اقترانية التزاوج فحوصات لتحليل تسلسل محدد من البروتينات نقل تشارك في الإقتران البكتيرية

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

نقل الجينات والبروتينات على المستوى الجزئي العضوي يلعب دورا مركزيا في بقاء البكتيريا وتطورها وكذلك عمليات العدوى. تبادل الحمض النووي بين البكتيريا أو بين البكتيريا والخلايا لا يمكن أن يتحقق من خلال التحول، والاقتران أو ناقلات التنبيغ. 1،2 الإقتران هي فريدة من نوعها بالمقارنة مع التحول والتنبيغ في ذلك خلال الاقتران بين البكتيريا سالبة الجرام مثل كولاي، يحدث نقل الحمض النووي بطريقة تسيطر عليها المانحة حيث يربط نظام الجزيئات المعقدة خلايا المانحة والمتلقية. الإقتران هي أيضا الطريقة الأكثر مباشرة التي الخلايا البكتيرية تتفاعل مع الخلايا المضيفة لحقن الجينات والبروتينات أو المواد الكيميائية في لأنظمة المضيف. 3 وفي كثير من الأحيان، ونقل هذه العوامل له تأثيرات ملحوظة على المضيف، تتراوح بين التسبب والتسرطن لاستضافة التطور والتكيف. وقد تبين أن recombinatio اقترانيةن يزيد من معدل التكيف 3 أضعاف في البكتيريا مع معدلات طفرة عالية في ظل ظروف الإجهاد البيئي. 4 وعلاوة على ذلك، الاقتران هو إلى حد بعيد الطريقة الأكثر شيوعا التي يتم من خلالها نشر الجينات المقاومة للمضادات الحيوية في السلالات البكتيرية. 5،6

وقد تطورت الكائنات الحية الدقيقة إفراز نظم متخصصة لدعم نقل الجزيئات عبر الأغشية الخلوية. يوجد حاليا 9 أنواع من أنظمة إفراز (TSSs) في البكتيريا سالبة الجرام التي تم وصفها: T1SS، T2SS، T3SS، T4SS، T5SS، T6SS، T7SS، وكذلك المجلس الأعلى للتعليم (إفراز) وتات (يومين أرجينين النبات) مسارات. 7،8 لكل نوع من نظام إفراز ينقسم الى مزيد من أنواع فرعية مختلفة، ضرورة بسبب تنوع البروتينات وتميز الممرات المشتركة، في السلالات البكتيرية المختلفة. على سبيل المثال، في نظام النوع الرابع إفراز (T4SS)، وأنظمة تي والمساعدة النقدية تسهل نقل المستجيب في حين أن F-البلازميد، R27 لالثانية pKM101 T4SSs تسهيل نقل البلازميد اقترانية. 7،9،10 الفهم المفصل من الآليات التي الكائنات تجميع أنظمة إفراز كل منهما من البروتينات المكونة لها وتشترك محتويات الخلوية مع المتلقي أو البيئة المحيطة بهم هو عامل مهم في تطوير استراتيجيات ترمي إلى مكافحة الكائنات الحية الدقيقة المسببة للأمراض والعمليات عدوى الخلوي.

بعد تحديد الاقتران البكتيري الأولي في كولاي التي كتبها دربيرج وتاتوم، 11 وقد تم تحديد عدد كبير من البلازميدات النقالة واقترانية ويتميز. تظهر هذه البلازميدات 12 المتنقلة مجموعة كبيرة هو حجم (من 1 إلى أكثر من 200 kilobases (كيلوبايت))، ولكن كل البلازميدات النقالة تحتوي على relaxase، الذي يعترف أصل نقل (أوريت) وبالتالي تمكين انتقال البلازميد. البلازميدات اقترانية مزيد من جينات ترميز لتجميع وT4SS وظيفية وكذلك نوعرابعا البروتين اقتران. 12 على سبيل المثال 100 كيلو بايت F البلازميد كولاي بترميز كل الجينات اقترانية ضمن (هيئة تنظيم الاتصالات) المنطقة 33.3 نقل كيلوبايت. 13 الجينات في المنطقة هيئة تنظيم الاتصالات البلازميد ترميز F جميع البروتينات التي تسهل تشكيل شعرة، التزاوج تشكيل الزوج (MPF)، نقل الحمض النووي وظائف استبعاد أثناء نقل البلازميد اقترانية. 10،14،15 مجموعة كبيرة من المعرفة متاحة للاقترانية T4SSs، ومع ذلك بالتفصيل الدراسات الهيكلية للبروتينات اقترانية والمجمعات وإلا أصبحت متاحة في الآونة الأخيرة. 16-28

من أجل تجميع عرض شامل لعملية اقترانية، لا بد من اقتران دراسات هيكلية مفصلة لالطفرات تحليل البروتينات نقل اقترانية. ويمكن تحقيق ذلك من خلال فحوصات التزاوج اقترانية. لالبلازميد F، كل البروتين المشفرة في المنطقة هيئة تنظيم الاتصالات تلعب دورا في التعاون بوساطة F-njugation. وبالتالي، فإن خروج المغلوب / حذف الجينات نقل تلغي قدرة اقترانية الخلية (الشكل 1). في حين البلازميدات المحمولة الصغيرة هي أكثر ملاءمة لإجراءات الحذف القياسية، لالبلازميدات اقترانية أكبر مثل F، تتحقق بالضربة القاضية جين بسهولة أكبر عبر إعادة التركيب مثلي حيث يتم استبدال الجينات المستهدفة مع واحد نقل الجينات المقاومة للمضادات الحيوية واضح. في البروتوكول الحالي، ونحن توظيف إعادة التركيب مثلي لاستبدال الجينات نقل الفائدة مع أسيتيل الكلورامفينيكول (CAT) في 55 كيلوبايت F البلازميد مشتق pOX38-ح. 29،30 البلازميد خروج المغلوب الناتجة، pOX38-ح Δgene :: سم، ويسهل المقاومة إلى وجود الكلورامفينيكول (سم) في وسائل الإعلام نمو. الخلايا المانحة إيواء pOX38-ح Δgene :: سم غير قادرة على التأثير اقترانية نقل الحمض النووي / التزاوج كما لوحظ من خلال استخدام فحص التزاوج. كفاءة التزاوج من خلية المانحة pOX38-ح Δgene :: سم ورجب الطبيعيient سينخفض ​​أو، في كثير من الأحيان، أن يلغى. نقل اقترانية من البلازميد pOX38-ح Δgene :: سم يمكن استعادتها عن طريق البلازميد الانتعاش صغير إيواء الجينات نقل المستهدفة. هذا البلازميد الانتعاش يمكن أن يكون واحد أن يوفر التعبير التأسيسي، مثل pK184 البلازميد (pK184 الجينات)، 31 أو أخرى توفر التعبير محرض طالما أن البلازميد يستهدف بشكل صحيح الجين إلى الموقع الصحيح داخل الخلية (السيتوبلازم أو الجبلة المحيطية). ونتيجة لذلك، في المقايسات التزاوج بين هذه الجهات المانحة الجديدة (إيواء pOX38-ح Δgene البلازميدات :: سم + pK184 الجينات) والخلية المستقبلة، ومن المتوقع أن يعيد إلى ما يقرب من ذلك من الطبيعي المانح والمتلقي التزاوج فحص كفاءة التزاوج. هذا النظام يمكن واحد للتحقيق وظيفة الجين خرج من خلال توليد سلسلة من يبني pK184 الجينات (الحذف أو طفرات نقطة) واختبار قدرة كل بناء لاستعادة القدرة التزاوج من إيواء pOX38-ح Δgene :: سم الخلية المانحةالصورة.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. الجيل من التركيبات DNA

  1. تصميم الأوليغومرات لمثلي إعادة التركيب من الهدف جين
    1. تصميم واحد 55-72 سنة مضت قليل وحدات إلى الأمام على النحو التالي: (أ) اختيار 19-32 نقطة أساس طويل تسلسل النوكليوتيدات الذي هو مثلي لتسلسل الحمض النووي في شركة بريتيش بتروليوم المنطقة 10-100 المنبع من موقع بداية 5 'من الجين أسيتيل الكلورامفينيكول في البلازميد pBAD33 التجاري و 32 و (ب) اختيار 36-54 سنة مضت النوكليوتيدات طويلة تسلسل مثلي إلى منطقة 10-150 بي بي المصب من موقع بداية 5 'من الجين المستهدف من الفائدة.
      1. تاريخ "نهاية تسلسل النوكليوتيدات التقطت في الفقرة (ب) إلى 5 '3 نهاية النوكليوتيدات اختار تسلسل في (أ)، مما يعطي واحدة 55-72 قليل وحدات إلى الأمام طويلة.
    2. تصميم واحد 55-72 بي بي العكس قليل وحدات على النحو التالي: (أ) اختيار 19-32 نقطة أساس طويل تسلسل النوكليوتيدات الذي هو مثلي لتسلسل الحمض النووي في شركة بريتيش بتروليوم المنطقة 10-100 المصبمن 3 'نهاية الجين الكلورامفينيكول في البلازميد pBAD33 التجاري، و (ب) اختيار 36-54 سنة مضت النوكليوتيدات طويلة تسلسل مثلي إلى منطقة داخل 10-150 بي بي المنبع 3' موقع نهاية الجين المستهدف من الفائدة .
      1. تاريخ "نهاية تسلسل النوكليوتيدات التقطت في الفقرة (ب) إلى 5 '3 نهاية النوكليوتيدات اختار تسلسل في الفقرة (أ) لجعله قليل وحدات واحدة.
      2. نسخ هذا قليل وحدات في أي برنامج المعلوماتية الحيوية المتاحة وتحويل تسلسل إلى متممة العكسي. وهذا يعطي واحدة 55-72 سنة مضت قليل وحدات عكس طويلة.
    3. باستخدام أي برنامج جزئية محلل المتاحة، وتأكد من أن الأوليغومرات إعادة التركيب يكون محتوى GC بين 40-60٪، وانخفاض القاسي درجة حرارة انصهار (T م)، وانخفاض الذاتي ومغاير dimerization T م الصورة. ترتيب الاشعال لتخليق وشحنة من أي شركة للتكنولوجيا الحيوية المفضلة.
  2. التضخيم من كاسيت لجنة مناهضة التعذيب من pBAD33 (سم R
  3. تنمو ثقافة بين عشية وضحاها (O / N، 16-18 ح) من الخلايا DH5α إيواء البلازميد pBAD33 في مرق استذابة معقم (LB) مع 20 ميكروغرام / مل الكلورامفينيكول (سم) مع اهتزاز عند 200 دورة في الدقيقة و 37 درجة مئوية.
  4. الطرد المركزي 6-8 مل من ثقافة O / N في درجة حرارة الغرفة، 5000 x ج لمدة 3 دقائق. صب طاف واستخراج البلازميد pBAD33 من بيليه استخدام البلازميد مجموعة مصغرة الإعدادية (مواد الجدول) وبروتوكول الشركة الصانعة.
  5. هل خلاصة من البلازميد الحمض النووي pBAD33 بإضافة ما يلي في أنبوب معقم في ترتيب معين: حجم مناسب من الماء المقطر مزدوجة ([ده 2 O) إلى الحجم النهائي من 50 ميكرولتر، حجم 1 ميكروغرام من pBAD33 البلازميد، 5 ميكرولتر 10X رد فعل العازلة انزيم، و 0.5 ميكرولتر من انزيم التقييد افاعي (RE). المزيج بلطف قبل pipetting والسماح للرد فعل المضي قدما لمدة 1 ساعة عند 37 درجة مئوية. الحرارة تعطيل رد فعل لمدة 20 دقيقة (دقيقة) في 80° C. عينات في مخزن -20 درجة مئوية لمدة لا تزيد عن 24 ساعة للحد من تدهور لزجة نهاية.
  6. إعداد الاغاروز 1.2٪ يفصل هلام عن طريق خلط 1.2 غرام من الاغاروز مع 100 مل من 1X تاي (40 ملي تريس، ودرجة الحموضة 8.5، و 20 ملم حمض الخليك، 1 ملم EDTA) عازلة في قارورة مخروطي سعة 250 مل. الحرارة ودوامة لتذوب تماما في الميكروويف. وقف تسخين فورا عندما يبدأ السائل في الغليان ودوامة القارورة.
    1. تبريد الاغاروز السائل لمدة 3 دقائق في درجة حرارة الغرفة في حين يحوم، إضافة 2 ميكرولتر من 10 ملغ / مل بروميد إيثيديوم ودوامة لخلط. صب الاغاروز في علبة هلام مع المشط جيدا والسماح لها لترسيخ لمدة 1 ساعة في درجة حرارة الغرفة. تخزين المواد الهلامية في 4 درجة مئوية لمدة تصل إلى 2 أيام في المخزن 1X تاي.
  7. خلط كل RE الهضم من 1.2.3 مع 0.2 حجم صبغ الحمض النووي تحميل (10 ميكرولتر من صبغ في 50 رد فعل ميكرولتر) من قبل pipetting. تحميل 5 ميكرولتر من 500 ميكروغرام / مل سلم الحمض النووي في البئر الأول وجميع من خليط RE هضم صبغ إلى آخر بشكل جيد على لهلام garose. استخدام 2-3 الآبار لتحميل كل من حجم رد الفعل على هلام.
    1. تشغيل هلام المغمورة بالكاد في 1X TAE العازلة والتي تعمل في 45-50 V (4،5-5 V / سم) لمدة 65 دقيقة في الجهاز الكهربائي للهلام.
  8. باستخدام مجلس الوزراء للأشعة فوق البنفسجية والحلاقة معقمة، وقطع بسرعة الفرقة 2.8 كيلوبايت الذي يتوافق مع تسلسل CAT من هلام للحد من التعرض للأشعة فوق البنفسجية من الحمض النووي. استخراج الحمض النووي من هلام شريحة قطع من استخدام عدة استخراج الهلام (مواد الجدول) وفقا لبروتوكول الشركة المصنعة.
    ملاحظة: احرص على عدم تعريض الجلد مباشرة تحت الأشعة فوق البنفسجية والتعامل مع الحلاقة مع الرعاية.
  9. تضخيم كاسيت CAT المستخرجة من 1.2.6 عن طريق البلمرة المتسلسل (PCR) باستخدام بادئات مصممة في 1.1 التي تحتوي على يتدلى مثلي إلى التسلسل الجيني للسماح لإعادة التركيب مثلي. يتم تعيين ردود الفعل PCR حتى على الجليد باستخدام المبادئ التوجيهية الشركة المصنعة (مواد الجدول) بالترتيب التالي:
    1. الىالعقيمة أنبوب PCR، إضافة حجم مناسب من ده 2 O إلى الحجم النهائي من 50 ميكرولتر، تليها 10 ميكرولتر من العازلة PCR، 1 ميكرولتر من 10 ملي dNTPs، 2.5 ميكرولتر من 10 ميكرومتر التمهيدي إلى الأمام، 2.5 ميكرولتر من 10 ميكرومتر التمهيدي عكسي ، 1-25 نانوغرام من الحمض النووي قالب من 1.2.6 و 0.5 ميكرولتر من 100 وحدة / ميكرولتر الحمض النووي بوليميريز.
    2. إعداد عنصر تحكم السلبية التي تحمل نفس المكونات 1.2.7.1 ولكن مع استثناء من الحمض النووي القالب. استخدام حجم مناسب من ده 2 O بدلا من قالب الحمض النووي. إعداد مراقبة إيجابية باستخدام الحمض النووي القالب والاشعال التي ثبت للعمل في تفاعل PCR، مثل تلك المنصوص كما تحكم إيجابية من قبل الشركة المصنعة.
    3. تخلط جميع محتويات رد فعل بلطف قبل pipetting.
    4. تضخيم عبر PCR باستخدام الإعدادات التالية: تمسخ الأولي لمدة 30 ثانية في 98 درجة مئوية، و 30 دورات تمسخ لمدة 10 ق على 98 درجة مئوية، الصلب التمهيدي لمدة 20 ثانية، تمديد لمدة 20 ثانية لكل كيلو قاعدة من amplicon عند 72 درجة مئوية و زعنفةآل تمديد لمدة 10 دقيقة عند 72 درجة مئوية. عينات في مخزن -20 درجة مئوية.
  10. تأكد من حجم الصحيح من التضخيم عبر الكهربائي للهلام الاغاروز (انظر 1.2.4-1.2.5) باستخدام فقط 5 ميكرولتر من كل رد فعل. تنقية amplicon PCR باستخدام طقم تنقية PCR وبروتوكول الشركة الصانعة. متجر تنقية الحمض النووي في -20 درجة مئوية.
  • وpK184 الجينات استعادة البلازميد
    1. تصميم التمهيدي إلى الأمام ابتداء من ل 5 'نهاية والذهاب نحو 3' نهاية بالترتيب التالي: (أ) اختيار 4 النيوكليوتيدات العشوائية (مزيج من الأدنين، ثايمين، الجوانين والسيتوزين) للكفاءة الانقسام، وتعلق على (ب) وEcoRI تقييد انزيم (RE) تسلسل خفض الموقع (GAATTC)، تليها (ج) 21-25 نقطة أساس طويل تسلسل النوكليوتيدات الذي هو مثلي إلى نهاية 5 'من الجينات في المصالح، بما في ذلك كودون البداية. إذا كان يحتوي على الجين المستهدف موقع EcoRI، اختر RE مناسب آخر من pK184 متعددة موقع الاستنساخ.
    2. في حالة جينات ترميز البروتينات محيط بالجبلة، وتشمل تسلسل زعيم إضافية بين الموقع RE وكودون بداية على التمهيدي إلى الأمام.
    3. باستخدام أي متاح بنسبة ضئيلة من محلل، تأكد من أن الاشعال لها محتوى GC بين 40-60٪، وانخفاض دبوس الشعر T م، وانخفاض الذاتي ومغاير dimerization T م الصورة. ترتيب الاشعال لتخليق.
    4. تنمو O / N ثقافة خلايا DY330R pOX38-ح في معقم LB تحتوي على 10 ميكروغرام / مل التتراسيكلين (ح) مع اهتزاز عند 32 درجة مئوية و 200 دورة في الدقيقة. الطرد المركزي 6-8 مل من ثقافة O / N في درجة حرارة الغرفة، 5000 x ج لمدة 3 دقائق. صبوطاف استخراج DNA البلازميد من بيليه استخدام البلازميد مجموعة مصغرة الإعدادية (مواد الجدول) وبروتوكول الشركة الصانعة.
    5. تضخيم الجين الكامل في المصالح مع الاشعال من 1.3.1-1.3.5 باستخدام pOX38-ح كقالب (انظر 1.2.7.1-1.2.7.3).
    6. تأكد من حجم الصحيح من التضخيم عبر الكهربائي للهلام الاغاروز (انظر 1.2.4-1.2.5) باستخدام فقط 5 ميكرولتر من كل رد فعل. تنقية تضخيم الحمض النووي باستخدام طقم تنقية PCR وبروتوكول الشركة الصانعة. متجر تنقية الحمض النووي في -20 درجة مئوية.
    7. هل خلاصة مزدوجة من كل من يتوفر تجاريا الحمض النووي pK184 البلازميد والجينات تضخيم (من 1.3.7.)، وذلك بإضافة ما يلي في أنبوب معقم في ترتيب معين: حجم مناسب لده 2 O إلى الحجم النهائي من 50 ميكرولتر (1) حجم ميكروغرام من pK184 البلازميد، 5 ميكرولتر رد فعل العازلة 10X الانزيم، و1 ميكرولتر من كل EcoRI وHindIII.
      1. المزيج بلطف قبل pipetting والسماح للرد فعل المضي قدما لمدة 1 ساعةفي 37 درجة مئوية. الحرارة تعطيل رد فعل لمدة 20 دقيقة في 80 درجة مئوية. عينات في مخزن -20 درجة مئوية لمدة لا تزيد عن 24 ساعة للحد من تدهور لزجة نهاية.
        ملاحظة: نوع نوكلياز تقييد استخدامها هنا يعتمد على موقع تقييد نوكلياز التي تم ترتيبه في الاشعال في خطوات 1.3.1 و 1.3.2.
      2. كما تحكم إيجابية، وإنشاء الملخصات واحدة من البلازميد pK184 من خلال إعداد نفس رد الفعل كما هو الحال في 1.3.8 باستثناء إضافة واحد فقط من الدقة لأنبوب رد فعل. هل هذا بشكل منفصل مع كل من الدقة.
    8. تشغيل هضم على هلام الاغاروز 1.2٪ باستخدام بروتوكولات 1.2.4-1.2.5 استخراج الحمض النووي المزدوج هضم أجزاء من كلا pK184 والجين من الفائدة وفقا إلى الخطوة 1.2.6.
    9. Ligate إدراج الجينات في ناقلات pK184 بإضافة المكونات في أنبوب معقم بالترتيب التالي: 2 ميكرولتر من 10X T4 DNA يغاز العازلة، أي ما مجموعه 100 نانوغرام الحمض النووي يتكون من 1: ناقل 3: إدراج (pK184: الجينات) النسبة، ده 2 O ما يصل الىالحجم الكلي لل20 ميكرولتر و 1 يغاز ميكرولتر T4 DNA. ونتيجة لسيطرة سلبية، اقامة رد فعل مماثل باستخدام 100 نانوغرام من ناقلات دون الجين إدراج.
      1. المزيج بلطف على جميع محتويات رد فعل باستخدام micropipette واحتضان لمدة 30 دقيقة في درجة حرارة 25 درجة مئوية. للحرارة على تعطيل التفاعل ربط لمدة 10 دقيقة عند 65 درجة مئوية ومن ثم وضع على الجليد.
    10. بينما على الجليد، إضافة 15 ميكرولتر من pK184 الجينات رد فعل ربط من الخطوة 1.3.10 إلى 100 ميكرولتر من الخلايا DH5α المختصة كيميائيا في العقيمة 1.5 مل أنبوب. المزيج بلطف قبل pipetting واحتضان على الجليد لمدة 10 دقيقة. تفعل الشيء نفسه بالنسبة للعينة السيطرة السلبية. للتحكم إيجابية، استخدام 20-100 نانوغرام من البلازميد مثل pBAD33 وتحويلها إلى 50 ميكرولتر من DHα الخلايا.
    11. مباشرة نقل عينات من الجليد إلى 42 ° C حمام المياه واحتضان لمدة 90 ثانية. وهذا يوفر للخلايا الصدمة الحرارية وتسمح لهم امتصاص الحمض النووي البلازميد.
    12. خلايا المكان مرة أخرى على الجليد لآخر5 دقائق ثم قم بإضافة 900 ميكرولتر من LB. عقيمة احتضان عند 37 درجة مئوية لمدة 1 ساعة في حين تهتز في 125 دورة في الدقيقة.
    13. قسامة حجم 100 ميكرولتر من عينة من كل رد فعل ربط في 1.3.13 على لوحة أجار يحتوي على 50 ميكروغرام / مل الكانامايسين (كم) وتنتشر الخلايا باستخدام رش العقيمة. يجب أن يكون المضادات الحيوية المناسبة لوحة تحكم إيجابية. إبقاء المنطقة العقيمة والعمل بالقرب من اللهب. احتضان لوحة رأسا على عقب عند 37 درجة مئوية خلال الليل.
    14. باستخدام ماصة معقمة أو حلقة، حصاد مستعمرة متميزة واحدة من الخلايا وتطعيم 20 مل معقم LB مع 50 ميكروغرام / مل كم. إبقاء المنطقة العقيمة والعمل بالقرب من اللهب. تنمو الخلايا O / N عند 37 درجة مئوية مع اهتزاز عند 200 دورة في الدقيقة.
    15. جعل 3-5 الأسهم الجلسرين من الخلايا DH5α تحويلها عن طريق خلط 500 ميكرولتر من O / N ثقافة مع 500 ميكرولتر من معقمة 100٪ الجلسرين (النهائي 50٪ ت / ت) في العقيمة البرد الأنابيب. تخزين في -80 درجة مئوية.
    16. أيضا أجهزة الطرد المركزي 6-8 مل من O / N الثقافة في درجة حرارة الغرفة، 5،000 x ج لمدة 3 دقائق. صب طاف واستخراج pK184 الجينات الانتعاش البلازميد من بيليه استخدام البلازميد مجموعة مصغرة الإعدادية (مواد الجدول) وبروتوكول الشركة الصانعة.
  • pK184 - المسوخ الجين
    ملاحظة: الاشعال مصممة لالحذف، الإدراج و / أو الطفرات نقطة يمكن أن تتولد بسهولة باستخدام الأدوات المتاحة على الانترنت الصانعين.
    1. تصميم كل التمهيدي إلى الأمام عن طريق التقاط و18-32 نقطة أساس النوكليوتيدات طويلة التسلسل الذي هو مثلي إلى نهاية 5 'من الجينات في المصالح، بما في ذلك كودون البداية. الاشعال تصميم مثل أن كل التمهيدي إلى الأمام anneals 30-180 بي بي المصب من سابقتها، مما أدى إلى طفرات الحذف تفتقر إلى شظايا الببتيد محطة N من أطوال مناسبة.
    2. تصميم التمهيدي العكسي عن طريق التقاط و18-32 نقطة أساس طويل تسلسل النوكليوتيدات الذي هو مثلي إلى نهاية 3 'من الجينات في المصالح بما في ذلك وقف كودون. نسخ هذا التمهيدي إلىنيويورك برنامج المعلوماتية الحيوية المتاحة وتحويل تسلسل إلى متممة العكسي. هذا هو التمهيدي عكسي.
      1. في حالة جينات ترميز البروتينات محيط بالجبلة، تصميم التمهيدي العكسي الذي هو تكملة العكسي من "نهاية التسلسل القيادي أن الجناحين 5 '3 نهاية هذا الجين ومطلوب لتوطين السليم للمنتج البروتين في الجبلة المحيطية.
    3. باستخدام أي برنامج جزئية محلل المتاحة، وتأكد من أن الاشعال الحذف يكون محتوى GC بين 40-60٪، وانخفاض القاسي درجة حرارة انصهار (T م)، وانخفاض الذاتي ومغاير dimerization T م الصورة. ترتيب الاشعال لتخليق وشحنة من أي شركة التكنولوجيا الحيوية المتاحة.
    4. باستخدام بناء pK184 الجينات التي تم الحصول عليها في بروتوكول 1.3 كقالب والمبادئ التوجيهية في 1.2.7-1.2.8، PCR تضخيم بنيات الحذف مع الاشعال مصممة في الخطوات 1.4.1-1.4.3 لتوليد amplicons ΔX pK184 الجينات . مخزن تضخيم الحمض النووي للر -20 درجة مئوية.
    5. Ligate التركيبة تضخيمها باستخدام أي مجموعة الطفرات المتاحة (مواد الجدول).
    6. تحويل كل من ligates ΔX pK184 الجينات بشكل منفصل في الخلايا DH5α المختصة كيميائيا باستخدام بروتوكول الصدمة الحرارية القياسية (انظر 1.3.11-1.3.13).
    7. قسامة حجم 100 ميكرولتر من عينة من كل رد فعل ربط في 1.4.12 على لوحة أجار يحتوي على 50 ميكروغرام / مل كم وتنتشر الخلايا باستخدام رش العقيمة. إبقاء المنطقة العقيمة والعمل بالقرب من اللهب. احتضان لوحة رأسا على عقب عند 37 درجة مئوية خلال الليل.
    8. باستخدام ماصة معقمة أو حلقة، حصاد مستعمرة متميزة واحدة من الخلايا وتطعيم 20 مل سائل الإعلام العقيمة LB مع 50 ميكروغرام / مل كم. إبقاء المنطقة العقيمة والعمل بالقرب من اللهب. تنمو الخلايا O / N عند 37 درجة مئوية مع اهتزاز عند 200 دورة في الدقيقة.
    9. جعل 3-5 الأسهم الجلسرين من الخلايا DH5α تحويلها عن طريق خلط 500 ميكرولتر من O / N ثقافة مع 500 ميكرولتر من معقمة 100٪ الجلسرين (وإينال 50٪ ت / ت) في العقيمة البرد الأنابيب. تخزين في -80 درجة مئوية.
    10. الطرد المركزي 6-8 مل من ثقافة O / N في درجة حرارة الغرفة، 5000 x ج لمدة 3 دقائق. صب طاف واستخراج ΔX البلازميد pK184 الجينات بناء من بيليه استخدام البلازميد مجموعة مصغرة الإعدادية (مواد الجدول) وبروتوكول الشركة الصانعة. تخزين الحمض النووي في -20 درجة مئوية.
  • 2. توليد pOX38-ح Δgene :: سم سلالات

    1. DY330R pOX38-ح Δgene :: بالضربة القاضية سم
      1. إعداد O / N ثقافة خلايا DY330R pOX38-ح في 10 مل معقم LB تحتوي على 10 ميكروغرام / مل ح. تنمو ثقافة O / N عند 32 درجة مئوية و 200 دورة في الدقيقة.
      2. جعل 1:70 التخفيف من O / N ثقافة إلى 20 مل من LB. عقيمة جديدة تنمو الخلايا على 32 درجة مئوية حتى (0،4-0،6 OD ل 600Nm) مرحلة النمو منتصف السجل.
      3. نقل 10 مل من ثقافة إلى قارورة معقمة واحتضان عند 42 درجة مئوية لمدة 15 دقيقة في 150 دورة في الدقيقة في هز با المياهعشر. وسيحفز هذا التعبير عن بروتينات معينة إعادة التركيب في DY330R.
      4. هدئ الثقافة في حمام الماء المثلج لمدة 10 دقيقة. إعداد خلايا electrocompetent على النحو التالي.
        1. نقل الخلايا المبردة في أنابيب المخروطية قبل المبردة وأجهزة الطرد المركزي في 4000 x ج لمدة 7 دقائق في 4 درجات مئوية. يجب وضع جميع الأنابيب والماصات لاستخدامها في الخطوات القادمة في 4 درجات مئوية أو على الجليد لتبريد.
        2. إزالة طاف ومعلق بلطف الخلايا في 1 مل من الجليد الباردة ده 2 O. إضافة 30 مل أخرى من الجليد البرد ده 2 O.
        3. الطرد المركزي الخلايا (4000 x ج، 7 دقائق، 4 ° C)، تجاهل طاف وبلطف معلق الخلايا في 1 مل من الجليد الباردة ده 2 O.
        4. نقل الخلايا معلق إلى ما قبل المبردة 1.5 مل أنابيب microfuge والطرد المركزي في 15000 x ج لمدة 1 دقيقة على 4 درجات مئوية.
        5. معلق بلطف بيليه في 200 ميكرولتر من الجليد الباردة ده 2 O وقسامة في 50 مجلدات ميكرولتر. Electrocompeteويمكن تخزين الخلايا الإقليم الشمالي في -80 ° C
      5. إضافة 300 نانوغرام من الكاسيت CAT تضخيم من 1.2 إلى 50 ميكرولتر من خلايا DY330R pOX38-ح electrocompetent حين خلط على الجليد، بلطف بواسطة pipetting صعودا وهبوطا. كرر هذه الخطوة باستخدام معدلة pBAD33 البلازميد كعنصر تحكم إيجابية.
      6. نقل الخلايا إلى (-20 درجة مئوية) 1 مم كفيت electroporation المبردة مسبقا. Electroporate الخلايا عند 1.8 كيلو فولت مع الوقت ثابت من 5.5 مللي ثانية، وذلك باستخدام electroporator. فورا بعد تطبيق النبض، وتمييع الخلايا مع 1 مل من شركة نفط الجنوب وسائل الإعلام ونقل إلى أنبوب microfuge جديدة. احتضان الخلايا عند 32 درجة مئوية لمدة 2 ساعة.
      7. قسامة 100 ميكرولتر من كل عينة على لوحات أجار التي تحتوي على 10 ميكروغرام / مل ح و 20 ميكروغرام / مل سم وانتشر استخدام رش العقيمة. إبقاء المنطقة العقيمة والعمل بالقرب من اللهب. احتضان لوحة رأسا على عقب على 32 درجة مئوية خلال الليل لتحديد لrecombinants ناجحة. سوف الكاسيت CAT أدخلت الخلية تخضع إعادة مثليبالاشتراك مع الجينات في المصالح وخلق DY330R pOX38-ح Δgene :: سم (ريف ح سم R) استنساخ.
        ملاحظة: من المهم أن ينمو خلايا DY330R في 32 درجة مئوية، مع استثناء من تحريض مدة 15 دقيقة في 42 ° C من الخطوة 2.1.3 قبل توليد خلايا electrocompetent، والنمو لفترات طويلة في درجات حرارة مرتفعة المخاطر موت الخلايا بسبب إنتاج المنتجات السامة من ص L الاوبرون مسؤولة عن وظائف إعادة التركيب في DY330R. 33،34
      8. إعداد O / N من DY330R pOX38-ح Δgene :: خلايا سم من حصاد مستعمرة متميزة واحدة من الخلايا مع ماصة معقمة أو حلقة، وتحصين وسائل الإعلام 20 مل معقم LB مع 10 ميكروغرام / مل ح، و 20 ميكروغرام / مل سم. إبقاء المنطقة العقيمة والعمل بالقرب من اللهب. تنمو الخلايا O / N عند 32 درجة مئوية مع اهتزاز عند 200 دورة في الدقيقة.
      9. جعل 3-5 الأسهم الجلسرين من O / N عن طريق خلط 500 ميكرولتر من O / N ثقافة مع 500 ميكرولتر من معقمة 100٪ GLycerol (النهائي 50٪ ت / ت) في العقيمة البرد الأنابيب. تخزين في -80 درجة مئوية.
      10. الطرد المركزي 6-8 مل من ثقافة O / N في درجة حرارة الغرفة، 5000 x ج لمدة 3 دقائق. صب طاف واستخراج pOX38-ح Δgene :: سم بناء من بيليه استخدام البلازميد مجموعة مصغرة الإعدادية (مواد الجدول) وبروتوكول الشركة المصنعة. تخزين الحمض النووي النقي عند درجة حرارة -20 درجة مئوية.
      11. إجراء فحص التزاوج اقترانية باستخدام XK1200 خلايا دور المتلقي لتأكيد تعطيل اقتران بالضربة القاضية جين حسب بروتوكول 3.1.
    2. DY330R pOX38-ح Δgene :: سم + pK184 الجينات
      1. تحويل خلايا DY330R pOX38-ح Δgene :: سم electrocompetent مع 300 نانوغرام للبناء pK184 الجينات عبر Electroporation للوفقا لخطوات 2.1.4-2.1.7. يجب أن يحتوي على جميع وسائل الإعلام انتقائية 20 ميكروغرام / مل سم و 50 ميكروغرام / مل كم. احتضان عند 32 درجة مئوية. والبلازميد الانتعاش في خلايا electroporated الآن استعادة وظيفة الجين خرج في DY330R pOX38-ح Δgene :: خلايا سم.
      2. إعداد O / N من DY330R pOX38-ح Δgene :: خلايا المؤتلف سم + pK184 الجينات التي كتبها حصاد مستعمرة متميزة واحدة من الخلايا مع ماصة معقمة أو حلقة، وتحصين وسائل الإعلام 20 مل معقم LB مع 20 ميكروغرام / مل سم و 50 ميكروغرام / مل كم. إبقاء المنطقة العقيمة والعمل بالقرب من اللهب. تنمو الخلايا O / N عند 32 درجة مئوية مع اهتزاز عند 200 دورة في الدقيقة.
      3. جعل 3-5 الأسهم الجلسرين من O / N عن طريق خلط 500 ميكرولتر من O / N ثقافة مع 500 ميكرولتر من معقمة 100٪ الجلسرين (النهائي 50٪ ت / ت) في العقيمة البرد الأنابيب. تخزين في -80 درجة مئوية.
      4. أيضا تنفيذ بروتوكول 3.1 لتوليد XK1200 pOX38-ح Δgene :: سم خلايا المؤتلف.
    3. XK1200 pOX38-ح Δgene :: سم + pK184 الجينات والمسوخ
      1. إعداد خلايا electrocompetent XK1200 pOX38-ح Δgene :: سم (من الخطوة 2.2.4).
      2. بشكل منفصل electroporate 300 نانوغرام من pK184 الجينات أو pK184 الجينات الطافرة البلازميدات إلى 50 ميكرولتر من ايلىctrocompetent XK1200 pOX38-ح Δgene :: خلايا سم حسب الخطوات 2.1.4-2.1.7. يجب أن يحتوي على جميع وسائل الإعلام انتقائية 10 ميكروغرام / مل حمض الناليديكسيك (نال)، و 20 ميكروغرام / مل سم، و 50 ميكروغرام / مل كم ويتم حضنت عند 37 درجة مئوية.
      3. إعداد O / N من XK1200 pOX38-ح Δgene :: خلايا المؤتلف سم + pK184 الجينات التي كتبها حصاد مستعمرة متميزة واحدة من الخلايا مع ماصة معقمة أو حلقة، وتحصين وسائل الإعلام 20 مل معقم LB مع نال 20 ميكروغرام / مل سم و 50 ميكروغرام / مل كم. إبقاء المنطقة العقيمة والعمل بالقرب من اللهب. تنمو الخلايا O / N عند 37 درجة مئوية مع اهتزاز عند 200 دورة في الدقيقة.
      4. جعل 3-5 الأسهم الجلسرين من O / N عن طريق خلط 500 ميكرولتر من O / N ثقافة مع 500 ميكرولتر من معقمة 100٪ الجلسرين (النهائي 50٪ ت / ت) في العقيمة البرد الأنابيب. تخزين في -80 درجة مئوية.

    3. اقترانية التزاوج فحوصات

    1. اقترانية التزاوج لتوليد خلايا XK1200 pOX38-ح Δgene :: سم
      1. إعداد 20 مل معقم LB O / N طريق مسدودالبنية من DY330R pOX38-ح Δgene :: خلايا سم + pK184 الجينات باستخدام ماصة معقمة أو حلقة لتطعيم 20 مل معقم LB تحتوي على 20 ميكروغرام / مل سم و 50 ميكروغرام / مل كم مع مخزون الجلسرين أو مستعمرة واحدة على لوحة أجار. ينمو بمعدل 32 درجة مئوية مع اهتزاز عند 200 دورة في الدقيقة. إعداد نفسه لXK1200 الخلايا في 20 مل معقم LB مع 10 ميكروغرام / مل نال، وتزايد عند 37 درجة مئوية.
      2. جعل 1:70 التخفيفات من كل ثقافة على حدة في 2 مل من معقم LB مع نفس المحتويات للمضادات الحيوية. إضافة الجلوكوز إلى تركيز النهائي من 100 ملم إلى جميع الخلايا المانحة. تنمو الخلايا إلى مرحلة منتصف السجل (OD 600 0،5-0،7) عند 37 درجة مئوية مع اهتزاز عند 200 دورة في الدقيقة.
      3. أجهزة الطرد المركزي (4000 x ج لمدة 5 دقائق في 4 درجات مئوية) لتكوير الخلايا، تجاهل طاف، ويغسل مرة واحدة مع LB معقم البارد لإزالة المضادات الحيوية، والخلايا resuspend في 2 مل LB. عقيمة البرد
      4. قسامة 100 ميكرولتر من كل ثقافة إلى 800 ميكرولتر من وسائل الاعلام LB العقيمة والسماح لهم للتزاوج في 32 درجة مئوية لمدة 1 ساعة دون أن تهتز.
      5. <لى> دوامة الخلايا لمدة 30 ثانية لعرقلة أزواج التزاوج ووضعها على الجليد لمدة 10 دقيقة لمنع المزيد من التزاوج.
      6. قسامة 100 ميكرولتر من خليط الخلية على لوحة أجار التي تحتوي على 10 ميكروغرام / مل نال و 20 ميكروغرام / مل سم لتحديد الخلايا XK1200 pOX38-ح Δgene :: سم. انتشار الخلايا باستخدام رش العقيمة. إبقاء المنطقة العقيمة والعمل بالقرب من اللهب. المحتضنة لوحة O / N عند 37 درجة مئوية رأسا على عقب.
      7. حصاد مستعمرة واحدة من الجين الجديد XK1200 pOX38-ح Δ :: سم خروج المغلوب سلالة باستخدام ماصة معقمة أو حلقة وتنمو في معقم LB مع 20 ميكروغرام / مل سم، O / N في 37 درجة مئوية مع اهتزاز عند 200 دورة في الدقيقة. جعل 3-5 الأسهم الجلسرين من O / N عن طريق خلط 500 ميكرولتر من O / N ثقافة مع 500 ميكرولتر من معقمة 100٪ الجلسرين (النهائي 50٪ ت / ت) في العقيمة البرد الأنابيب. تخزين في -80 درجة مئوية.
        ملاحظة: الخلايا الناتجة أصبحت الآن قادرة على أن تدلي المختصة للتحول مع بنيات pK184 الجينات (بروتوكولات 1.3 و 1.4) للالحمارessing الجينات والطفرات على القدرة على استرداد نقل اقترانية في بروتوكول 3.2.
    2. اقترانية التزاوج الفحص من XK1200 الجهات المانحة إلى المستلمين MC4100
      1. إعداد O / ثقافة N من XK1200 pOX38-ح Δgene :: سم + pK184 الجينات الخلايا في 20 مل من معقم LB مع 20 ميكروغرام / مل سم، 50 ميكروغرام / مل كم وMC4100 الخلايا في 5 مل LB مع 50 ميكروغرام / مل الستربتومايسين (SM) باستخدام خلايا من المخزون الجلسرين أو مستعمرة واحدة على لوحة أجار ومعقمة ماصة أو حلقة. تنمو الثقافات في 37 درجة مئوية مع 200 دورة في الدقيقة تهتز.
      2. جعل 1:70 التخفيفات من كل O / N ثقافة على حدة في 2 مل من معقم LB مع نفس المضادات الحيوية. إضافة الجلوكوز إلى تركيز النهائي من 100 ملم إلى جميع الخلايا المانحة. تنمو الخلايا إلى مرحلة منتصف السجل (OD 600 0،5-0،7) عند 37 درجة مئوية مع اهتزاز عند 200 دورة في الدقيقة.
      3. أجهزة الطرد المركزي (4000 x ج لمدة 5 دقائق في 4 درجات مئوية) لتكوير الخلايا، تجاهل طاف، ويغسل مرة واحدة مع LB معقم البارد لإزالة المضاداتالتشنجات اللاإرادية، والخلايا resuspend في 2 مل LB. عقيمة البرد
      4. في نسختين، قسامة 100 ميكرولتر من كل ثقافة إلى 800 ميكرولتر من وسائل الاعلام LB العقيمة والسماح لهم للتزاوج عند 37 درجة مئوية لمدة 1 ساعة دون أن تهتز.
      5. دوامة الخلايا لمدة 30 ثانية لعرقلة أزواج التزاوج ووضعها على الجليد لمدة 10 دقيقة لمنع المزيد من التزاوج.
      6. باستخدام الثقافات منتصف سجل من الخطوة 3.2.2 ومعقم LB جديدة، وإعداد 6 التخفيفات المسلسل من الخلايا المانحة والمتلقية من 10 -2 الى 10 -7.
      7. على كل من نصفين من لوحة أجار التي تحتوي على 10 ميكروغرام / مل نال 20 ميكروغرام / مل سم و 50 ميكروغرام / مل كم، بقعة 10 مكل من كل تخفيف من XK1200 الخلايا المانحة، كما هو مبين في الشكل 2. كرر لالتخفيفات من الخلايا MC4100 المتلقي على لوحات أجار يحتوي على 50 ميكروغرام / مل ن خ. احتضان لوحات O / N عند 37 درجة مئوية.
      8. باستخدام خليط vortexed من الخطوة 3.2.5 ومعقم LB جديدة، وإعداد 6 التخفيفات (10 -2 الى 10 -7 الشكل (2). كرر لكل من الخلطات مكررة. إبقاء المنطقة العقيمة والعمل بالقرب من اللهب. احتضان لوحات O / N عند 37 درجة مئوية.
      9. تحديد كفاءة التزاوج من كل بناء كما هو موضح في بروتوكول 3.3.
      10. كرر هذا البروتوكول لجميع البلازميدات الانتعاش لتقييم تأثير طفرة معينة على كفاءة تصريف الافعال.
    3. حساب الكفاءة التزاوج
      1. حساب عدد المستعمرات من نفس اكتشاف تخفيف لكل المانحة والمتلقي وخلايا transconjugant على لوحات كل منها.
      2. عدد المستعمرات المتلقي لاختبار أي تحيز التي ستنجم عن وجود عدد أكبر من transconjugants من المتلقين في ذلك تخفيف معين.
      3. Calculate كفاءة التزاوج حيث بلغ عدد المستعمرات transconjugant مقسوما على عدد من المستعمرات المانحة. ضرب من قبل 100 إلى الحصول على قيمة الكفاءة لكل 100 الخلايا المانحة.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    عملية F يحركها البلازميد الاقتران البكتيري هي عملية منسقة الذي ينطوي على البروتينات نقل داخل المنطقة هيئة تنظيم الاتصالات من F-البلازميد التي تجمع على T4SS لتسهيل تركيب شعرة ونقل الحمض النووي اقترانية. مطلوب لتشكيل F-شعرة اقترانية، وTraF البروتين (يونيبروت معرف P14497 بنك الجينات الانضمام # BAA97961). 10،14،35 - 37 البروتين يحتوي على نطاق مثل thioredoxin C-المحطة، على الرغم من أنه لم يكن لديك عزر CXXC الحفاز. 35،38 وعلى الرغم من توقع لها أن تتفاعل مع بروتين TraH من خلال نطاق-N محطة لها، 39 منطقة أوضحت أن تكون أكثر ديناميكية من نطاق C-محطة لها، 37 ليس الكثير غير ذلك لا يعرف الكثير عن السمات الهيكلية للبروتين. لتقييم الجوانب الوظيفية للبروتين TraF بالتزامن مع الدراسات الهيكلية، ونحن طرقت أول من الجين traF على pOX38-TC عبر مثليإعادة التركيب، وتوليد البلازميد pOX38-ح ΔtraF :: سم (الجدول 1) في E. خلايا القولونية DY330R. 33،34 ولدت أيضا كان البلازميد pK184-TraF من traF الاشعال -specific (الجدول 2) لتوفير استرداد الاقتران وتمكين التحقيق تسلسل البروتين. وعندما قدمت pK184-TraF في عبر نقل البلازميد pOX38-ح ΔtraF :: سم إلى XK1200 خلايا 40 من خلايا DY330R (transconjugants نمت على 10 ميكروغرام / مل نال، 10 ميكروغرام / مل ح و 20 ميكروغرام / مل سم) إلى (أ) أن دور الستة عشر traF في pOx38-ح ΔtraF :: سم يوفر CAT كاسيت في الإطار، و (ب) يمكن أن pK184-traF استعادة وظيفة اقترانية.

    تم إنشاء سلسلة من المسوخ TraF للتحليل باستخدام اقترانية التزاوج فحص 37 باستخدام XK1200 pOX38-ح ΔtraF :: سم + pK184-TraF ΔXوالخلايا MC4100 41 إلى المانحين والمتلقين، على التوالي. واحد متحولة التمثيلي هو TraF 55-247 (الجدول 1)، ومتحولة الحذف N-المحطة التي تزيل توقعت المنطقة من البروتين للتفاعل مع TraH. عندما يتم توفير كامل طول البروتين TraF إلى الخلايا المانحة، يتم استعادة نقل اقترانية (الشكل 2)، مع توفير pK184 البلازميد فارغة لا (الجدول 3). وبالمثل، لا يتم استعادة وظيفة اقترانية في الخلايا المانحة XK1200 عندما قدمت مع البلازميد pK184-TraF 55-247 (الجدول 3). هذا يدل على أن المنطقة المقتطعة من البروتين مهم لوظيفة TraF داخل جهاز اقترانية، على الأرجح من خلال التفاعل مع TraH، ويوفر منطقة من البروتين لاستهداف لمزيد من التحليل طفرية.

    شكل 1
    في العابرة عبر البلازميد الاسترداد (pK184 الجينات). يتم نقل الناتجة pOX38-ح Δgene :: سم البلازميد سلالة XK1200 (الخطوة 2) لمزيد من التقييم من الجينات باستخدام فحوصات التزاوج مع المتلقي MC4100 (الخطوة 3). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

    الشكل 2
    الشكل 2: حصيرجي فحص لتقييم وظيفة الجين المستهدف في الاقتران. كانت خلايا المانحة والمتلقية كولاي XK1200 pOX38-ح ΔtraF :: سم تحولت مع pK184-TraF وMC4100، على التوالي. وtransconjugants الناتج (MC4100 pOX38-ح ΔtraF :: سم) تنمو على لوحات تحتوي ن خ وسم، مما يشير إلى انتعاش الناجح وظيفة اقترانية. تتم التجربة في نسختين على طبق آغار واحدة، وتستخدم التخفيفات المسلسل من أجل حساب كفاءة التزاوج من المسوخ الجينات التصالحية (الجدول 2). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

    سلالة بكتيرية / البلازميد الخصائص ذات الصلة ماركر الانتقائي (ق) مرجع
    سلالات بكتيرية
    DY330R W3110 ΔlacU169 gal490 λc1857 Δ (CRO-bioA) ريف R الريف 33،34
    XK1200 F - lacΔU124 Δ (ندى AROG غال attλ الحيوي gyrA) نال 40
    MC4100 araD139 Δ (صندوق الفرعي لاك) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR خ 41
    ناقلات والتركيبات
    pBAD33 البلازميد عن التعبير تحت من P العرباض سم 32
    pK184 2.4 كيلوبايت استنساخ ناقلات، ريبليكون p15a كم 31
    pK184-TraF </ td> F TraF من pOX38 في pK184 كم 35
    pK184-TraF 56-247 F TraF أأ 56-247 من pK184-TraF كم
    البلازميدات اقترانية
    pOX38-ح IncFI، ترا +، RepFIA +، F1 HindIII جزء من F، ميني تينيسي ح 29،30
    pOX38-ح ΔtraF :: سم pOX38-TC مع CAT إدراجها في traF ح سم 35
    † سم، الكلورامفينيكول. كم، كانامايسين. نال وحمض الناليديكسيك. الريف، ريفامبيسين، سم، الستربتومايسين. ح، التتراسيكلين
    ‡ جميع بنيات TraF تحتوي على 19 بقايا تسلسل زعيم لضمان توطين إلى الفضاء محيط بالجبلة.

    الجدول 1: سلالات القولونية والبلازميدات المستخدمة في هذه الدراسة.

    بناء التمهيدي *
    TraF-سم-ل 5'- GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC -3 "
    TraF-سم-القس 5'- TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG -3 "
    pK184-TraF-ل 5'- TTTTTT GAATTC TATGAATAAAGCATTACTGCCAC -3 "
    pK184-TraF-القس 5'- TTTTTT AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA -3 "
    pK184-TraF 55-247، للحصول على 5'- TACG CATATG ATGGCCGCACTGCAGACGG -3 "
    pK184-TraF 55-247 5'- TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA -3 "
    † الجدول مقتبس من بطيء وآخرون. 2016 35 بإذن
    * يتم المائل المناطق يخيم TraF. وأكد مواقع الانزيم تقييد (HindIII: AAGCTT، EcoRI: GAATTC، NdeI: CATATG)

    الجدول 2: قائمة الاشعال المستخدمة في هذه الدراسة.

    الجهات المانحة البلازميد † انتعاش البلازميد Transconjugants ‡ § (خلايا مل -1) التزاوج Efficiency§ ||
    pOX38-ح ΔtraF :: سم لا شيء 0 0
    pOX38-Tج ΔtraF :: سم pK184 0 0
    pOX38-ح ΔtraF :: سم pK184-TraF 5 × 10 3 0.0167
    pOX38-ح ΔtraF :: سم pK184-TraF 55-247 0 0
    * الجدول مقتبس من بطيء وآخرون. 2016 35 بإذن
    † كانت الخلايا المانحة كولاي XK1200، مع تركيز متوسط قدره 3 × 10 7 خلايا مل -1
    ‡ كانت خلايا مستلم كولاي MC4100. عدد transconjugants لمراقبة إيجابية هو من التخفيف 10-5. 0 يدل على عدم transconjugants من التخفيف 10-2.
    أجريت المتوسط ​​§An من 03:58 تجارب التزاوج لكل بناء.
    || التزاوج كفاءة definإد كما transconjugants لكل 100 الخلايا المانحة. 0 كفاءة التزاوج تشير لا transconjugants من التخفيف 10-2

    الجدول 3: كفاءة التزاوج ألغيت من قبل بنيات الحذف TraF.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    توفر عملية الاقتران البكتيري الوسائل التي يمكن للبكتيريا تنتشر الجينات توفير ميزة تطورية للنمو في البيئات الصعبة، مثل انتشار علامات مقاومة للمضادات الحيوية. لأن الكثير من البلازميدات اقترانية هي كبيرة جدا، 12 دراسة وظيفية على البروتينات المشاركة في تجميع جهاز نقل من خلال تحور الجينات المستهدفة على البلازميد اقترانية نفسها هي غير عملي. البروتوكولات بالتفصيل هنا توفر الوسائل التي يمكن للمرء أن تقييم بسهولة أكبر على الجينات المستهدفة من الفائدة من خلال استخدام، البلازميدات التعبير أكثر قابلية للإدارة الصغيرة (الشكل 1). نحن نوظف البلازميد F مشتق pOX38-ح (الجدول 1) لدراسة F بوساطة البلازميد الاقتران. البلازميدات اقترانية أخرى يمكن دراستها باستخدام البروتوكولات بالتفصيل هنا والبلازميدات مشتقة المناسبة. وقد تم تكييف المقايسات التزاوج الواردة من فروست والزملاء، 42 مع بعض modificatiالإضافات. في دراسات سابقة، وقد تحقق 8،33،42 إنشاء بناء pOX38-ح Δgene :: سم من الشق الجينات في المصالح مع الانزيمات تقييد المناسبة وإدخال الكاسيت CAT تضخيمها إلى pOX38-ح. 42 في الطريقة الحالية، ونحن توظيف إعادة التركيب مثلي في recombineering كولاي سلالة DY330R 33،34 لخروج المغلوب الجينات المستهدفة واستبدالها الكاسيت اتفاقية مناهضة التعذيب. هذا له ميزة تسمح للسلالة DY330R الناتجة إيواء pOX38-ح Δgene :: سم بناء ليكون بمثابة مراقبة لدور الستة عشر جينات محددة من F-T4SS بوساطة نقل اقترانية عبر انتعاش النقل باستخدام pK184 الجينات الانتعاش البلازميد . في حين أنه قد يكون من الممكن توليد بالضربة القاضية باستخدام منهجية هش-Cas9، 43 ليس لدينا في هذا الوقت استكشاف هذا الاحتمال.

    وتبدأ عملية توليد بالضربة القاضية جين في F البلازميد مشتق pOX38-ح (شملت رقمه 1). ويتحقق ذلك عن طريق إعادة التركيب مثلي في الخلايا DY330R (الجدول 1)، والسلالات الأخرى مع ميزات مشابهة مثل DY329، DY331 وDY378 يمكن أن تستخدم أيضا. تم تصميم الاشعال في البداية إلى PCR تضخيم كاسيت CAT من البلازميد pBAD33 32 واحتواء يخيم على القواعد التي هي محددة لهذا الجين الهدف (الجدول 2). ثم يتم electroporated المنتج PCR إلى خلايا DY330R إيواء pOX38-ح. إعادة التركيب مثلي يولد خروج المغلوب البلازميد pOX38-ح Δgene :: سم حيث يتم إدراج كاسيت CAT في الإطار داخل الجين المستهدف، وتعطيل التجمع T4SS والتصريف بشكل فعال مع توفير مقاومة سم. في الوقت نفسه، فإن الجين المستهدف هو PCR تضخيمها من pOX38-ح وإدخالها في التعبير البلازميد الصغيرة؛ في هذا البروتوكول نستخدم pK184 للتعبير التأسيسية، ولكن يمكن للمرء أن اختار البلازميد مع التعبير محرض من الجين المستهدف إذا رغبت في ذلك. ثم يتم تحويل البلازميد pK184 الجيناتإلى خلايا DY330R pOX38-ح Δgene :: سم، ويتم بعد ذلك استخدام هذه الخلايا الجهات المانحة لنقل pOX38-ح Δgene :: سم بناء عن طريق الاقتران في XK1200 الخلايا لفحوصات التزاوج. في المقايسات التزاوج، والخلايا المانحة والمستفيدة هي XK1200 pOX38-ح Δgene :: سم وMC4100، على التوالي. يتم توفير الانتعاش البلازميد pK184 الجينات، فضلا عن سلسلة طفرات في الجين المستهدف (الحذف أو طفرات نقطة)، إلى الخلايا المانحة لتقييم قدرتها على استعادة التزاوج، وتحديد كفاءتها، مع خلايا MC4100 المتلقي (الشكل 2 ، الجدول 3).

    الحرجة لهذا الإجراء هو استخدام المانحة المناسب وسلالات المتلقي (الجدول 1)، وتصميم الاشعال المستخدمة. لكل التمهيدي تصميم، هناك مبادئ توجيهية العامة التي ينبغي اتباعها. في الوقت الذي نحاول بدقة على الالتزام مع محتوى GC 40-60٪، وهذا قد لا يكون من الممكن دائما. في مثل هذه الحالات، هو تقدير المجرب لاختبار التمهيدي ثمحتوى GC إيث أقل بقليل أو أعلى من هذا النطاق. ويجب أن تكون درجة حرارة انصهار (T م) من التمهيدي إلى الأمام وعكس مماثل، ودرجة الحرارة الصلب (T أ) قيمة ينبغي أن يكون دائما أقل من T م من 2-5 درجة مئوية لمدة PCR. الطاقة الحرة المتاحة للسماح لمنعطف حاد لتطوير ينبغي أن يكون أقل بكثير من تي لذلك، في حين أن هومو والمغاير dimerization T م الصورة يجب أن تكون منخفضة جدا (أقل من -10 كج و 30 درجة مئوية). الاشعال يمكن أن تكون مصممة لتحقيق الحذف، الإدراج أو الطفرات نقطة كما تريد. وبالطبع فإنه من الأهمية بمكان أن بناء الجينات الناتجة يتم تضخيمه وligated إلى البلازميد الانتعاش في الإطار بحيث يتم التعبير عن ذلك بشكل صحيح. تحول الخلايا المختصة ويمكن أن يتم عن طريق Electroporation للأو الحرارة صدمة باستخدام خلايا electrocompetent أو المختصة كيميائيا، على التوالي. نجد أن Electroporation للهو أكثر كفاءة ليبني أكبر مثل pOX38-ح وoligonucle إعادة التركيب مثليotide، في حين أن التعبير البلازميدات أصغر مثل pK184-TraF يمكن أن تتحول بسهولة إلى الخلايا باستخدام أساليب الصدمة الحرارية. وأخيرا، من المهم أن نتذكر أنه لن يكون هناك مضادات حيوية متعددة في استخدام في جميع أنحاء البروتوكول، كما تتطلب من المانحين والمستفيدين السلالات المقاومة المختلفة التي تختلف عن تلك المستخدمة في اقترانية والانتعاش البلازميدات.

    وبصرف النظر عن التقنيات المقايسات التزاوج الموصوفة هنا، هناك طرق أخرى التي تستخدم لدراسة الاقتران البكتيري، تتفاوت قليلا في نهجها. نقل الجينات الأفقي هو عملية حيث نقل البكتيريا البلازميد إلى الخلية المستقبلة، بما في ذلك المتلقين بين الأنواع. 44 دراسة من قبل داهلبرغ وزملاؤه 44 على سبيل المثال تستخدم الاقتران البكتيري لتحديد مدى بين الأنواع نقل الجينات الأفقي. أنها تستخدم دمج البروتين الفلوري الأخضر (GFP) إلى البلازميد المستنسخة في خلايا KT2442. في الكروموسومات لميلان أنا ف الجينات في الخلايا KT2442 قمع التعبير GFP. عندما يتم نقل GFP تحمل البلازميد الأنواع دون الجين ف لاك الأول، لوحظ مضان. 44 على الرغم من محدوديته لتوفير البروتين وظيفة محددة في مختلف الأنواع، يمكن ربما أن يقترن التجربة بين الأنواع الاقتران مع البروتوكولات المعروضة هنا لتقديم تنبؤات التطورية للتفاعل البروتين البروتين بين الأنواع المختلفة.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    الكتاب تعلن أنه ليس لديهم مصالح مالية المتنافسة.

    Acknowledgments

    وأيد هذا البحث من قبل منحة ديسكفري من العلوم والهندسة مجلس الطبيعية في كندا (NSERC).

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics