentrífuga, comience inmediatamente tanto la recolección de fracciones y la grabación en vivo de la señal A 254.
  23. Una vez que una fuerte caída se observa en la señal A 254, correspondiente a la interfaz entre las soluciones de sacarosa 50% y 60%, tanto detener el flujo de fluido y A 254
  24. Guarde las fracciones del gradiente a -80   ° C para su uso posterior.
  25. Invertir el flujo de fluido en 100 x 10 velocidad hasta que la solución de sacarosa al 60% se vacía fuera del tubo de ultracentrífuga.
  26. Si hay gradientes adicionales para fraccionar, retire el tubo de ultracentrífuga vacío de la cámara de carga y reiniciar desde el paso 6.21. Si se han completado todas las muestras, lavar el aparato como se llevó a cabo en pasos de 6.16 y 6.19.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Perfiles Global de microARN humano en P. falciparum

Las técnicas presentadas aquí se utilizaron para extraer microRNAs de parásitos en una variedad de condiciones. Una cosa a destacar es que se realizaron extracciones de ARN para los glóbulos rojos no infectados como se indica en 32, que a menudo sirve como punto de referencia para los datos de microARN presentados tanto en este artículo y el estudio original 29. Esos estudios anteriores también demostraron que los eritrocitos HbSS poseían mucho mayores niveles de ciertas miRNAs, miR-451 en particular. Las técnicas indicadas anteriormente eran suficientes para demostrar los cambios en la abundancia de miRNA en HBS (HBA o HbSS) parásitos que infectan. Las muestras de ARN se extrajeron como se ha indicado anteriormente y se normalizaron contra el 18S rRNA. Las muestras con parásitos de HbSS glóbulos rojos, por ejemplo, no muestran un aumento significativo en los niveles de varios microARN, incluyendo el miR-451 (Figura 1). La ejecución de los miRNA del erythr anfitriónocyte también es consistente con estudios previos 34,35.

La transfección de eritrocitos HbAA con miR-451 aumentó HbAA miR-451 a niveles similares a los eritrocitos HbSS (Figura 1). La citometría de flujo se utilizó para medir la infección del parásito, con el fin de evaluar el efecto de los genes miARN translocación sobre el crecimiento del parásito. En base a eso, eritrocitos HbAA transfectadas con miR-451, miR-223 y miR-181, junto con un oligo ssDNA, se examinaron los efectos de microRNAs sobre el crecimiento del parásito. La transfección de ssDNA o miR-181 no tuvo ningún efecto sobre la parasitemia (Figura 2A - D), mientras que la transfección con miR-451 marcadamente reducida parasitemia, lo que podría ser mitigado solamente por co-transfección de un antisentido miR-451 oligo.

El bloqueo de microRNAs por transfección de microRNAs antisentido 2'-O-Me demostró un efecto recíproco. Eritrocitos HbSS, con naturalmente altos niveles de miR-451, se transfectaron con antisentido miR-451 o los oligonucleótidos 2'-O-metilo (Figura 3). La inhibición de miR-451 aumentó el crecimiento del parásito en ambos eritrocitos HbSS (Figura 3C - F). Parásito porcentajes se calcularon a partir de al menos 3 transfecciones independientes, a continuación, promediado y presentado como pliegue cambio relativo al crecimiento HbSS (Figura 3F).

Captura de RNAs de fusión miARN-mRNA por ensayo de captura de biotina

Después de la transfección de 5'-destiobiotina-miR-451 (5'Db-miR-451) y 5'Db-miR-181, como se indica en la sección de métodos 5, se determinó que la secuencia de los genes miARN observado originó con microARN humano. QRT-PCR análisis indicó que la transfección de 5'Db-miR-451 dio lugar a un enriquecimiento de las transcripciones de fusión PKA-R (Figura 4).

Separación polisomas para determinar la ocupación ribosomal de P. falciparum

tienda "> A A 254 rastro típico se muestra en la Figura 5A (con confirmación norte del contenido de rRNA en la figura 5B), con la densidad de la fracción creciente de izquierda a derecha en el gráfico (es decir, fracciones más ligeras a la izquierda). La inicial A 254 es bastante alta debido a la absorbancia por la hemoglobina en las primeras fracciones, pero rápidamente cae a la línea de base. La primera pequeño pico corresponde a la subunidad pequeña ribosomal (40S), seguido rápidamente por el segundo pico, que es ligeramente más grande y corresponde a la gran subunidad ribosomal (60S). El tercer pico, que es generalmente la más grande para P. falciparum, corresponde al pico monosome (80S). Debido a su altura, los 80S debe utilizarse como una guía para ajustar la sensibilidad del detector de UV para tiradas posteriores (paso 6,17). También, debido al tamaño del pico 80S, es común que los 60S señal a desdibujarse como un "hombro" en el inicio del pico monosome, si ambos los 60S y 80Slas señales son grandes.

Tras el pico monosome son los picos correspondientes a los polisomas. Cada pico sucesiva representa una fracción polisomas representar números cada vez más grandes de los ribosomas (2, 3, 4, etc.). Cada pico polisoma es también menor que el máximo anterior, disminuyendo en altura por 2.3 veces con cada número polisoma sucesiva. Carreras típicos permitirán la resolución de polisomas compuestas de 5-7 ribosomas, aunque resolución de hasta un polisomas 9-mer se ha observado en algunas carreras con una gran cantidad de material de partida. Polisomas de orden superior componen el resto de la traza, y no se pueden resolver bajo estas condiciones de gradiente.

Figura 1
Figura 1: miR-451 se encuentra elevado en los eritrocitos HbSS Intraparasitic miR-451 niveles, según lo determinado por PCR en tiempo real y se normalizó contra 18S rRNA, a partir de parásitos aislados de la indicada.tipos de eritrocitos. Los valores son medias ± SE.

Figura 2
Figura 2: La sobreexpresión de miR-451 en los eritrocitos normales inhibe el crecimiento del parásito (A - C) parcelas FACS representativos que indican las tasas de infección, como un porcentaje del total de glóbulos rojos, se indican con m1, para los tipos de eritrocitos que se muestran.. (D) las tasas de infección compuestos derivados de FACS y normalizado contra untransfected HbAA glóbulos rojos. Los valores en la CA del panel son FACS representativos parcelas, mientras que D es la media ± SE.

Figura 3
Figura 3:. La inhibición de miR-451 en los eritrocitos de células falciformes eleva el crecimiento del parásito (A - E) de FACS representativos parcelas que indican las tasas de infección, como un porcentaje del total de RBC, se indica mediante m1, para la er mostradotipos ythrocyte. (F) las tasas de infección compuestos derivados de FACS y se representan como un valor normalizado contra untransfected HbAA glóbulos rojos. Los valores en el panel AE son FACS representativos parcelas, F es la media ± SE.

Figura 4
Figura 4: La transfección de miR-451 enriquece de transcripciones de fusión PKA-R y muestra que el miARN fusionado es eritrocítica origen Enriquecimiento de las transcripciones de fusión indicadas-destiobiotina conjugado miARN-mRNA que han sido capturados por estreptavidina.. Los valores se midieron usando PCR en tiempo real y se representaron como un valor relativo en comparación con parásitos no transfectadas. Los valores son medias ± SE.

Figura 5
Figura 5:. Ribosomas parásito puede ser aislados a través de gradiente de sacarosa (A - B) example traza un perfil de polisomas extraído de Plasmodium falciparum. (A) Rastro de un perfil polisoma extraído de Plasmodium falciparum, con los años 40, 60S, 80S y picos polisomas (con # s que indican el número de ribosomas asociados) que se muestra. (B) de transferencia Northern de 18S y 28S rRNA través de las fracciones ribosomales. Los valores son medias ± SE.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

HbS es una de las variantes de hemoglobina más comunes en las zonas endémicas de malaria, en gran medida, ya que proporciona protección contra la malaria grave por P. falciparum. Las técnicas necesarias para caracterizar el papel del microRNA humana en la regulación de genes de P. falciparum se detallan a lo largo de este manuscrito. Mediante la extracción de ARN total de una manera tal como para incluir todos los pequeños RNAs, y mediante la realización de un procedimiento de lisis parásito relativamente sencillo, estos RNAs de fusión fueron capaces de ser identificados a través de una variedad de técnicas independientes.

Estos pasos son relativamente sencillos, pero son sensibles a los problemas y la contaminación si no se sigue correctamente. Durante la extracción del parásito, es crítico para llevar a cabo la lisis de saponina para eliminar la contaminación de eritrocitos de acogida. Esto es particularmente cierto durante la etapa de lisis de saponina de la aislamiento de ARN. El componente de miARN de las células de sangre roja de acogida es varios órdenes de magnitud greater que la del parásito, en parte debido a la mayoría de las células rojas de la sangre siendo infectada, por lo que es vital para eliminar la mayor cantidad de contaminación eritrocítica posible. También es importante mantener la cultura de la malaria en una etapa sana y correcta (si se requiere un punto específico en el ciclo de infección) para obtener un perfil exacto miRNA. Del mismo modo, durante la extracción con fenol-cloroformo, es de vital importancia para asegurar que las fases acuosas son claras y, en caso contrario, repetir la extracción con fenol-cloroformo para evitar cualquier contaminación restante.

Además, en el experimento de captura de destiobiotina, es crítico para eluir con un exceso de biotina y utilizar el mínimo de perlas de estreptavidina, a fin de asegurar la elución específica adecuada. La elución de ARN unido a través de la competencia con biotina, en lugar de la desnaturalización completa de las perlas de sí mismos, sirve para reducir drásticamente el enriquecimiento fondo ARN. Por último, se destacó el experimento de captura destiobiotina uns una manera importante para demostrar cómo fueron capturados estos miRNAs, pero varias otras técnicas también se utilizaron en los estudios previos para demostrar estos ARN de fusión, tales como transferencias Northern y ensayos de protección de ribonucleasa 29. Tales métodos de uso de los microRNAs transfectadas para recuperar las transcripciones modificados pueden tener una aplicación más amplia, tales como la purificación de complejos de proteínas asociadas que pueden mediar el transporte y el procesamiento de los miRNAs transfectadas.

Si bien diversos enfoques en todo el genoma se han utilizado para estudiar el proteoma malaria y transcriptoma 22-25, hay pocos métodos a nivel mundial examinan la regulación de traducción en P. falciparum 21,26. Esta limitación metodológica impide el análisis global de la regulación de traducción en P. falciparum. Uno de los enfoques experimentales más comunes para estudiar la regulación de traducción es polisoma perfiles, que evalúa traducción generalactividad al basado en los ribosomas cargados en mRNAs específicos de interés. Más detalles en este manuscrito es un método de perfiles polisoma optimizado para su uso en parásitos de la malaria que lisa tanto los eritrocitos infectados y el parásito dentro. Los métodos anteriores no se recuperaron la mayoría de los polisomas y lo hizo parecer como si los parásitos del paludismo no tenían poblaciones sustanciales de polisomas. El uso de un tampón de lisis con una alta concentración de acetato de potasio y magnesio hizo posible para lisar ambas células rojas de la sangre y parásitos mientras que la solubilización de los ribosomas unidos a la membrana para permitir la captura de polisomas intactos.

Este método rentable de purificación ribosomal y perfilado ayudará a cerrar la brecha en el conocimiento existente entre el transcriptoma y proteoma malaria y permitir el análisis de todo el genoma del estado de traslación de P. falciparum. Este enfoque ha sido utilizado para comparar el estado de traducción de la etapa temprana y tardía betapa lood parásitos 28, que bien han coordinado la expresión génica. Los datos sobre la carga ribosomal de las transcripciones se pueden obtener fácilmente y se analizaron para determinar la densidad de los ribosomas en mRNAs específicos. Además, cuando se combina con la sincronización de sorbitol, cambios en la densidad ribosomal se pueden utilizar para establecer cómo traducción se regula durante todo el ciclo de vida del parásito. El aislamiento de los ribosomas utilizando este enfoque requiere una gran cantidad de la cultura, que por desgracia limita las etapas del ciclo de vida de la malaria en la que se puede realizar. La gran cantidad de material de entrada también limitar su uso tanto a las cepas de laboratorio in vitro de Plasmodium falciparum, y puede limitar su aplicabilidad a otros organismos infecciosos. Cualquier persona que utiliza este procedimiento también será capaz de detectar los genes que muestran perfiles de traducción inusuales, en transcripciones particulares que no estén asociadas a los ribosomas, lo que refleja los modos alternativos de regulación génica. Por último,este enfoque nos permitirá evaluar cómo los agentes antipalúdicos nuevos afectan a la traducción de proteínas e identificar mecanismos de traducción-de resistencia a los medicamentos. Este gasoducto tiene una gran utilidad en la identificación y determinación de la regulación post-transcripcional en muchos sistemas experimentales.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
REAGENTS-All reagents must be RNAse-free.
Diethyl pyrocarbonate Sigma D5758 DEPC
DEPC-treated water (see REAGENT SETUP)
Yoyo-1 DNA fluorescent dye Thermo Fisher
Gene Pulser II electroporator Bio-Rad
0.2 cm Electroporation cuvettes
4 M potassium acetate Mallinckrodt 6700
2 M potassium HEPES Sigma H0527 pH 7.2
1 M magnesium acetate Sigma M-2545
1 M dithiothreitol Research Products International D11000 DTT
100 mM phenylmethylsulfonate fluoride Sigma P7626 PMSF, dissolved in isopropanol
10% (v/v) Igepal CA-630 Sigma-Aldrich I3021
10% (w/v) sodium deoxycholate Sigma D-6750 DOC
Cycloheximide Sigma C-7698 CHX
Sucrose Mallinckrodt 8360-04
RNAseOUT (Invitrogen, cat. no. 100000840) Invitrogen 100000840
RPMI-1640 w/ L-glutamine Cellgro 10-040-CV
10% AlbuMAX I Invitrogen 11020-039 w/v in sterile water
Gentamicin Gibco 15750-060
HT supplement (100x) (Invitrogen, cat. no. 11067030)
45% (w/v) sucrose (Sigma, cat no. G8769)
1 M HEPES buffer (Gibco, cat. no. 15630-080)
1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)
Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)
Glass slides (VWR, cat. no. 48311-702)
Giemsa stain (50X) (VWR, cat no. m708-01)
mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).
5' Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)
Biotin powder (Sigma-Aldrich)
1 M Potassium Chloride
Streptavidin Sepharose High Performance Beads (GE Healthcare)
Ribosome resuspension buffer (see REAGENT SETUP)
Lysis buffer (see REAGENT SETUP)
15% (w/v) sucrose gradient solution (see REAGENT SETUP)
50% (w/v) sucrose gradient solution (see REAGENT SETUP)
0.5 M sucrose cushion (see REAGENT SETUP)
60% (w/v) sucrose chase solution (see REAGENT SETUP)
Plasmodium cell culture media (see REAGENT SETUP)
RNA capture Wash Buffer (see REAGENT SETUP)
RNA Elution Buffer (see REAGENT SETUP)
REAGENT SETUP
Solutions
Plasmodium cell culture media
500 ml RPMI-1640 w/ L-glutamine
0.5 ml gentamicin
5 ml HT supplement
2.5 ml 45% glucose
25 ml 10% AlbuMAX I
12.5 ml 1 M HEPES
Sterile filter with 0.2 mm vacuum filter flask.
Plasmodium cell culture media containing 10x CHX
Same recipe as Plasmodium cell culture media above, with the addition of:
2 mM cycloheximide
Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter. 
1x PBS containing cycloheximide
Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.
Ribosome resuspension buffer
400 mM potassium acetate
25 mM potassium HEPES, pH 7.2
15 mM magnesium acetate
200 mM cycloheximide (add fresh)
1 mM DTT (add fresh)
1 mM PMSF (add fresh)
40 U/ml RNaseOUT (add fresh)
Lysis buffer
Same recipe as ribosome resuspension buffer above, with the addition of:
1% (v/v) Igepal CA-630
0.5% (w/v) DOC
Sucrose solutions
Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:
15% (w/v) sucrose to make 15% sucrose gradient solution
50% (w/v) sucrose to make 50% sucrose gradient solution
0.5 M sucrose to make 0.5 M sucrose cushion
As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.
The 60% sucrose chase solution requires only sucrose and water, no other components
60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution
RNA Capture Wash Buffer
20 mM  KCl
5 unit/ml Rnase Out (Invitrogen)
RNA Capture Elution Buffer
Same recipe as RNA Capture Wash Buffer, with the addition of:
2 mM Biotin
EQUIPMENT
SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)
SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)
Ultra-ClearTM ½ x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)
Polyallomer 9/16 x 3 ½ in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)
L8-80M ultracentrifuge (Beckman)
Steel blunt syringe needle, 4 inch, 16 G (Aldrich, cat. no. Z261378)
1 ml syringe with 27 G½ needle (Becton Dickinson, cat no. 309623)
5 ml syringe (Becton Dickinson, cat. no. 309646)
Parafilm
Tube rotator, end-over-end
Microcentrifuge, refrigerated
Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)
TracerDAQ (Measurement Computing)
Eppendorf 5810R centrifuge
Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)

DOWNLOAD MATERIALS LIST

References

  1. World Health Organization. World Malaria Report. (2014).
  2. Livincstone, F. B. Malaria and human polymorphisms. Annu Rev Genet. 5, 33-64 (1971).
  3. Nagel, R. L., Roth, E. F. Malaria and red cell genetic defects. Blood. 74, 1213-1221 (1989).
  4. Aidoo, M., et al. Protective effects of the sickle cell gene against malaria morbidity and mortality. Lancet. 359, 1311-1312 (2002).
  5. Tiffert, T., et al. The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum. Blood. 105, 4853-4860 (2005).
  6. Fairhurst, R. M., et al. Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 435, 1117-1121 (2005).
  7. Cyrklaff, M., et al. Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes. Science. 334, 1283-1286 (2011).
  8. Friedman, M. J. Erythrocytic mechanism of sickle cell resistance to malaria. Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).
  9. Pasvol, G., Weatherall, D. J., Wilson, R. J. Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria. Nature. 274, 701-703 (1978).
  10. Lecellier, C. H., et al. A cellular microRNA mediates antiviral defense in human cells. Science. 308, 557-560 (2005).
  11. Niu, Q. W., et al. Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nature biotechnology. 24, 1420-1428 (2006).
  12. Zhao, G., Yu, D., Weiss, M. J. MicroRNAs in erythropoiesis. Curr Opin Hematol. 17, 155-162 (2010).
  13. Lee, Y. T., et al. LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo. Blood. 122, 1034-1041 (2013).
  14. Sangokoya, C., Doss, J. F., Chi, J. T. Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS genetics. 9, e1003408 (2013).
  15. Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS ONE. 3, e2360 (2008).
  16. Sangokoya, C., Telen, M. J., Chi, J. T. microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease. Blood. 116, 4338-4348 (2010).
  17. Deitsch, K., Driskill, C., Wellems, T. Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic acids research. 29, 850-853 (2001).
  18. Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. trans and cis splicing in trypanosomatids: mechanism, factors, and regulation. Eukaryotic cell. 2, 830-840 (2003).
  19. Baum, J., et al. Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites. Nucleic acids research. 37, 3788-3798 (2009).
  20. Hall, N., et al. A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses. Science. 307, 82-86 (2005).
  21. Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. Genome-wide regulatory dynamics of translation in the asexual blood stages. eLife. 3, (2014).
  22. Oehring, S. C., et al. Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum. Genome biology. 13, R108 (2012).
  23. Lasonder, E., et al. Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry. Nature. 419, 537-542 (2002).
  24. Bozdech, Z., et al. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum. PLoS biology. 1, E5 (2003).
  25. Gardner, M. J., et al. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature. 419, 498-511 (2002).
  26. Zhang, M., Joyce, B. R., Sullivan, W. J. Jr., Nussenzweig, V. Translational control in Plasmodium and toxoplasma parasites. Eukaryotic cell. 12, 161-167 (2013).
  27. Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. Polysome profiling of the malaria parasite Plasmodium falciparum. Molecular and biochemical parasitology. 179, 42-62 (2011).
  28. Bunnik, E. M., et al. Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum. Genome biology. 14, R128 (2013).
  29. LaMonte, G., et al. Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance. Cell host & microbe. 12, 187-199 (2012).
  30. Lambros, C., Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. The Journal of parasitology. 65, 418-420 (1979).
  31. Bourgeois, N., et al. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).
  32. Abruzzo, L. V., et al. Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data. Biotechniques. 38, 785-792 (2005).
  33. Sangokoya, C., LaMonte, G., Chi, J. T. Isolation and characterization of microRNAs of human mature erythrocytes. Methods in molecular biology. 667, 193-203 (2010).
  34. Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. Analysis of short RNAs in the malaria parasite and its red blood cell host. FEBS Lett. 580, 5185-5188 (2006).
  35. Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection. Malar J. 7, 47 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics