Конъюгативных Спаривание Анализы для последовательности конкретного анализа переноса белков, участвующих в конъюгации бактерий

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Перенос генов и белков на микро-организменном уровне играет центральную роль в выживаемости бактерий и эволюции, а также инфекционных процессов. Обмен ДНК между бактериями или между бактерией и клеткой может быть достигнуто с помощью трансформации, конъюгации или вектором трансдукции. 1,2 Сопряжение уникальна по сравнению с трансформацией и трансдукции в том , что при конъюгации между грамотрицательных бактерий , таких как кишечная палочка, перенос ДНК происходит в донорной-контролируемым способом , посредством которого комплекс макромолекулярная система соединяет донора и реципиента клетки. Сопряжение также самый прямой путь, в котором бактериальные клетки взаимодействуют с клетками-хозяевами, чтобы ввести гены, белки или химические вещества, чтобы хост-системах. 3 Довольно часто, передача таких агентов имеет замечательные эффекты на хозяина, начиная от патогенеза и канцерогенеза провести эволюцию и адаптацию. Было показано, что конъюгативная recombinatioп увеличивает скорость адаптации в 3 раза у бактерий с высоким уровнем мутаций в условиях экологического стресса. 4 Кроме того, конъюгация на сегодняшний день является наиболее распространенным путем , через который гены устойчивости к антибиотикам в бактериальных штаммов рассредоточены. 5,6

Микроорганизмы развивались специализированные системы секреции для поддержки передачи макромолекул через клеточные мембраны; Есть в настоящее время 9 типов систем секреции (ЦСС) в грамотрицательных бактерий, которые были описаны: T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS, а также Sec (секреции) и Tat (два-Аргинин транслокации) пути. 7,8 Каждый тип системы секреции дополнительно делится на различные подтипы, необходимость из - за разнообразия белков и своеобразия путей , участвующих в различных бактериальных штаммов. Например, в системе секреции IV типа (T4SS), системы Ti и CAG облегчают эффекторной транспорт в то время как F-плазмиды, Р27й pKM101 T4SSs облегчают передачу конъюгативной плазмиды. 7,9,10 Детальное понимание механизмов , с помощью которых организмы собирают свои системы секреции из их составных белков и разделяют клеточное содержимое с получателем или их окружающей среды является важным фактором в развитии целевых стратегий борьбы с патогенными микроорганизмами и процессы клеточная инфекция.

После первоначальной идентификации конъюгации бактерий в E.coli путем Ледербергом & Tatum, 11 большое количество мобильных и конъюгативных плазмид были идентифицированы и охарактеризованы. 12 Такие мобильные плазмид показывают значительный диапазон размеров (от 1 до более чем 200 т.п.н. (КБ)), однако все мобильные плазмиды содержат relaxase, признающей происхождение передачи (ОРИТ) , тем самым позволяя передачу плазмиды. Конъюгативных плазмид дополнительные гены кодируют для сборки функционального T4SS, а также типIV соединительный белок. 12 Например, 100 кб F плазмиды E.coli , кодирует все конъюгативных гены в пределах 33,3 кБ передачи (TRA) области. 13 Гены ТНС области плазмиды закодировать F все белки , которые способствуют образованию фимбриевый, присоединительными образования пар (MPF), перенос ДНК и функции исключения во время конъюгативного переноса плазмиды. 10,14,15 Значительный объем знаний доступен для конъюгативной T4SSs, однако подробно Структурные исследования конъюгативных белков и комплексов только в последнее время становятся доступными. 16 - 28

Для того, чтобы собрать полное представление о конъюгативной процесса, соединительное детальных структурных исследований для мутационный анализ конъюгативных белков переноса требуется. Это может быть достигнуто с помощью конъюгативных сопрягаемых анализов. Для получения плазмиды F, каждый белок , кодируемый в пределах области тра играет определенную роль в F-опосредованного соnjugation; поэтому, нокаута / удаление гена переноса отменит конъюгативных способность клетки (рисунок 1). В то время как более мелкие мобильные Плазмиды являются более благоприятными для стандартных процедур, удаление, для больших конъюгативных плазмид, таких как F, нокаут гена более легко достигается с помощью гомологичной рекомбинации, где ген-мишень заменен одним передать отчетливое ген устойчивости к антибиотику. В текущем протоколе, мы используем гомологичной рекомбинации, чтобы заменить ген переноса интереса с хлорамфениколацетилтрансферазы (CAT) в 55 кб F плазмиды производное pOX38-Tc; 29,30 результирующая Нокаут плазмиду pOX38-Tc Δgene :: Cm, способствует устойчивости к наличию хлорамфеникола (Cm) в ростовой среде. Донорские клетки, несущие pOX38-Tc Δgene :: Cm не могут влиять на конъюгативного переноса ДНК / спаривание, как наблюдаемое за счет использования пробирного сопрягаемой; эффективность спаривание донора клетки pOX38-Tc Δgene :: Cm и нормальный Recipнике, будет уменьшаться или, чаще, быть отменена. Конъюгативных перенос плазмиды pOX38-Tc Δgene :: Cm может быть восстановлен с помощью небольшой плазмиды восстановления укрывает целевого гена переноса. Это восстановление плазмида может быть тот , который обеспечивает конститутивную экспрессию, такой как плазмида pK184 (pK184-гена), 31 или тот , который обеспечивает индуцируемой экспрессии до тех пор , как плазмида правильно ориентирована ген на правильное расположение внутри клетки (цитоплазме или периплазмы). Следовательно, в брачных анализах между этим новым донором (укрывательство pOX38-Tc Δgene :: Cm + pK184-гена плазмид) и клетку-реципиент, эффективность спаривание, как ожидается, восстановление до почти у нормального донора и реципиента сопрягаемой анализа. Эта система дает возможность исследовать функцию выбиты гена через поколение серии pK184-генных конструкций (делеции или точечные мутации) и тестирование способности каждой конструкции, чтобы восстановить брачный потенциал укрывательство pOX38-Tc Δgene :: Cm донор клетокs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Получение ДНК-конструктов

  1. Проектирование олигомеров для гомологичной рекомбинации гена - мишени
    1. Конструкция одного 55-72 п.н. вперед олигомера следующим образом: (а) получить длинную последовательность нуклеотидов 19-32 п.н., которая является гомологичной последовательности ДНК, в область 10-100 п.н. выше стартового сайта 5'-гена хлорамфеникол-ацетилтрансферазы в коммерческой плазмиды pBAD33, 32 и (б) выбор 36-54 пар оснований нуклеотидов , гомологичную а в области 10-150 пар оснований ниже по течению от сайта инициации 5' - гена - мишени интерес.
      1. Присоединяйтесь к 'концу нуклеотидной последовательности определена (б) 5' 3-й конец нуклеотидной последовательности определена (а), что дает одну длинную 55-72 вперед олигомера.
    2. Разработка единого олигомер обратного 55-72 б.п. следующим образом: (а) получить длинную последовательность нуклеотидов 19-32 п.н., которая является гомологичной последовательности ДНК в области 10-100 б.п. вниз по течениюиз 3'-конца гена хлорамфеникол в коммерческой плазмиды pBAD33, и (б) выбрать 36-54 п.н. нуклеотидную последовательность, гомологичную области в пределах 10-150 пар оснований против хода транскрипции от 3'-концевого участка гена-мишени представляющего интерес ,
      1. Присоединяйтесь к 'концу нуклеотидной последовательности определена (б) 5' 3-й конец нуклеотидной последовательности определена (а), чтобы сделать его один олигомер.
      2. Скопируйте этот олигомер в любое доступное программное обеспечение биоинформатики и преобразовать последовательность в ее обратной комплементарной. Это даст единственный 55-72 п.н. обратный олигомера.
    3. Используя любую доступную программу олиго-анализатор, убедитесь , что рекомбинация олигомеры имеют содержание GC между 40-60%, температура плавления низкая шпилька (Т м), низкой само- и гетеро-димеризации Тпл 's. Заказ праймеров для синтеза и отгрузки из любой предпочтительной компании биотехнологии.
  2. Усиление CAT кассеты из pBAD33 (Cm R
  3. Вырастить в течение ночи (O / N, 16-18 ч) культуры клеток DH5 & alpha, несущих плазмиду pBAD33 в стерильной лизогении бульона (LB) с 20 мкг / мл хлорамфеникола (см) при встряхивании со скоростью 200 оборотов в минуту и ​​температуре 37 ° С.
  4. Центрифуга 6-8 мл культуры O / N при комнатной температуре, 5000 мкг в течение 3 мин. Слейте супернатант и извлечения плазмиды pBAD33 из гранул с использованием плазмиды мини-Prep Kit (Материалы таблицу) и протокол производителя.
  5. У дайджеста плазмидной ДНК pBAD33 добавлением следующей строки в стерильную пробирку в указанном порядке: соответствующий объем бидистиллированной воды (DDH 2 O) до конечного объема 50 мкл, объем 1 мкг pBAD33 плазмиды, 5 мкл 10х фермент реакционный буфер, и 0,5 мкл Avai фермента рестрикции (RE). Осторожно перемешать с помощью пипетки и позволить реакции протекать в течение 1 ч при 37 ° С. Тепло инактивировать реакционную смесь в течение 20 мин (мин) при 80° С. Образцы хранить при температуре -20 ° С в течение не более чем 24 часов, чтобы свести к минимуму деградацию липким класса.
  6. Готовят 1,2% агарозы, разделяющий гель смешиванием 1,2 г агарозы 100 мл 1x TAE (40 мМ Трис, рН 8,5, 20 мМ уксусной кислоты; 1 мМ ЭДТА) буфере в колбу объемом 250 мл Эрленмейера. Тепло и вихрем, чтобы полностью растворить в микроволновой печи. Немедленно прекратите нагрев, когда жидкость начинает кипеть и вихрем колбу.
    1. Охладить жидкость агарозы в течение 3 мин при комнатной температуре, в то время как закрученной, добавляют по 2 мкл 10 мг / мл этидий-бромида и завихрения для смешивания. Налейте агарозы в поднос геля с гребнем скважины и позволяют ему затвердеть в течение 1 ч при комнатной температуре. Хранить гели при температуре 4 ° С в течение до 2-х дней в буфер 1x TAE.
  7. Смешайте каждый RE переваривать из 1.2.3 с 0,2 объема загрузки ДНК красителя (10 мкл красителя на 50 мкл реакции) с помощью пипетки. Нагрузка 5 мкл 500 мкг / мл ДНК трапа в первую лунку и все смеси, RE-дайджеста красителя в другой скважине на аgarose гель. Используйте 2-3 скважины, чтобы загрузить все реакционного объема на гель.
    1. Выполнить гель едва погруженной в 1x TAE буфер и работающий на 45-50 V (4,5-5 В / см) в течение 65 мин в гель-электрофореза устройства.
  8. С помощью УФ-шкаф и стерильный бритву, быстро перерезал 2,8 т.п.н. полосу, которая соответствует последовательности CAT из геля, чтобы свести к минимуму воздействие УФ-ДНК. Извлечение ДНК из вырезанного геля среза с использованием набора для экстракции из геля (Материалы таблицу) в соответствии с протоколом производителя.
    Примечание: Следите за тем, чтобы не подвергать кожу непосредственно под УФ и обрабатывать бритву с осторожностью.
  9. Amplify КОШКИ кассету, извлеченную из 1.2.6 с помощью полимеразной цепной реакции (ПЦР) с использованием праймеров, сконструированных в 1.1, которые содержат свесов, гомологичных последовательности гена, чтобы позволить гомологичной рекомбинации. ПЦР - реакции устанавливаются на льду с использованием руководящих принципов изготовителя (Материалы таблицу) в следующем порядке:
    1. вСтерильный ПЦР - пробирку, добавьте соответствующий объем DDH 2 O до конечного объема 50 мкл, а затем 10 мкл ПЦР буфера, 1 мкл 10 мМ дНТФ, 2,5 мкл 10 мкМ Прямой праймер, 2,5 мкл 10 мкМ обратного праймера , 1-25 нг матричной ДНК из 1.2.6 и 0,5 мкл 100 ед / мкл полимеразы ДНК.
    2. Установка отрицательного контроля, который несет в себе те же компоненты, как 1.2.7.1, но за исключением матричной ДНК. Используйте соответствующий объем DDH 2 O вместо матричной ДНК. Настройка положительного контроля с использованием ДНК-матрицы и праймеров, которые были доказаны, чтобы работать в ПЦР-реакции, такие, как те, которые предусмотрены в качестве положительного контроля изготовителем.
    3. Смешайте все содержимое реакции осторожно пипеткой.
    4. Amplify с помощью ПЦР с использованием следующих параметров: начальная денатурация в течение 30 сек при 98 ° С, 30 циклов денатурации в течение 10 секунд при 98 ° С, отжига праймеров в течение 20 сек, расширение в течение 20 с на килобаза от ампликона при 72 ° С и плавникAl расширение в течение 10 мин при 72 ° С. Образцы хранить при температуре -20 ° С.
  10. Подтвердите правильный размер амплификации с помощью электрофореза в агарозном геле (см 1.2.4-1.2.5), используя только 5 мкл каждой реакции. Очищают ампликона ПЦР с использованием набора для очистки ПЦР и протокол производителя. Хранить очищают ДНК при температуре -20 ° С.
  • PK184-ген восстановления Плазмида
    1. Конструкция прямого праймера, начиная с его 5'-конца и происходит в направлении 3'-конца в следующем порядке: (а) выбрать 4 случайных нуклеотида (сочетание аденин, тимин, гуанин и цитозин), для эффективности расщепления, присоединенные к (б) EcoRI-рестрикционных ферментов (RE) последовательность вырезать участок (GAATTC), а затем (в) 21-25 пар оснований нуклеотидной последовательности, которая является гомологичной 5'-концу гена интереса, в том числе стартовый кодон,. Если ген-мишень содержит сайт EcoRI, выберите другой подходящий RE из pK184 сайт множественного клонирования.
    2. В случае генов, кодирующих белки периплазмической, включают дополнительную основную последовательность между сайтом RE и старт-кодоном на прямой праймер.
    3. Используя любой доступный олиго-анализатор, проверьте , что праймеры имеют содержание GC между 40-60%, низкий шпилька T м, низкой само- и гетеро-димеризации Тпл 's. Заказ праймеров для синтеза.
    4. Вырастить O / N культуре клеток DY330R pOX38-Tc в стерильный LB, содержащей 10 мкг / мл тетрациклина (Tc) при встряхивании при 32 ° С и 200 оборотах в минуту. Центрифуга 6-8 мл культуры O / N при комнатной температуре, 5000 мкг в течение 3 мин. переливатьсупернатант и экстракции плазмидной ДНК из гранул с использованием плазмиды мини-Prep Kit (Материалы таблицу) и протокол производителя.
    5. Amplify полный интерес ген с грунтами от 1.3.1-1.3.5 использованием pOX38-Tc в качестве матрицы (см 1.2.7.1-1.2.7.3).
    6. Подтвердите правильный размер амплификации с помощью электрофореза в агарозном геле (см 1.2.4-1.2.5), используя только 5 мкл каждой реакции. Очищают амплифицированной ДНК с использованием набора для очистки ПЦР и протокол производителя. Хранить очищенной ДНК при -20 ° С.
    7. Сделайте двойной дайджеста как коммерчески доступного pK184 плазмидной ДНК и усиливаемого гена (от 1.3.7.), Добавив следующую строку в стерильную пробирку в указанном порядке: соответствующий объем DDH 2 O до конечного объема 50 мкл , 1 объем мкг плазмиды pK184, 5 мкл 10х буфера фермента реакции, и 1 мкл каждого EcoRI и Hind III.
      1. Аккуратно перемешать с помощью пипетки и пусть реакция протекать в течение 1 чпри температуре 37 ° С. Тепло инактивировать реакционной смеси в течение 20 мин при 80 ° С. Образцы хранить при температуре -20 ° С в течение не более чем 24 часов, чтобы свести к минимуму деградацию липким класса.
        Примечание: Тип рестрикционные используемый здесь, зависит от сайта рестрикции нуклеазная, что было спроектировано в праймеры на этапах 1.3.1 и 1.3.2.
      2. В качестве положительного контроля, установить одиночные дайджесты плазмиды pK184, подготовив такую ​​же реакцию, как в 1.3.8, за исключением того, добавить только один из УЭ в реакционной трубке. Делайте это по отдельности с обоими УЭ.
    8. Запуск дайджестов на агарозном геле 1,2% с использованием протоколов 1.2.4-1.2.5 Извлечение ДНК двойного переваривания фрагменты обоих pK184 и гена интерес согласно пункту 1.2.6.
    9. Лигирования гена вставляется в вектор pK184 путем добавления компонентов в стерильную пробирку в следующем порядке: 2 мкл 10X T4 ДНК-лигазы буфера, в общей сложности на 100 нг ДНК, состоящую из 1: 3 вектор: вставка (pK184: ген) отношение, DDh 2 O с точностью дообщий объем 20 мкл и 1 мкл ДНК-лигазы Т4. В качестве отрицательного контроля, установить аналогичную реакции с использованием 100 нг вектора без гена вставки.
      1. Аккуратно перемешать все содержимое реакции с использованием микропипетки и инкубировать в течение 30 мин при 25 ° С. Тепло-инактивировать реакции лигирования в течение 10 мин при 65 ° С, а затем поместить на лед.
    10. В то время как на льду, добавляют 15 мкл pK184-гена Реакцию лигирования с этапа 1.3.10 к 100 мкл химически компетентных клеток DH5 & alpha в стерильном 1,5 мл трубки. Осторожно перемешать с помощью пипетки и инкубировать на льду в течение 10 мин. Сделайте то же самое для отрицательного контрольного образца. Для положительного контроля используют 20-100 нг плазмиды такой как pBAD33 и превратить его в 50 мкл DHα клеток.
    11. Непосредственно передавать образцы из льда в С водяную баню 42 ° и инкубировать в течение 90 секунд. Это обеспечивает клеткам теплового шока и позволяет им поглощать плазмидной ДНК.
    12. Место клетки обратно на льду на другой5 мин и затем добавляют 900 мкл стерильной LB. Инкубируют при 37 ° С в течение 1 ч при встряхивании при 125 оборотах в минуту.
    13. Алиготе объемом 100 мкл образца из каждой реакции лигирования в 1.3.13 на агаровой пластине, содержащей 50 мкг / мл канамицина (Km) и распределили клетки с помощью стерильной шпателя. Положительный контроль пластины должны иметь соответствующие антибиотики. Держите область стерильной и работать рядом с пламенем. Инкубируйте планшет вверх дном при 37 ° С в течение ночи.
    14. С помощью стерильной пипетки или петлю, собрать единую отчетливую колонию клеток и инокуляции 20 мл стерильного LB с 50 мкг / мл Km. Держите область стерильной и работать рядом с пламенем. Grow клетки O / N при 37 ° C при встряхивании со скоростью 200 оборотов в минуту.
    15. Сделать 3-5 запасы глицерина трансформированных клеток DH5 & alpha путем смешивания 500 мкл O / N культуры с 500 мкл стерильной 100% глицерина (конечная 50% об / об) в стерильных крио-пробирки. Хранить при температуре -80 ° С.
    16. Кроме того, центрифуга 6-8 мл O / N культура при комнатной температуре, 5,000 мкг в течение 3 мин. Слейте супернатант и извлечения pK184-гена плазмиды восстановления из гранул с использованием плазмиды мини-Prep Kit (Материалы таблицу) и протокол производителя.
  • pK184 - ген Мутанты
    Примечание: Грунтовки, предназначенные для делеции, вставки и / или точечных мутаций могут быть легко получены с использованием доступных инструментов онлайн-производителей.
    1. Конструкция каждого прямого праймера, выбирая длиной в нуклеотидной последовательности 18-32 п.н., которая является гомологичной 5'-концу гена интереса, в том числе стартовый кодон,. Дизайн праймеров таким образом, что каждый прямой праймер отжиги 30-180 б.п. ниже предыдущего, что приводит к делеции мутантов, лишенных N-концевых пептидных фрагментов соответствующей длины.
    2. Конструкция обратного праймера, выбирая собой длинную последовательность нуклеотидов 18-32 пар оснований, гомологичный 3'-концу гена, представляющего интерес, в том числе и стоп-кодон. Скопируйте этот праймер впу Программа доступна биоинформатики и преобразовать последовательность в ее обратной комплементарной. Это обратный праймер.
      1. В случае генов, кодирующих периплазмической белки, дизайн обратного праймера, который является обратным дополнением 'концу лидерной последовательности, которая фланкирует 5' 3'-концу гена, и необходим для правильной локализации белкового продукта в периплазме.
    3. Используя любую доступную программу олиго-анализатор, убедитесь , что удаление праймеров имеют содержание GC между 40-60%, температура плавления низкая шпилька (Т м), низкой само- и гетеро-димеризации Тпл 's. Заказ праймеров для синтеза и отгрузки из любого доступного биотехнологической компании.
    4. Используя конструкцию pK184-гена , полученного в Протоколе 1.3 в качестве шаблона и руководящих принципов в 1.2.7-1.2.8, ПЦР - амплификации делеции конструкции с использованием праймеров , разработанных на этапах 1.4.1-1.4.3 для генерации pK184-гена ампликонов ? X , Магазин амплифицировали ДНК длинойт -20 ° C.
    5. Перевязывать усиленную конструкцию с использованием любого доступного набора для мутагенеза (Материалы таблицу).
    6. Преобразование каждого из ligates pK184 ? X-генов отдельно в химически компетентные клетки DH5 & alpha с использованием стандартного протокола теплового шока (см 1.3.11-1.3.13).
    7. Алиготе объемом 100 мкл образца из каждой реакции лигирования в 1.4.12 на агаровой пластине, содержащей 50 мкг / мл Km, и распределили клетки с помощью стерильной шпателя. Держите область стерильной и работать рядом с пламенем. Инкубируйте планшет вверх дном при 37 ° С в течение ночи.
    8. С помощью стерильной пипетки или петлю, собрать единую отчетливую колонию клеток и инокуляции 20 мл стерильного LB среды с 50 мкг / мл Km. Держите область стерильной и работать рядом с пламенем. Grow клетки O / N при 37 ° C при встряхивании со скоростью 200 оборотов в минуту.
    9. Сделать 3-5 запасы глицерина трансформированных клеток DH5 & alpha путем смешивания 500 мкл O / N культуры с 500 мкл стерильной 100% глицерина (FInal 50% об / об) в стерильных крио-пробирки. Хранить при температуре -80 ° С.
    10. Центрифуга 6-8 мл культуры O / N при комнатной температуре, 5000 мкг в течение 3 мин. Слейте супернатант и извлечь ген плазмиду ? X pK184 построить из гранул с использованием плазмиды мини-Prep Kit (Материалы таблицу) и протокол производителя. ДНК Хранить при температуре -20 ° C.
  • 2. Генерация pOX38-Tc Δgene :: Cm Штаммы

    1. DY330R pOX38-Tc Δgene :: Cm нокауты
      1. Приготовьте O / N культуре клеток DY330R pOX38-Tc в 10 мл стерильного LB, содержащей 10 мкг / мл Tc. Grow культуры O / N при 32 ° C и 200 оборотов в минуту.
      2. Сделать 1:70 разбавление O / N культуры в 20 мл свежей стерильной LB. Растут клетки при 32 ° С до середины логарифмического (OD 600нм 0,4-0,6) роста.
      3. Передача 10 мл культуры в стерильную колбу и инкубировать при 42 ° С в течение 15 мин при 150 оборотах в минуту в покиванием ба водыго. Это будет стимулировать экспрессию рекомбинации специфических белков в DY330R.
      4. Холод культуры в ледяной водяной бане в течение 10 мин. Готовят Электрокомпетентные клетки следующим образом.
        1. Передача охлажденные клетки в предварительно охлажденные конические пробирки и центрифуге при 4000 мкг в течение 7 мин при 4 ° С. Все пробирки и пипетки, которые будут использоваться в следующих шагах должны быть размещены при 4 ° С или на льду для охлаждения.
        2. Удалить супернатант и осторожно ресуспендируют клетки в 1 мл охлажденного льдом DDH 2 O. Добавить еще 30 мл охлажденного льдом DDH 2 O.
        3. Центрифуга клетки (4000 XG, 7 мин, 4 ° C), выбросьте супернатант и осторожно ресуспендируют клеток в 1 мл охлажденного льдом DDH 2 O.
        4. Передача ресуспендировали клеток в предварительно охлажденные 1,5 мл микроцентрифужных пробирках и центрифугируют при 15000 х г в течение 1 мин при 4 ° С.
        5. Аккуратно ресуспендировали осадок в 200 мкл охлажденного на льду DDH 2 O и аликвоту в 50 мкл объемы. ElectrocompeteКлетки нт можно хранить при температуре -80 ° C
      5. Добавьте 300 нг амплифицированного CAT кассеты от 1,2 в 50 мкл электрокомпетентных клеток DY330R pOX38-Tc при перемешивании на льду, осторожно пипеткой вверх и вниз. Повторите этот шаг с использованием немодифицированного плазмиды pBAD33 в качестве положительного контроля.
      6. Передача клеток в предварительно охлажденный кювету для электропорации (-20 ° C) 1 мм. Электропорации клетки при 1,8 кВ с постоянной времени 5,5 мс, используя электропоратора. Сразу же после нанесения импульса, разбавленные клетки с 1 мл SOC сред и переносят в свежую микроцентрифужную пробирку. Инкубируйте клетки при 32 ° С в течение 2 ч.
      7. Аликвоты по 100 мкл каждого образца на чашках с агаром, содержащих 10 мкг / мл Tc и 20 мкг / мл Cm и Распределенные с помощью стерильного шпателя. Держите область стерильной и работать рядом с пламенем. Инкубируйте планшет вверх дном при 32 ° С в течение ночи, чтобы выбрать для успешных рекомбинантов. КПП кассета введена в клетку будет претерпевать гомологичную повторнокомбинация с интересующим геном и создать DY330R pOX38-Tc Δgene :: Cm (Rif R, Tc R, Cm R) клон.
        Примечание: Важно, чтобы вырастить DY330R клеток при 32 ° С, за исключением 15 мин индукции при 42 ° C на стадии 2.1.3 до генерации Электрокомпетентные клеток, продолженный рост при повышенных температурах риск гибели клеток в результате образования токсичных продуктов из L оперона р , ответственного за рекомбинации функций в DY330R. 33,34
      8. Подготовка O / N из DY330R pOX38-Tc Δgene :: клетки Cm путем сбора одного отчетливое колонию клеток с помощью стерильной пипетки или петлей, и прививка носитель 20 мл стерильного LB с 10 мкг / мл Tc, и 20 мкг / мл См. Держите область стерильной и работать рядом с пламенем. Grow клетки O / N при 32 ° C при встряхивании со скоростью 200 оборотов в минуту.
      9. Сделать 3-5 запасы глицерина из O / N путем смешивания 500 мкл O / N культуры с 500 мкл стерильной 100% этиленгликольycerol (конечная 50% об / об) в стерильных крио-пробирки. Хранить при температуре -80 ° С.
      10. Центрифуга 6-8 мл культуры O / N при комнатной температуре, 5000 мкг в течение 3 мин. Слейте супернатант и извлечь pOX38-Tc Δgene :: Cm построить из гранул с использованием плазмиды мини-Prep Kit (Материалы таблицу) и протокол изготовителя; хранить очищенную ДНК при -20 ° С.
      11. Провести анализ конъюгативных спаривании с использованием XK1200 клеток в качестве получателя для подтверждения нарушения сопряжения по нокаут гена согласно протоколу 3.1.
    2. DY330R pOX38-Tc Δgene :: Cm + pK184-гена
      1. Transform Электрокомпетентные клетки DY330R pOX38-Tc Δgene :: Cm с 300 нг конструкции pK184-гена с помощью электропорации в соответствии с шагами 2.1.4-2.1.7. Все селективные среды должны содержать 20 мкг / мл и 50 Cm мкг / мл Km. Инкубировать при 32 ° С. Плазмида восстановления в клетках электропорации теперь восстановить функцию выбиты гена в DY330R pOX38-Tc Δgene :: Cm клетки.
      2. Подготовка O / N из DY330R pOX38-Tc Δgene :: Cm + pK184-генные рекомбинантные клетки путем сбора одну отчетливую колонию клеток с помощью стерильной пипеткой или петлей, и прививка носитель 20 мл стерильного LB с 20 мкг / мл Cm и 50 мкг / мл км. Держите область стерильной и работать рядом с пламенем. Grow клетки O / N при 32 ° C при встряхивании со скоростью 200 оборотов в минуту.
      3. Сделать 3-5 запасы глицерина из O / N путем смешивания 500 мкл O / N культуры с 500 мкл стерильной 100% глицерина (конечная 50% об / об) в стерильных крио-пробирки. Хранить при температуре -80 ° С.
      4. Кроме выполнения протокола 3.1 для генерации XK1200 pOX38-Tc Δgene :: Cm рекомбинантных клеток.
    3. XK1200 pOX38-Tc Δgene :: Cm + pK184-гена и Мутанты
      1. Приготовьте клетки Электрокомпетентные XK1200 pOX38-Tc Δgene :: Cm (со стадии 2.2.4).
      2. Отдельно электропорации 300 нг pK184-гена или pK184-мутантного гена плазмид в 50 мкл Electrocompetent XK1200 pOX38-Tc Δgene :: Cm клетки как на шаги 2.1.4-2.1.7. Все селективные среды должны содержать 10 мкг / мл налидиксовой кислоты (NAL), 20 мкг / мл Cm, и 50 мкг / мл Km, и инкубировать при температуре 37 ° С.
      3. Подготовка O / N из XK1200 pOX38-Tc Δgene :: Cm + pK184-генные рекомбинантные клетки путем сбора одну отчетливую колонию клеток с помощью стерильной пипеткой или петлей, и прививка носитель 20 мл стерильного LB с Нал, 20 мкг / мл Cm и 50 мкг / мл км. Держите область стерильной и работать рядом с пламенем. Grow клетки O / N при 37 ° C при встряхивании со скоростью 200 оборотов в минуту.
      4. Сделать 3-5 запасы глицерина из O / N путем смешивания 500 мкл O / N культуры с 500 мкл стерильной 100% глицерина (конечная 50% об / об) в стерильных крио-пробирки. Хранить при температуре -80 ° С.

    3. конъюгативных Спаривание Assays

    1. Конъюгативных Спаривание для генерации XK1200 pOX38-Tc Δgene :: Cm Cells
      1. Приготовьте 20 мл стерильного LB O / N CULратуре DY330R pOX38-Tc Δgene :: Cm + pK184-генные клетки с помощью стерильной пипетки или петлю для инокуляции 20 мл стерильного LB, содержащей 20 мкг / мл Cm и 50 мкг / мл Km, с глицерином запаса или одной колонии на агар пластины. Grow при 32 ° C при встряхивании со скоростью 200 оборотов в минуту. Приготовьте то же самое для XK1200 клеток в 20 мл стерильного LB с 10 мкг / мл Нал, растет при 37 ° С.
      2. Сделать 1:70 разведений каждой культуры по отдельности в 2 мл стерильного LB с тем же содержанием антибиотика; добавить глюкозу до конечной концентрации 100 мМ для всех донорских клеток. Рост клеток в фазе середины логарифмической (OD 600 0,5-0,7) при 37 ° C при встряхивании со скоростью 200 оборотов в минуту.
      3. Центрифуга (4000 мкг в течение 5 мин при 4 ° С), чтобы осадить клетки, отбросить супернатант, промыть один раз холодным стерильным LB для удаления антибиотики и ресуспендирования клеток в 2 мл холодной стерильной LB.
      4. Алиготе 100 мкл каждой культуры в 800 мкл стерильными средами LB и дать им возможность спариваться при 32 ° С в течение 1 ч без встряхивания.
      5. <li> Vortex клетки в течение 30 секунд, чтобы разрушить пары сопрягаемых и разместить их на льду в течение 10 мин, чтобы предотвратить дальнейшее спаривание.
      6. Аликвоты по 100 мкл клеточной смеси на чашку с агаром, содержащей 10 мкг / мл Наль и 20 мкг / мл Cm, чтобы выбрать для клеток XK1200 pOX38-Тс Δgene :: Cm. Распространение клеток с помощью стерильного шпателя. Держите область стерильной и работать рядом с пламенем. Инкубируют пластины O / N при 37 ° C в обратном порядке.
      7. Заготавливают одну колонию гена нового XK1200 pOX38 Тс-Д :: Cm Штамм Нокаут с помощью стерильной пипетки или петлю и расти в стерильном LB с 20 мкг / мл Cm, O / N в 37 ° C при встряхивании со скоростью 200 оборотов в минуту. Сделать 3-5 запасы глицерина из O / N путем смешивания 500 мкл O / N культуры с 500 мкл стерильной 100% глицерина (конечная 50% об / об) в стерильных крио-пробирки. Хранить при температуре -80 ° С.
        Примечание: Полученные клетки теперь могут быть сделаны компетентным для трансформации с pK184-генных конструкций (протоколы 1.3 и 1.4) для попкуэссинга ген и его мутантов на способность восстанавливать конъюгативных передачи в протоколе 3.2.
    2. Конъюгативных Спаривание Анализ от XK1200 доноров к MC4100 реципиентов
      1. Подготовка O / N культуры XK1200 pOX38-Tc Δgene :: Cm + pK184-гена клетки в 20 мл стерильного LB с 20 мкг / мл Cm, 50 мкг / мл Км и MC4100 клеток в 5 мл LB с 50 мкг / мл стрептомицина (SM) с использованием клеток из глицерина запаса или одной колонии на агаровой пластине и стерильный пипетка или петли. Grow культуры в 37 ° C с 200 оборотов в минуту дрожать.
      2. Сделать 1:70 разведений от каждого O / N культуры по отдельности в 2 мл стерильного LB с теми же антибиотиками. Добавить глюкозу до конечной концентрации 100 мМ для всех донорских клеток. Рост клеток в фазе середины логарифмической (OD 600 0,5-0,7) при 37 ° C при встряхивании со скоростью 200 оборотов в минуту.
      3. Центрифуга (4000 мкг в течение 5 мин при 4 ° С), чтобы осадить клетки, отбросить супернатант, мыть один раз с холодной стерильной LB для удаления antibioтики и ресуспендирования клеток в 2 мл холодной стерильной LB.
      4. В двух экземплярах, аликвоты по 100 мкл каждой культуры в 800 мкл стерильными средами LB и дать им возможность спариваться при 37 ° С в течение 1 ч без встряхивания.
      5. Vortex клетки в течение 30 секунд, чтобы разрушить пары сопрягаемых и разместить их на льду в течение 10 мин, чтобы предотвратить дальнейшее спаривание.
      6. Использование культур в середине журнала со стадии 3.2.2 и свежего стерильного LB, готовят 6 серийных разведений донора и реципиента клеток от 10 -2 до 10 -7.
      7. На каждой из двух половин чашки с агаром , содержащей 10 мкг / мл Nal, 20 мкг / мл и 50 Cm мкг / мл Km , появления пятен 10 мкл аликвоты каждого разведения XK1200 донорских клеток, как показано на рисунке 2. Повторите эти действия для Разведения MC4100 реципиент клеток на чашках с агаром, содержащих 50 мкг / мл Sm. Инкубируйте пластины O / N при 37 ° C.
      8. Используя встряхивали смесь со стадии 3.2.5 и свежей стерильной LB, готовят 6 разведения (10 -2 -10 -7 показано на рисунке 2. Повторите эти действия для обоих дублированных смесей. Держите область стерильной и работать рядом с пламенем. Инкубируйте пластины O / N при 37 ° C.
      9. Определить эффективность спаривание каждого конструкта, как описано в протоколе 3.3.
      10. Повторите этот протокол для всех плазмид восстановления, чтобы оценить влияние конкретной мутации на эффективность сопряжения.
    3. Расчет эффективности Спаривание
      1. Подсчитайте количество колоний из того же разведения кровянистые выделения для каждого донора, реципиента и transconjugant клеток на их соответствующих пластин.
      2. Количество колоний получателей проверить любое смещение, которое привело бы от необходимости большего количества трансконъюгантов чем реципиентов при этом данного разведения.
      3. Сalculate эффективность матовую как количество transconjugant колоний, поделенное на число колоний-доноров. Умножьте на 100, чтобы получить значение эффективности на 100 донорских клеток.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Процесс F плазмиды управляемой бактериальной конъюгации представляет собой скоординированный процесс , который включает в себя белки переноса в тра области F-плазмиды , которая собирает T4SS для облегчения синтеза фимбриевый и конъюгативных перенос ДНК. Белок TRAF (GenBank, # BAA97961; UniProt ID P14497) необходим для формирования конъюгативной F-пилей. 10,14,35 - 37 Белок содержит С-концевой тиоредоксин-подобный домен, хотя он не имеет каталитический CXXC мотив. 35,38 Несмотря на то, что было предсказано , чтобы взаимодействовать с белком трах через его N-концевой домен, 39 область , показано более динамичны , чем его С-концевого домена, 37 не так много еще известно о структурных особенностей белка. Для того, чтобы оценить функциональные аспекты белка TRAF в сочетании со структурными исследованиями, мы впервые нокаутирован ген Traf на pOX38-Tc посредством гомологичнойрекомбинации, генерации плазмиды pOX38-Tc ΔtraF :: Cm (Таблица 1) в E.coli DY330R клетках. 33,34 Также генерируется была плазмида pK184-Traf из Traf -специфических праймеров (таблица 2) , чтобы обеспечить восстановление сопряжения и позволяют зондировании последовательность белка. Перенос плазмиды pOX38-Tc ΔtraF :: Cm в XK1200 клетки 40 из DY330R клеток при pK184-Traf был предоставлен в транс (трансконъюгантов выращивают на 10 мкг / мл Нал, 10 мкг / мл Tc и 20 мкг / мл Cm) указывает что (а) нокаут Traf в pOx38-Tc ΔtraF :: Cm обеспечивает в рамке CAT кассету, и (б) что pK184-Traf может восстановить конъюгативных функцию.

    Серия Traf мутантов были получены для анализа с помощью анализа конъюгативных матовую 37 с использованием XK1200 pOX38-Tc ΔtraF :: Cm + pK184-Traf ? Xклетки и клетки MC4100 41 в качестве доноров и реципиентов, соответственно. Один представитель мутант Traf 55-247 (таблица 1), N-концевую делецию мутант , который удаляет область белка предсказал взаимодействовать с трах. Когда полноразмерный белок TRAF предоставляется донорских клеток, конъюгативная передача восстанавливается (рисунок 2), обеспечивая при этом пустые плазмиды pK184 нет (таблица 3). Точно так же, конъюгативная функции в клетках XK1200 донора не восстанавливается при условии плазмидой pK184-Traf 55-247 (таблица 3). Это указывает на то, что укороченная область белка имеет важное значение для функции TRAF в пределах конъюгативной аппарата, скорее всего, через взаимодействие с трах, и обеспечивает область белка целевой для дальнейшего мутационного анализа.

    Рисунок 1
    в транс с помощью плазмиды восстановления (pK184-гена). Полученную плазмиду pOX38-Tc Δgene :: Cm передается штамм XK1200 (этап 2) для дальнейшей оценки гена с использованием брачные анализов с получателем MC4100 (шаг 3). Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

    фигура 2
    Рисунок 2: МатИНГ анализа для оценки функции гена-мишени в в сопряжении. Донора и реципиента клетки кишечной палочки XK1200 pOX38-Tc ΔtraF :: Cm трансформировали pK184-Traf и MC4100, соответственно. Полученные трансконъюганты (MC4100 pOX38-Tc ΔtraF :: Cm) растут на пластинах , содержащих Sm и Cm, что указывает на успешное восстановление конъюгативной функции. Эксперимент проводится в двух экземплярах на одной чашке с агаром, и серийные разведения используются для того расчета эффективности сопрягаемой реституционной мутантов гена (таблица 2). Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

    Бактериальный штамм / Плазмидная Соответствующие характеристики Селективного маркера (ов) Справка
    бактериальными штаммами
    DY330R W3110 ΔlacU169 gal490 λc1857 Δ (CRO-BIOA) Rif R понижение в должности 33,34
    XK1200 F - lacΔU124 Δ (NADA Arog гал attλ био GYRA) Нал 40
    MC4100 araD139 Δ (ФГДД-ЛАК) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR Sm 41
    Векторы и конструкты
    pBAD33 Плазмида для экспрессии под P от araBAD См 32
    pK184 2.4 кб клонирующий вектор, p15a репликон Km 31
    pK184-Traf </ TD> F Traf от pOX38 в pK184 Km 35
    pK184-Traf 56-247 F Traf аа 56-247 из pK184-Traf Km
    конъюгативных Плазмиды
    pOX38-Тс IncFI, Тра +, RepFIA +, f1 HindIII фрагмент F, мини-Tn Тс 29,30
    pOX38-Tc ΔtraF :: Cm pOX38 Тс-с КПП вставляется в Traf Tc Cm 35
    † Cm, хлорамфеникол; Km, канамицин; Нал, налидиксовой кислоты; Rif, рифампицин; Sm, стрептомицин; Тс, тетрациклин
    ‡ Все конструкции Traf содержат 19-остатков лидерной последовательности, чтобы обеспечить локализацию периплазмическое пространства.

    Таблица 1: штаммы палочки и плазмиды использовали в данном исследовании.

    сооружать Грунтовка *
    Traf-Cm-For 5'- GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC -3 '
    Traf-Cm-Rev 5'- TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG -3 '
    pK184-TRAF-For 5'- TTTTTT GAATTC TATGAATAAAGCATTACTGCCAC -3 '
    pK184-TRAF-Rev 5'- TTTTTT AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA -3 '
    pK184-Traf 55-247 -Для 5'- TACG CATATG ATGGCCGCACTGCAGACGG -3 '
    pK184-Traf 55-247 5'- TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA -3 '
    † Таблица заимствована из Lento и др. 2016 35 с разрешения
    * Traf нависающие участки Курсивом. Ограничение ферментные сайты подчеркнуты (HindIII: AAGCTT, EcoRI: GAATTC, NdeI: CATATG)

    Таблица 2: Перечень праймеров , использованных в данном исследовании.

    Донор Плазмида † Восстановление Плазмида Трансконъюгаты ‡ § (клетки мл -1) Спаривание Efficiency§ ||
    pOX38-Tc ΔtraF :: Cm Никто 0 0
    pOX38-Tс ΔtraF :: Cm pK184 0 0
    pOX38-Tc ΔtraF :: Cm pK184-Traf 5 х 10 3 0,0167
    pOX38-Tc ΔtraF :: Cm pK184-Traf 55-247 0 0
    * Таблица заимствована из Lento и др. 2016 35 с разрешения
    † Донорские клетки кишечной палочки XK1200, со средней концентрацией 3 × 10 7 клеток мл -1
    ‡ клетки - реципиенты были кишечной палочки MC4100. Число трансконъюгантов для положительного контроля составляет от 10-5 разведения. 0 указывает на отсутствие трансконъюгантов от 10-2 разведения.
    §An в среднем от двух до четырех брачных экспериментов были выполнены для каждой конструкции.
    || Эффективность спаривание definэд в качестве трансконъюгантов на 100 донорских клеток. 0 КПД спаривание указывает на отсутствие трансконъюгантов от 10-2 разведения

    Таблица 3: упразднены эффективность спаривания с помощью Traf делеционных конструкций.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    Бактериальный процесс конъюгации обеспечивает средства, с помощью которых бактерии могут распространяться гены обеспечивая эволюционное преимущество для роста в сложных условиях, таких как распространение маркеров устойчивости к антибиотикам. Поскольку многие из конъюгативных плазмид настолько велики, 12 функциональных исследований по белков , участвующих в сборке передачи аппарата в результате мутации генов - мишеней , на самом конъюгативной плазмиды являются громоздкими. В данном документе подробно описанные протоколы обеспечивают средство , с помощью которого можно более легко оценить целевой интерес ген , за счет использования меньшие, более экспрессионных плазмид (рисунок 1). Мы используем плазмиды F производное pOX38-Tc (таблица 1) для изучения F плазмиды опосредованной конъюгации; другие конъюгативных плазмиды могут быть изучены с помощью подробных здесь протоколы и соответствующие производные плазмид. Сопряженные анализы , описанные были адаптированы от мороза и коллег, 42 с некоторыми modificatiдополнения. В предыдущих исследованиях, 8,33,42 создание конструкции pOX38-Tc Δgene :: Cm была достигнута путем скалывания интересующего гена с соответствующими ферментами рестрикции и встраиванием амплифицированной CAT кассету в pOX38-Tc. 42 В текущем методе мы используем гомологичной рекомбинации в recombineering штамма E.coli DY330R 33,34 нокаут гена - мишени и заменить его на CAT кассете. Это имеет преимущество, что позволяет результирующую DY330R штамм укрывает pOX38-Тс Δgene :: Cm сооружать действовать в качестве контроля для нокаута гена специфических из F-T4SS опосредованной конъюгативного переноса через восстановление переноса с использованием плазмиды восстановления pK184-гена , В то время как это может быть возможно генерировать просвечивания с использованием методологии Зернистое-cas9, 43 мы не имеем в это время использовали эту возможность.

    Процесс начинается с генерации гена в нокауте производной плазмиды F pOX38-Tc (Figurе 1). Это достигается с помощью гомологичной рекомбинации в клетках DY330R (таблица 1), также могут быть использованы и другие штаммы с аналогичными характеристиками , такими как DY329, DY331 и DY378. Грунтовки первоначально предназначены для ПЦР - амплификации КОШКИ кассеты из плазмиды pBAD33 32 и содержат нависающих основы , которые являются специфическими для гена - мишени (таблица 2); ПЦР-продукт затем электропорации в DY330R клеток, несущих pOX38-Tc. Гомологичные рекомбинация генерирует нокаут плазмиды pOX38-Tc Δgene :: Cm, где CAT кассета вставляется в рамке в пределах гена-мишени, эффективно нарушая сборку и спряжения T4SS, обеспечивая при этом Cm сопротивление. В то же время, гена-мишени амплифицировали с помощью ПЦР из pOX38-Tc и вставляется в небольшой экспрессирующую плазмиду; В этом протоколе мы используем pK184 для конститутивной экспрессии, тем не менее можно было бы выбрать плазмиду с индуцируемой экспрессии гена-мишени, если это желательно. Плазмида pK184-ген затем трансформируютв клетки DY330R pOX38-Tc Δgene :: Cm, и эти клетки затем используются в качестве доноров Для переноса pOX38-Tc Δgene :: Cm построить с помощью сопряжения в XK1200 клеток для вязки анализов. В ответными анализах, донор и реципиент клетки XK1200 pOX38-Tc Δgene :: Cm и MC4100, соответственно. Восстановление плазмида pK184-гена, а также мутанты серий гена - мишени (делеции или точечные мутации), предоставляется донорских клеток , чтобы оценить их способность восстанавливать спаривание, и определить его эффективность, с клетки - реципиенты MC4100 (рисунок 2 ; Таблица 3).

    Решающее значение для процедуры является использование соответствующего донора и штаммов - реципиентов (таблица 1), а также от конструкции используемых праймеров. Для каждого праймера разработан, существуют общие принципы, которые следует соблюдать. В то время как мы строго стараться соблюдать с 40-60% содержанием GC, это не всегда возможно. В таких случаях своему усмотрению экспериментатора, чтобы проверить грунт шСодержание GC Ith немного ниже или выше этого диапазона. Температура плавления (Тпл) переднего и обратного праймера , должны быть одинаковыми, а температура отжига (Т а) значение всегда должно быть ниже , чем Тпл на 2-5 ° С для ПЦР. Свободная энергия , доступная для обеспечения возможности заколку для разработки должен быть значительно ниже , чем Т а, в то время как гомо- и гетеро- димеризации Тпл 's должно быть очень низким (менее чем -10 кДж и 30 ° С). Праймеры могут быть разработаны, чтобы исследовать делеции, инсерции или точечные мутации по своему желанию. Это, конечно, важно, чтобы полученный в результате конструкт гена амплифицировать и лигировали в плазмиду восстановления в рамке считывания таким образом, чтобы он правильно экспрессирован. Трансформация компетентных клеток может быть сделано с помощью электропорации или теплового шока с использованием Электрокомпетентные или химически компетентных клеток, соответственно. Мы считаем, что электропорации является более эффективным для больших конструкций, таких как pOX38-Tc и гомологичной рекомбинации oligonucleotide, в то время как более мелкие плазмиды экспрессии, такие как pK184-TRAF могут быть легко преобразованы в клетки, используя методы теплового шока. И, наконец, важно помнить, что будет несколько антибиотиков в использовании на протяжении всего протокола, поскольку оба доноров и получателей штаммы требуют различных сопротивлений, которые отличаются от тех, которые использованы на конъюгативных и восстановления плазмид.

    Помимо методов сопрягаемые анализов, описанных здесь, существуют другие методы, которые используются для изучения конъюгации бактерий, слегка различающиеся по их подходе. Горизонтальный перенос генов представляет собой процесс, в котором бактерии переноса плазмиды в клетку-реципиент, в том числе получателей межвидовых. 44 Исследование Дальбергом и его коллеги 44 например использовали конъюгации бактерий , чтобы определить степень межвидовой горизонтального переноса генов. Они использовали включение зеленого флуоресцентного белка (GFP) в плазмиду клонировали в KT2442 клеток; хромосомный лAC I кв гена в клетках KT2442 подавляют экспрессию GFP. Когда плазмиду , несущую GFP , передается вида без гена д лаковые I, наблюдается флуоресценция. 44 Несмотря на ограничения , чтобы обеспечить определенную функцию белка у разных видов, эксперимент межвидовой спряжения возможно может быть связан с протоколами , представленными здесь , чтобы сделать эволюционные предсказания для белок-белковых взаимодействий между различными видами.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Авторы заявляют, что у них нет конкурирующих финансовых интересов.

    Acknowledgments

    Это исследование было поддержано Discovery Гранта из наук и инженерного совета природного Канады (NSERC).

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics