बैक्टीरियल संयुग्मन में शामिल स्थानांतरण प्रोटीन के अनुक्रम विशिष्ट विश्लेषण के लिए संयुग्मी संभोग Assays

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

सूक्ष्म जीवधारी स्तर पर जीन और प्रोटीन के हस्तांतरण बैक्टीरियल अस्तित्व और विकास के रूप में अच्छी तरह से संक्रमण की प्रक्रिया में एक केंद्रीय भूमिका निभाता है। बैक्टीरिया के बीच या एक जीवाणु और एक सेल के बीच डीएनए के आदान-परिवर्तन, विकार या वेक्टर पारगमन के माध्यम से प्राप्त किया जा सकता है। 1,2 संयुग्मन ऐसे कोलाई के रूप में ग्राम नकारात्मक बैक्टीरिया के बीच विकार के दौरान परिवर्तन और उस में पारगमन की तुलना में अद्वितीय है, डीएनए के हस्तांतरण के एक दाता नियंत्रित फैशन जिससे एक जटिल प्रणाली macromolecular दाता और प्राप्तकर्ता कोशिकाओं से जोड़ता में होता है। संयुग्मन भी सबसे सीधा रास्ता है जो बैक्टीरियल कोशिकाओं मेजबान कोशिकाओं के साथ बातचीत करने के लिए मेजबान सिस्टम में जीन, प्रोटीन या रसायन इंजेक्षन है। 3 अक्सर, ऐसे एजेंटों के हस्तांतरण मेजबान पर उल्लेखनीय प्रभाव, विकास और अनुकूलन की मेजबानी करने के रोगजनन और कैंसरजनन से लेकर है। ऐसा नहीं है कि संयुग्मी recombinatio दिखाया गया हैn पर्यावरण के तनाव की शर्तों के तहत उच्च उत्परिवर्तन दर के साथ बैक्टीरिया में अनुकूलन 3 गुना की दर बढ़ जाती है। 4 इसके अलावा, विकार अब तक का सबसे आम मार्ग के माध्यम से जो जीवाणु उपभेदों में एंटीबायोटिक प्रतिरोध जीनों में फैले हुए हैं के द्वारा होता है। 5,6

सूक्ष्मजीवों सेलुलर झिल्ली भर में बड़े अणुओं के स्थानांतरण का समर्थन करने के लिए विशेष स्राव सिस्टम विकसित किया है; वर्तमान में वर्णित किया गया है कि ग्राम नकारात्मक बैक्टीरिया में स्राव सिस्टम (TSSs) के 9 प्रकार के होते हैं: T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS, साथ ही धारा (स्राव) और गूंथना (दो arginine translocation) रास्ते। 7.8 स्राव प्रणाली के प्रत्येक प्रकार के आगे विभिन्न उपप्रकार में, एक आवश्यकता प्रोटीन की विविधता और शामिल रास्ते की विशिष्टता के कारण, विभिन्न जीवाणु उपभेदों में बांटा गया है। उदाहरण के लिए, प्रकार चतुर्थ स्राव प्रणाली (T4SS) में, तिवारी और कैग सिस्टम जबकि एफ प्लाज्मिड प्रेरक परिवहन की सुविधा, R27 एकएन डी pKM101 T4SSs एक संयुग्मी प्लाज्मिड के हस्तांतरण की सुविधा। 7,9,10 तंत्र है जिसके द्वारा जीवों एक प्राप्तकर्ता या अपने आसपास के वातावरण के साथ अपने घटक प्रोटीन से उनके संबंधित स्राव सिस्टम को इकट्ठा और सेलुलर सामग्री साझा करने की एक विस्तृत समझ लक्षित रणनीतियों के विकास रोगजनक सूक्ष्मजीवों और प्रक्रियाओं का मुकाबला करने के लिए एक महत्वपूर्ण कारक है सेलुलर संक्रमण।

Lederberg और टेटम, 11 से ई कोलाई में प्रारंभिक पहचान बैक्टीरियल विकार के बाद मोबाइल और संयुग्मी plasmids की एक बड़ी संख्या की पहचान की और विशेषता किया गया है। 12 तरह के मोबाइल plasmids दिखाने काफी रेंज आकार (1 से 200 से अधिक kilobases (केबी) करने के लिए) है, लेकिन सभी मोबाइल plasmids एक relaxase, जो हस्तांतरण (Orit) जिससे प्लाज्मिड के प्रसारण के लिए सक्षम करने के मूल पहचानता होते हैं। संयुग्मी plasmids एक कार्यात्मक T4SS की विधानसभा के लिए आगे सांकेतिक शब्दों में जीन के साथ ही एक प्रकार हैचतुर्थ युग्मन प्रोटीन। 12 उदाहरण के लिए ई कोलाई के 100 केबी एफ प्लाज्मिड एक 33.3 kB हस्तांतरण (टीआरए) क्षेत्र के भीतर सभी संयुग्मी जीन encodes। 13 संयुग्मी प्लाज्मिड स्थानांतरण के दौरान सभी प्रोटीन है कि pilus गठन की सुविधा, जोड़ी गठन (एमपीएफ), डीएनए हस्तांतरण और बहिष्कार कार्यों संभोग एफ प्लाज्मिड सांकेतिक शब्दों का टीआरए क्षेत्र में जीनों। 10,14,15 ज्ञान का एक महत्वपूर्ण शरीर संयुग्मी T4SSs के लिए उपलब्ध है, लेकिन केवल अधिक हाल ही में उपलब्ध हो रहे हैं संयुग्मी प्रोटीन और परिसरों के संरचनात्मक अध्ययन विस्तृत जानकारी दी। 16 - 28

आदेश संयुग्मी प्रक्रिया के लिए एक व्यापक दृष्टिकोण को इकट्ठा करने के लिए, विस्तृत संरचनात्मक अध्ययन की एक युग्मन संयुग्मी हस्तांतरण प्रोटीन का विश्लेषण mutational करने के लिए आवश्यक है। इस संयुग्मी संभोग assays के माध्यम से हासिल किया जा सकता है। एफ प्लाज्मिड के लिए, प्रत्येक प्रोटीन टीआरए क्षेत्र के भीतर इनकोडिंग एफ की मध्यस्थता सह में एक भूमिका निभाता हैnjugation; इसलिए, पीटकर / एक हस्तांतरण के जीन का विलोपन सेल (चित्रा 1) के संयुग्मी क्षमता को समाप्त होगा। जबकि छोटे मोबाइल plasmids मानक विलोपन प्रक्रियाओं के लिए अनुकूल है, ऐसे एफ के रूप में बड़ा संयुग्मी plasmids के लिए कर रहे हैं, जीन नॉकआउट अधिक आसानी मुताबिक़ पुनर्संयोजन के माध्यम से प्राप्त कर रहे हैं, जहां लक्ष्य जीन एक एक अलग एंटीबायोटिक प्रतिरोध जीन संदेश के साथ बदल दिया है। वर्तमान प्रोटोकॉल में, हम 55 केबी एफ प्लाज्मिड व्युत्पन्न pOX38-टीसी में chloramphenicol acetyltransferase (कैट) के साथ ब्याज की एक हस्तांतरण के जीन को बदलने के लिए मुताबिक़ पुनर्संयोजन को रोजगार; 29,30 परिणामी पीटकर प्लाज्मिड, pOX38-टीसी Δgene :: सेमी, विकास मीडिया में (सेमी) chloramphenicol की उपस्थिति के लिए प्रतिरोध की सुविधा। शरण pOX38-टीसी Δgene :: सेमी दाता कोशिकाओं संयुग्मी डीएनए स्थानांतरण / संभोग के रूप में एक संभोग परख के उपयोग के माध्यम से मनाया को प्रभावित करने में असमर्थ हैं; एक pOX38-टीसी Δgene :: सेमी दाता सेल के संभोग दक्षता और एक सामान्य RECIPient कमी होगी या, अधिक बार, समाप्त कर दिया जाना। pOX38-टीसी Δgene :: सेमी प्लाज्मिड के संयुग्मी हस्तांतरण लक्षित हस्तांतरण जीन को शरण देने के एक छोटे से वसूली प्लाज्मिड के माध्यम से बहाल किया जा सकता है। यह वसूली प्लाज्मिड एक है कि इस तरह के प्लाज्मिड pK184 (pK184-जीन), 31 या एक है कि इतने लंबे समय के रूप में है कि प्लाज्मिड ठीक से सेल (कोशिका द्रव्य या periplasm) के भीतर सही स्थान पर जीन लक्ष्य inducible अभिव्यक्ति प्रदान करता है के रूप में, विधान अभिव्यक्ति प्रदान करता है हो सकता है। नतीजतन, इस नए दाता के बीच संभोग assays में (pOX38-टीसी Δgene :: सेमी + pK184-जीन plasmids शरण) और एक प्राप्तकर्ता सेल, संभोग दक्षता लगभग कि एक सामान्य दाता प्राप्तकर्ता संभोग परख के लिए बहाल करने की उम्मीद है। इस प्रणाली pK184-जीन निर्माणों (विलोपन या बिंदु उत्परिवर्तन) की एक श्रृंखला की पीढ़ी के माध्यम से बाहर खटखटाया जीन के समारोह की जांच करने और प्रत्येक निर्माण के pOX38-टीसी Δgene :: मुख्यमंत्री को शरण देने का संभोग क्षमता को बहाल करने की क्षमता का परीक्षण करने के लिए एक सक्षम बनाता है दाता सेलएस।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. डीएनए निर्माणों के जनरेशन

  1. लक्ष्य जीन के मुताबिक़ पुनर्संयोजन के लिए oligomers डिजाइनिंग
    1. एक भी 55-72 बीपी आगे oligomer डिजाइन इस प्रकार है: (क) एक 19-32 बीपी लंबे न्यूक्लियोटाइड अनुक्रम कि chloramphenicol acetyltransferase जीन के 5 'शुरू साइट के अपस्ट्रीम क्षेत्र 10-100 बी.पी. में एक डीएनए अनुक्रम के मुताबिक़ है उठाओ वाणिज्यिक pBAD33 प्लाज्मिड में, 32 और (ख) एक 36-54 बीपी लंबे न्यूक्लियोटाइड अनुक्रम मुताबिक़ एक क्षेत्र के लिए 10-150 बीपी लक्ष्य जीन के 5 'शुरू साइट के बहाव का चयन ब्याज की।
      1. न्यूक्लियोटाइड अनुक्रम में (क), इस प्रकार एक ही 55-72 लंबे आगे oligomer देने उठाया के अंत 3 'न्यूक्लियोटाइड अनुक्रम (ख) 5 के लिए उठाया के अंत' में शामिल हों।
    2. एक भी 55-72 बीपी रिवर्स oligomer डिजाइन इस प्रकार है: (क) एक 19-32 बीपी लंबे न्यूक्लियोटाइड अनुक्रम है कि इस क्षेत्र 10-100 बी.पी. में एक डीएनए अनुक्रम के मुताबिक़ है लेने डाउनस्ट्रीम3 के हित का लक्ष्य जीन के अंत साइट 'वाणिज्यिक pBAD33 प्लाज्मिड में chloramphenicol जीन के अंत में, और (ख) 3 के ऊपर 10-150 बीपी के भीतर एक क्षेत्र के लिए एक 36-54 बीपी लंबे न्यूक्लियोटाइड अनुक्रम मुताबिक़ चुनें' ।
      1. न्यूक्लियोटाइड अनुक्रम में उठाया के अंत 3 'न्यूक्लियोटाइड अनुक्रम से 5 (ख) में उठाया के अंत' (क) यह एक एकल oligomer बनाने के लिए शामिल।
      2. किसी भी उपलब्ध जैव सूचना विज्ञान सॉफ्टवेयर में इस oligomer कॉपी और उसके रिवर्स पूरक में अनुक्रम में परिवर्तित। यह एक एकल 55-72 बीपी लंबे रिवर्स oligomer दे देंगे।
    3. किसी भी उपलब्ध oligo-विश्लेषक कार्यक्रम का उपयोग करना, जाँच करें कि पुनर्संयोजन oligomers 40-60% के बीच जीसी सामग्री, कम बाल के लिये कांटा पिघलने के तापमान (टी एम), कम आत्म और असमलैंगिक dimerization टी एम के लोगों की है। किसी भी पसंदीदा जैव प्रौद्योगिकी कंपनी से संश्लेषण और लदान के लिए प्राइमरों आदेश।
  2. PBAD33 से बिल्ली कैसेट (सेमी आर के प्रवर्धन
  3. 200 आरपीएम और 37 डिग्री सेल्सियस पर झटकों के साथ बाँझ Lysogeny शोरबा (पौंड) 20 माइक्रोग्राम / एमएल chloramphenicol (सेमी) के साथ में pBAD33 प्लाज्मिड शरण DH5α कोशिकाओं की एक रात (ओ / एन, 16-18 ज) संस्कृति विकसित।
  4. कमरे के तापमान पर हे / एन संस्कृति की अपकेंद्रित्र 6-8 एमएल, 3 मिनट के लिए 5000 XG। सतह पर तैरनेवाला छानना और एक प्लाज्मिड मिनी प्रस्तुत करने किट (सामग्री तालिका) और निर्माता प्रोटोकॉल का उपयोग कर गोली से pBAD33 प्लाज्मिड निकाल सकते हैं।
  5. 50 μL, pBAD33 प्लाज्मिड की 1 ग्राम की मात्रा, 5 μL 10x के अंतिम मात्रा को दोहरा आसुत जल की उचित मात्रा (DDH 2 हे): आदेश में एक बाँझ ट्यूब में निम्नलिखित दी जोड़कर pBAD33 प्लास्मिड डीएनए के एक डाइजेस्ट करो aVAI प्रतिबंध एंजाइम की एंजाइम की प्रतिक्रिया बफर, और 0.5 μL (आरई)। धीरे pipetting द्वारा मिश्रण और प्रतिक्रिया 37 डिग्री सेल्सियस पर 1 घंटे के लिए आगे बढ़ना। हीट 80 पर 20 मिनट (न्यूनतम) के लिए प्रतिक्रिया निष्क्रियसी। 24 घंटे से अधिक समय के लिए कोई -20 डिग्री सेल्सियस पर स्टोर के नमूने चिपचिपा अंत गिरावट को कम करने के लिए।
  6. एक 250 एमएल Erlenmeyer फ्लास्क में बफर 1x TAE के 100 एमएल (; 20 मिमी एसिटिक एसिड 1 मिमी EDTA 40 मिमी Tris, पीएच 8.5) के साथ agarose के 1.2 जी के मिश्रण से एक 1.2% agarose जेल को अलग करने को तैयार है। गर्मी और चक्कर आने के लिए पूरी तरह से एक माइक्रोवेव में भंग करने के लिए। तुरंत हीटिंग जब तरल फोड़ा और कुप्पी चक्कर आने के लिए शुरू होता है बंद करो।
    1. कमरे के तापमान पर 3 मिनट के लिए तरल agarose शांत देर घूमता, मिश्रण करने के लिए 10 मिलीग्राम / एमएल ethidium ब्रोमाइड और चक्कर आने के 2 μL जोड़ें। एक अच्छी तरह कंघी के साथ एक जेल ट्रे में agarose डालो और यह कमरे के तापमान पर 1 घंटे के लिए जमना करने की अनुमति। 1x TAE बफर में अप करने के लिए 2 दिनों के लिए 4 डिग्री सेल्सियस पर स्टोर जैल।
  7. मिक्स प्रत्येक आरई 1.2.3 से pipetting द्वारा डीएनए लोडिंग डाई (प्रति 50 μL प्रतिक्रिया डाई के 10 μL) के 0.2 मात्रा के साथ पचाने। लोड 5 अच्छी तरह से एक पर दूसरे में पहले अच्छी तरह से में 500 माइक्रोग्राम / एमएल डीएनए सीढ़ी और आरई डाइजेस्ट-डाई मिश्रण के सभी के μLgarose जेल। जेल पर प्रतिक्रिया मात्रा के सभी लोड करने के लिए 2-3 कुओं का प्रयोग करें।
    1. जेल मुश्किल से 1x TAE में डूबे हुए चलाने के बफर और एक जेल वैद्युतकणसंचलन डिवाइस में 65 मिनट के लिए 45-50 वी (4.5-5 वी / सेमी) पर काम कर।
  8. एक यूवी कैबिनेट और एक बाँझ रेजर का प्रयोग, जल्दी से 2.8 केबी बैंड है कि जेल से बाहर कैट अनुक्रम से मेल खाती है डीएनए की यूवी जोखिम को कम करने के लिए काट दिया। कट आउट जेल निर्माता प्रोटोकॉल के अनुसार एक जेल निकालना किट (सामग्री तालिका) का उपयोग टुकड़ा से डीएनए निकालने।
    नोट: सीधे यूवी के तहत त्वचा को बेनकाब और देखभाल के साथ उस्तरा को संभालने के लिए नहीं ख्याल रखना।
  9. कैट कैसेट पोलीमरेज़ चेन रिएक्शन (पीसीआर) द्वारा 1.2.6 से निकाला 1.1 में डिजाइन किया गया है कि प्राइमरों जीन अनुक्रम के मुताबिक़ मुताबिक़ पुनर्संयोजन के लिए अनुमति देने के लिए overhangs रोकने का उपयोग बढ़ाना। पीसीआर प्रतिक्रियाओं निम्न क्रम में निर्माता के दिशा निर्देशों (सामग्री तालिका) का उपयोग कर बर्फ पर स्थापित कर रहे हैं:
    1. मेंबाँझ पीसीआर ट्यूब, हे 50 μL के अंतिम मात्रा, पीसीआर बफर के 10 μL, 10 मिमी dNTPs, 10 माइक्रोन के आगे प्राइमर का 2.5 μL, 10 माइक्रोन के रिवर्स प्राइमर का 2.5 μL के 1 μL के द्वारा पीछा करने के लिए DDH 2 का एक उचित मात्रा जोड़ने , 1.2.6 से टेम्पलेट डीएनए के 1-25 एनजी और 100 यूनिट / μL डीएनए पोलीमरेज़ के 0.5 μL।
    2. एक नकारात्मक नियंत्रण कि 1.2.7.1 रूप में, लेकिन टेम्पलेट डीएनए के अपवाद के साथ एक ही घटक भालू सेट करें। एक उचित बजाय टेम्पलेट डीएनए DDH 2 हे की मात्रा का प्रयोग करें। टेम्पलेट डीएनए और प्राइमरों कि इस तरह के निर्माता द्वारा सकारात्मक नियंत्रण के रूप में प्रदान की उन के रूप में एक पीसीआर प्रतिक्रिया में काम करने के लिए, सिद्ध किया गया है का उपयोग कर एक सकारात्मक नियंत्रण स्थापित करें।
    3. सभी प्रतिक्रिया सामग्री pipetting द्वारा धीरे मिलाएं।
    4. 30 एस के लिए 72 डिग्री सेल्सियस और एक में 98 डिग्री सेल्सियस, 20 एस, amplicon की kilobase प्रति 20 S के लिए विस्तार के लिए प्राइमर annealing पर 10 एस के लिए 98 डिग्री सेल्सियस पर प्रारंभिक विकृतीकरण, विकृतीकरण के 30 चक्रों: पीसीआर के माध्यम से बढ़ाना निम्नलिखित सेटिंग्स का उपयोग पंख72 डिग्री सेल्सियस पर 10 मिनट के लिए अल विस्तार। -20 डिग्री सेल्सियस पर स्टोर नमूने हैं।
  10. सही (1.2.4-1.2.5 देखें) agarose जेल वैद्युतकणसंचलन के माध्यम से प्रवर्धन के आकार के प्रत्येक प्रतिक्रिया का केवल 5 μL का उपयोग करके पुष्टि करें। पीसीआर amplicon एक पीसीआर शुद्धि किट और निर्माता प्रोटोकॉल का उपयोग कर शुद्ध। दुकान -20 डिग्री सेल्सियस पर डीएनए शुद्ध।
  • PK184-जीन वसूली प्लाज्मिड
    1. आगे एक प्राइमर डिजाइन अपने 5 से शुरुआत 'अंत और 3 की ओर जा रही' निम्न क्रम में अंत: (क) 4 यादृच्छिक न्यूक्लियोटाइड दरार दक्षता के लिए (adenine, थाइमिन, गुआनिन और साइटोसिन का एक संयोजन), से जुड़ी लेने (ख) EcoRI प्रतिबंध एंजाइम (आरई) में कटौती साइट अनुक्रम (GAATTC), (ग) एक 21-25 बीपी लंबे न्यूक्लियोटाइड दृश्य है कि ब्याज की जीन, शुरू कोडोन सहित के 5 'को समाप्त करने के मुताबिक़ है द्वारा पीछा किया। लक्ष्य जीन एक EcoRI साइट शामिल हैं, pK184 कई क्लोनिंग साइट से एक और उचित आरई चुनें।
    2. periplasmic प्रोटीन एन्कोडिंग जीन के मामले में, फिर साइट और आगे प्राइमर पर शुरू कोडोन के बीच एक अतिरिक्त नेता अनुक्रम में शामिल हैं।
    3. किसी भी उपलब्ध oligo-विश्लेषक का उपयोग कर, जाँच करें कि प्राइमरों 40-60% के बीच जीसी सामग्री, कम बाल के लिये कांटा टी एम, कम आत्म और असमलैंगिक dimerization टी एम के लोगों की है। संश्लेषण के लिए प्राइमरों आदेश।
    4. बाँझ लेग 32 डिग्री सेल्सियस और 200 rpm पर झटकों के साथ 10 माइक्रोग्राम / एमएल टेट्रासाइक्लिन (टीसी) युक्त DY330R pOX38-टीसी कोशिकाओं के एक हे / एन संस्कृति विकसित। कमरे के तापमान पर हे / एन संस्कृति की अपकेंद्रित्र 6-8 एमएल, 3 मिनट के लिए 5000 XG। छाननातैरनेवाला और एक प्लाज्मिड मिनी प्रस्तुत करने किट (सामग्री तालिका) और निर्माता प्रोटोकॉल का उपयोग कर गोली से प्लास्मिड डीएनए निकाल सकते हैं।
    5. 1.3.1-1.3.5 से प्राइमरों के साथ ब्याज की पूर्ण जीन बढ़ाना (1.2.7.1-1.2.7.3 देखें) टेम्पलेट के रूप में pOX38-टीसी का उपयोग कर।
    6. सही (1.2.4-1.2.5 देखें) agarose जेल वैद्युतकणसंचलन के माध्यम से प्रवर्धन के आकार के प्रत्येक प्रतिक्रिया का केवल 5 μL का उपयोग करके पुष्टि करें। प्रवर्धित डीएनए एक पीसीआर शुद्धि किट और निर्माता प्रोटोकॉल का उपयोग कर शुद्ध। स्टोर -20 डिग्री सेल्सियस पर डीएनए शुद्ध।
    7. 50 μL के अंतिम मात्रा को DDH 2 हे की उचित मात्रा: दोनों व्यावसायिक रूप से उपलब्ध pK184 प्लास्मिड डीएनए और प्रवर्धित जीन के एक डबल डाइजेस्ट (। 1.3.7 से), क्रम में एक बाँझ ट्यूब में निम्नलिखित दी जोड़कर करो , pK184 प्लाज्मिड की 1 ग्राम की मात्रा, 5 μL 10x एंजाइम की प्रतिक्रिया बफर, और प्रत्येक EcoRI और HindIII के 1 μL।
      1. धीरे pipetting द्वारा मिश्रण और प्रतिक्रिया 1 घंटे के लिए आगे बढ़ना37 डिग्री सेल्सियस पर। गर्मी 80 डिग्री सेल्सियस पर 20 मिनट के लिए प्रतिक्रिया निष्क्रिय। 24 घंटे से अधिक समय के लिए कोई -20 डिग्री सेल्सियस पर स्टोर के नमूने चिपचिपा अंत गिरावट को कम करने के लिए।
        नोट: प्रतिबंध nuclease के प्रकार के यहां इस्तेमाल प्रतिबंध nuclease साइट है कि कदम 1.3.1 और 1.3.2 में प्राइमरों में इंजीनियर था पर निर्भर करता है।
      2. एक सकारात्मक नियंत्रण के रूप में, 1.3.8 के रूप में ही प्रतिक्रिया तैयार करके pK184 प्लाज्मिड की एकल हज़म की स्थापना के अलावा एक प्रतिक्रिया ट्यूब के लिए रेस के लिए केवल एक जोड़ें। दोनों Res के साथ अलग से यह मत करो।
    8. प्रोटोकॉल का उपयोग 1.2.4-1.2.5 डीएनए निकालें डबल दोनों pK184 और जीन के टुकड़े को पचाने में 1.2% agarose जेल पर हज़म भागो ब्याज के कदम के लिए 1.2.6 अनुसार।
    9. 3 वेक्टर: 10x टी -4 डीएनए ligase बफर, 100 एनजी डीएनए की कुल एक 1 से बना के 2 μL: निम्न क्रम में एक बाँझ ट्यूब में घटकों जोड़कर pK184 वेक्टर में जीन डालने ligate डालने (pK184: जीन) अनुपात, DDH 2 हे अप करने के लिए एक20 μL और 1 μL टी -4 डीएनए ligase की कुल मात्रा। एक नकारात्मक नियंत्रण के रूप में, एक ऐसी ही प्रतिक्रिया डालने जीन बिना वेक्टर के 100 एनजी का उपयोग कर की स्थापना की।
      1. धीरे से एक micropipette का उपयोग सभी प्रतिक्रिया सामग्री मिश्रण और 25 डिग्री सेल्सियस पर 30 मिनट के लिए सेते हैं। 65 डिग्री सेल्सियस पर 10 मिनट के लिए बंधाव प्रतिक्रिया गर्मी निष्क्रिय और फिर बर्फ पर जगह है।
    10. जबकि बर्फ पर, pK184-जीन के 15 μL जोड़ने कदम से बंधाव प्रतिक्रिया एक बाँझ 1.5 मिलीलीटर ट्यूब में रासायनिक सक्षम DH5α कोशिकाओं के 1.3.10 से 100 μL। धीरे pipetting द्वारा मिश्रण और 10 मिनट के लिए बर्फ पर सेते हैं। नकारात्मक नियंत्रण नमूना के लिए एक ही मत करो। एक सकारात्मक नियंत्रण के लिए, pBAD33 के रूप में एक प्लाज्मिड इस तरह की 20-100 एनजी का उपयोग करें और यह 50 DHα की μL कोशिकाओं में बदलना।
    11. सीधे एक 42 डिग्री सेल्सियस पानी के स्नान में बर्फ से नमूने हस्तांतरण और 90 सेकंड के लिए सेते हैं। यह कोशिकाओं को एक गर्मी झटका प्रदान करता है और उन्हें प्लास्मिड डीएनए तेज करने के लिए अनुमति देता है।
    12. किसी अन्य के लिए बर्फ पर वापस जगह कोशिकाओं5 मिनट के लिए और फिर बाँझ लेग के 900 μL जोड़ने 1 घंटे के लिए 37 डिग्री सेल्सियस पर सेते हैं, जबकि 125 rpm पर मिलाते हुए।
    13. एक अगर प्लेट 50 माइक्रोग्राम / एमएल केनामाइसिन (किमी) युक्त पर 1.3.13 में प्रत्येक बंधाव प्रतिक्रिया से नमूने के एक 100 μL मात्रा विभाज्य और एक बाँझ स्प्रेडर का उपयोग कोशिकाओं में फैल गया। सकारात्मक नियंत्रण प्लेट उचित एंटीबायोटिक दवाओं होनी चाहिए। क्षेत्र बाँझ रखें और एक लौ के पास काम करते हैं। प्लेट उल्टा 37 डिग्री सेल्सियस रात भर में नीचे सेते हैं।
    14. एक बाँझ पिपेट या लूप का प्रयोग, कोशिकाओं की एक अलग कॉलोनी फसल और 50 माइक्रोग्राम / एमएल किमी के साथ एक 20 एमएल बाँझ लेग टीका लगाना। क्षेत्र बाँझ रखें और एक लौ के पास काम करते हैं। 200 rpm पर झटकों के साथ 37 डिग्री सेल्सियस पर कोशिकाओं हे / एन आगे बढ़ें।
    15. बाँझ क्रायो-ट्यूब में बाँझ 100% ग्लिसरॉल (अंतिम 50% वी / वी) के 500 μL के साथ हे / एन संस्कृति के 500 μL के मिश्रण से बदल DH5α कोशिकाओं के 3-5 ग्लिसरॉल शेयरों बनाओ। -80 डिग्री सेल्सियस पर स्टोर।
    16. कमरे के तापमान पर ओ के अलावा सेंट्रीफ्यूज 6-8 एमएल / एन संस्कृति, 5,000 3 मिनट के लिए XG। सतह पर तैरनेवाला छानना और एक प्लाज्मिड मिनी प्रस्तुत करने किट (सामग्री तालिका) और निर्माता प्रोटोकॉल का उपयोग कर गोली से pK184-जीन वसूली प्लाज्मिड निकाल सकते हैं।
  • pK184 - जीन म्यूटेंट
    नोट: विलोपन, सम्मिलन और / या बिंदु उत्परिवर्तन के लिए डिज़ाइन किया प्राइमर आसानी से निर्माताओं 'ऑनलाइन उपलब्ध साधनों का उपयोग उत्पन्न किया जा सकता है।
    1. एक 18-32 बीपी लंबे न्यूक्लियोटाइड दृश्य है कि ब्याज की जीन, शुरू कोडोन सहित के 5 'को समाप्त करने के मुताबिक़ है चुनने के द्वारा प्रत्येक आगे प्राइमर डिजाइन। डिजाइन प्राइमरों ऐसी है कि प्रत्येक आगे प्राइमर पूर्ववर्ती एक से 30-180 बीपी नीचे की ओर anneals, उचित लंबाई के एन टर्मिनल पेप्टाइड टुकड़े कमी विलोपन म्यूटेंट में जिसके परिणामस्वरूप।
    2. एक 18-32 बीपी लंबे न्यूक्लियोटाइड अनुक्रम कि स्टॉप कोडोन सहित हित के जीन के 3 'को समाप्त करने के मुताबिक़ है चुनने के द्वारा एक रिवर्स प्राइमर डिजाइन। एक में इस किताब कॉपीहिन्दी अनुवाद उपलब्ध जैव सूचना विज्ञान कार्यक्रम और उसके रिवर्स पूरक में अनुक्रम में परिवर्तित। इस रिवर्स प्राइमर है।
      1. periplasmic प्रोटीन एन्कोडिंग जीन के मामले में, रिवर्स प्राइमर जीन के अंत और periplasm में प्रोटीन उत्पाद का उचित स्थानीयकरण के लिए आवश्यक है 3 'एक नेता के अनुक्रम है कि 5 flanks के अंत' की रिवर्स पूरक है कि डिजाइन।
    3. किसी भी उपलब्ध oligo-विश्लेषक कार्यक्रम का उपयोग करना, जाँच करें कि विलोपन प्राइमरों 40-60% के बीच जीसी सामग्री, कम बाल के लिये कांटा पिघलने के तापमान (टी एम), कम आत्म और असमलैंगिक dimerization टी एम के लोगों की है। किसी भी उपलब्ध जैव प्रौद्योगिकी कंपनी से संश्लेषण और लदान के लिए प्राइमरों आदेश।
    4. PK184-जीन का निर्माण टेम्पलेट के रूप में प्रोटोकॉल 1.3 में प्राप्त की और 1.2.7-1.2.8 में दिशा निर्देशों का प्रयोग, पीसीआर कदम 1.4.1-1.4.3 pK184-जीन ΔX amplicons उत्पन्न करने के लिए डिजाइन प्राइमरों के साथ विलोपन निर्माणों बढ़ाना । स्टोर प्रवर्धित डीएनए एकटी -20 डिग्री सेल्सियस।
    5. प्रवर्धित का निर्माण किसी भी उपलब्ध mutagenesis किट (सामग्री तालिका) का उपयोग ligate।
    6. PK184-जीन ΔX ligates में से प्रत्येक के लिए एक मानक गर्मी झटका प्रोटोकॉल (1.3.11-1.3.13 देखें) का उपयोग रासायनिक सक्षम DH5α कोशिकाओं में अलग से रूपांतरण।
    7. एक अगर प्लेट 50 माइक्रोग्राम / एमएल किमी युक्त पर 1.4.12 में प्रत्येक बंधाव प्रतिक्रिया से नमूने के एक 100 μL मात्रा विभाज्य और एक बाँझ स्प्रेडर का उपयोग कोशिकाओं में फैल गया। क्षेत्र बाँझ रखें और एक लौ के पास काम करते हैं। प्लेट उल्टा 37 डिग्री सेल्सियस रात भर में नीचे सेते हैं।
    8. एक बाँझ पिपेट या लूप का प्रयोग, कोशिकाओं की एक अलग कॉलोनी फसल और 50 माइक्रोग्राम / एमएल किमी के साथ एक 20 एमएल बाँझ लेग मीडिया टीका लगाना। क्षेत्र बाँझ रखें और एक लौ के पास काम करते हैं। 200 rpm पर झटकों के साथ 37 डिग्री सेल्सियस पर कोशिकाओं हे / एन आगे बढ़ें।
    9. बाँझ 100% ग्लिसरॉल के 500 μL के साथ हे / एन संस्कृति के 500 μL के मिश्रण से बदल DH5α कोशिकाओं के 3-5 ग्लिसरॉल शेयरों बनाओ (final 50% वी / वी) बाँझ क्रायो ट्यूबों में। -80 डिग्री सेल्सियस पर स्टोर।
    10. कमरे के तापमान पर हे / एन संस्कृति की अपकेंद्रित्र 6-8 एमएल, 3 मिनट के लिए 5000 XG। सतह पर तैरनेवाला छानना और निकालने pK184 जीन ΔX प्लाज्मिड एक प्लाज्मिड मिनी प्रस्तुत करने किट (सामग्री तालिका) और निर्माता प्रोटोकॉल का उपयोग कर गोली से निर्माण। -20 डिग्री सेल्सियस पर स्टोर डीएनए।
  • 2. pOX38-टीसी Δgene की पीढ़ी :: सेमी खींच

    1. DY330R pOX38-टीसी Δgene :: सेमी knockouts
      1. 10 एमएल बाँझ लेग में DY330R pOX38-टीसी कोशिकाओं के एक हे / एन संस्कृति 10 माइक्रोग्राम / एमएल टीसी युक्त तैयार करें। 32 डिग्री सेल्सियस और 200 rpm पर आगे बढ़ें संस्कृति हे / एन।
      2. ताजा बाँझ पौंड के 20 एमएल में हे / एन संस्कृति का एक 1:70 कमजोर पड़ने बनाओ जब तक मध्य लॉग चरण (आयुध डिपो 600nm 0.4-0.6) वृद्धि 32 डिग्री सेल्सियस पर कोशिकाओं को विकसित।
      3. एक बाँझ फ्लास्क स्थानांतरण 10 संस्कृति के एमएल और 150 rpm पर 15 मिनट के लिए 42 डिग्री सेल्सियस पर सेते एक मिलाते हुए पानी में बीएवें। इस DY330R में पुनर्संयोजन विशिष्ट प्रोटीन की अभिव्यक्ति के लिए प्रेरित करेगा।
      4. 10 मिनट के लिए एक बर्फ नहाने के पानी में संस्कृति टेंशन मत लो। इस प्रकार के रूप electrocompetent कोशिकाओं को तैयार।
        1. 4 डिग्री सेल्सियस पर 7 मिनट के लिए 4000 XG पर पूर्व ठंडा शंक्वाकार ट्यूब और अपकेंद्रित्र में ठंडा कोशिकाओं स्थानांतरण। सभी ट्यूबों और pipettes आगामी चरणों में इस्तेमाल किया जा करने के लिए 4 डिग्री सेल्सियस पर रखा जाना चाहिए या बर्फ पर शांत करने के लिए।
        2. सतह पर तैरनेवाला निकालें और धीरे ठंडा DDH 2 ओ के 1 एमएल में कोशिकाओं resuspended बर्फ के ठंडे DDH 2 ओ की एक और 30 एमएल जोड़ें
        3. अपकेंद्रित्र कोशिकाओं (4000 XG, 7 मिनट, 4 डिग्री सेल्सियस), सतह पर तैरनेवाला त्यागें और धीरे ठंडा DDH 2 ओ के 1 एमएल में कोशिकाओं resuspended
        4. resuspended कोशिकाओं 4 डिग्री सेल्सियस पर 1 मिनट के लिए 15,000 XG पर पूर्व ठंडा 1.5 एमएल microfuge ट्यूब और अपकेंद्रित्र में स्थानांतरण।
        5. धीरे 50 μL मात्रा में बर्फ ठंड DDH 2 हे और विभाज्य के 200 μL में गोली resuspended। ElectrocompeteNT कोशिकाओं -80 डिग्री सेल्सियस पर संग्रहीत किया जा सकता
      5. 1.2 से परिलक्षित कैट कैसेट के 300 एनजी electrocompetent DY330R pOX38-टीसी कोशिकाओं के 50 μL में जोड़े जबकि ऊपर और नीचे pipetting द्वारा, बर्फ पर मिश्रण धीरे। इस कदम के लिए एक सकारात्मक नियंत्रण के रूप में असंशोधित pBAD33 प्लाज्मिड का उपयोग कर दोहराएँ।
      6. एक पूर्व ठंडा (-20 डिग्री सेल्सियस) 1 मिमी electroporation क्युवेट कोशिकाओं स्थानांतरण। एक समय 5.5 एमएस की लगातार साथ 1.8 केवी कोशिकाओं Electroporate, एक electroporator का उपयोग कर। इसके तत्काल बाद पल्स लगाने के बाद, 1 समाज एमएल मीडिया के साथ कोशिकाओं को कमजोर और एक ताजा microfuge ट्यूब को हस्तांतरण। 2 घंटे के लिए 32 डिग्री सेल्सियस पर कोशिकाओं को सेते हैं।
      7. 10 माइक्रोग्राम / एमएल टीसी और 20 माइक्रोग्राम / एमएल सेमी युक्त और एक बाँझ स्प्रेडर का उपयोग फैल अगर प्लेट पर प्रत्येक नमूने की अशेष 100 μL। क्षेत्र बाँझ रखें और एक लौ के पास काम करते हैं। सफल रिकोम्बिनेंट्स के लिए चयन करने के लिए उल्टा 32 डिग्री सेल्सियस रात भर में नीचे की थाली सेते हैं। कैट कैसेट सेल में पेश मुताबिक़ फिर से गुजरना होगाऔर ब्याज की जीन के साथ संयोजन DY330R pOX38-टीसी Δgene :: सेमी (राइफल्स आर, टीसी आर, मुख्यमंत्री आर) क्लोन पैदा करते हैं।
        नोट: यह DY330R कोशिकाओं 32 डिग्री सेल्सियस पर 15 मिनट प्रेरण के अपवाद के साथ 42 डिग्री सेल्सियस पर कदम 2.1.3 के electrocompetent कोशिकाओं को पैदा करने के लिए पहले, विकसित करने के लिए ऊंचा तापमान पर लंबे समय तक विकास के रूप में महत्वपूर्ण है उत्पादन के कारण कोशिका मृत्यु का जोखिम पी एल operon DY330R में पुनर्संयोजन कार्यों के लिए जिम्मेदार से की विषाक्त उत्पादों। 33,34
      8. एक संगठन तैयार / DY330R pOX38-टीसी Δgene के एन :: एक बाँझ पिपेट या पाश के साथ कोशिकाओं की एक अलग कॉलोनी कटाई, और 10 माइक्रोग्राम / एमएल टीसी, और 20 माइक्रोग्राम / एमएल के साथ एक 20 एमएल बाँझ लेग मीडिया inoculating द्वारा मुख्यमंत्री कोशिकाओं से.मी। क्षेत्र बाँझ रखें और एक लौ के पास काम करते हैं। 200 rpm पर झटकों के साथ 32 डिग्री सेल्सियस पर कोशिकाओं हे / एन आगे बढ़ें।
      9. हे / एन से 3-5 ग्लिसरॉल शेयरों बनाओ बाँझ 100% जीएल के 500 μL के साथ हे / एन संस्कृति के 500 μL के मिश्रण सेycerol (अंतिम 50% वी / वी) बाँझ क्रायो ट्यूबों में। -80 डिग्री सेल्सियस पर स्टोर।
      10. कमरे के तापमान पर हे / एन संस्कृति की अपकेंद्रित्र 6-8 एमएल, 3 मिनट के लिए 5000 XG। सतह पर तैरनेवाला छानना और pOX38-टीसी Δgene :: सेमी निकालने एक प्लाज्मिड मिनी प्रस्तुत करने किट (सामग्री तालिका) और निर्माता प्रोटोकॉल का उपयोग कर गोली से निर्माण; -20 डिग्री सेल्सियस पर शुद्ध डीएनए की दुकान।
      11. प्राप्तकर्ता के रूप में XK1200 कोशिकाओं का उपयोग प्रोटोकॉल 3.1 के अनुसार जीन पीटकर विकार के विघटन की पुष्टि के लिए एक संयुग्मी संभोग परख प्रदर्शन।
    2. DY330R pOX38-टीसी Δgene :: सेमी + pK184-जीन
      1. कदम प्रति 2.1.4-2.1.7 के रूप में electroporation के माध्यम से pK184-जीन का निर्माण के 300 एनजी के साथ electrocompetent DY330R pOX38-टीसी Δgene :: सेमी कोशिकाओं को बदलने। सभी चयनात्मक मीडिया 20 माइक्रोग्राम / एमएल सेमी और 50 माइक्रोग्राम / एमएल किमी होना चाहिए। 32 डिग्री सेल्सियस पर सेते हैं। electroporated कोशिकाओं में वसूली प्लाज्मिड अब डी में बाहर खटखटाया जीन के समारोह को बहाल करेंगेY330R pOX38-टीसी Δgene :: सेमी कोशिकाओं।
      2. एक संगठन तैयार / DY330R pOX38-टीसी Δgene के एन :: एक बाँझ पिपेट या पाश के साथ कोशिकाओं की एक अलग कॉलोनी कटाई, और 20 माइक्रोग्राम / एमएल मुख्यमंत्री के साथ एक 20 एमएल बाँझ लेग मीडिया inoculating द्वारा सेमी + pK184-जीन पुनः संयोजक कोशिकाओं और 50 माइक्रोग्राम / एमएल किमी। क्षेत्र बाँझ रखें और एक लौ के पास काम करते हैं। 200 rpm पर झटकों के साथ 32 डिग्री सेल्सियस पर कोशिकाओं हे / एन आगे बढ़ें।
      3. बाँझ क्रायो-ट्यूब में बाँझ 100% ग्लिसरॉल (अंतिम 50% वी / वी) के 500 μL के साथ हे / एन संस्कृति के 500 μL के मिश्रण से हे / एन से 3-5 ग्लिसरॉल शेयरों बनाओ। -80 डिग्री सेल्सियस पर स्टोर।
      4. इसके अलावा प्रोटोकॉल 3.1 प्रदर्शन XK1200 pOX38-टीसी Δgene :: सेमी पुनः संयोजक कोशिकाओं को उत्पन्न करने के लिए।
    3. XK1200 pOX38-टीसी Δgene :: सेमी + pK184-जीन और म्यूटेंट
      1. (कदम 2.2.4 से) electrocompetent XK1200 pOX38-टीसी Δgene :: सेमी कोशिकाओं को तैयार।
      2. उधर हाथी के 50 μL में pK184-जीन या pK184-जीन उत्परिवर्ती plasmids के 300 एनजी electroporatectrocompetent XK1200 pOX38-टीसी Δgene कदम के रूप में प्रति :: सेमी कोशिकाओं 2.1.4-2.1.7। सभी चयनात्मक मीडिया 10 माइक्रोग्राम / एमएल nalidixic एसिड (एनएएल), 20 माइक्रोग्राम / एमएल सेमी, और 50 माइक्रोग्राम / एमएल किमी शामिल करना चाहिए और 37 डिग्री सेल्सियस पर incubated किया।
      3. एक संगठन तैयार / XK1200 pOX38-टीसी Δgene के एन :: एक बाँझ पिपेट या पाश के साथ कोशिकाओं की एक अलग कॉलोनी कटाई, और नल, 20 माइक्रोग्राम / एमएल के साथ एक 20 एमएल बाँझ लेग मीडिया inoculating द्वारा सेमी + pK184-जीन पुनः संयोजक कोशिकाओं सेमी और 50 माइक्रोग्राम / एमएल किमी। क्षेत्र बाँझ रखें और एक लौ के पास काम करते हैं। 200 rpm पर झटकों के साथ 37 डिग्री सेल्सियस पर कोशिकाओं हे / एन आगे बढ़ें।
      4. बाँझ क्रायो-ट्यूब में बाँझ 100% ग्लिसरॉल (अंतिम 50% वी / वी) के 500 μL के साथ हे / एन संस्कृति के 500 μL के मिश्रण से हे / एन से 3-5 ग्लिसरॉल शेयरों बनाओ। -80 डिग्री सेल्सियस पर स्टोर।

    3. संयुग्मी संभोग Assays

    1. संयुग्मी संभोग XK1200 pOX38-टीसी Δgene :: सेमी कोशिकाओं को उत्पन्न करने के लिए
      1. एक 20 एमएल बाँझ लेग हे / एन संस्कृति तैयारDY330R pOX38-टीसी Δgene की संरचना :: एक बाँझ पिपेट या पाश का उपयोग करके सेमी + pK184-जीन कोशिकाओं टीका लगाना एक 20 एमएल बाँझ लेग एक ग्लिसरॉल शेयर या एक पर एक कॉलोनी के साथ 20 माइक्रोग्राम / एमएल सेमी और 50 माइक्रोग्राम / एमएल किमी युक्त अगर प्लेट। 200 rpm पर झटकों के साथ 32 डिग्री सेल्सियस पर आगे बढ़ें। 10 माइक्रोग्राम / एमएल नल के साथ 20 एमएल बाँझ लेग में XK1200 कोशिकाओं के लिए ही तैयार, 37 डिग्री सेल्सियस पर बढ़ रहा है।
      2. अलग से एक ही एंटीबायोटिक सामग्री के साथ बाँझ लेग के 2 एमएल में प्रत्येक संस्कृति के 1:70 dilutions बनाओ; सभी दाता कोशिकाओं के लिए 100 मिमी की एक अंतिम एकाग्रता के लिए ग्लूकोज को जोड़ने। 200 rpm पर झटकों के साथ 37 डिग्री सेल्सियस पर मध्य लॉग चरण (600 आयुध डिपो 0.5-0.7) के लिए कोशिकाओं को विकसित।
      3. अपकेंद्रित्र गोली कोशिकाओं, सतह पर तैरनेवाला त्यागें, ठंड बाँझ लेग के साथ एक बार धोने के 2 एमएल ठंड बाँझ पौंड में एंटीबायोटिक दवाओं, और resuspend कोशिकाओं को दूर करने के लिए (4000 XG 5 4 डिग्री सेल्सियस पर मिनट)
      4. अशेष बाँझ लेग मीडिया के 800 μL में प्रत्येक संस्कृति के 100 μL और उन्हें मिलाते हुए बिना 1 घंटे के लिए 32 डिग्री सेल्सियस पर दोस्त के लिए अनुमति देते हैं।
      5. <li> भंवर 30 एस के लिए कोशिकाओं संभोग जोड़े को बाधित और आगे संभोग को रोकने के लिए 10 मिनट के लिए बर्फ पर उन्हें जगह है।
      6. अशेष 100 एक अगर प्लेट 10 माइक्रोग्राम / एमएल नल और 20 माइक्रोग्राम / एमएल सेमी युक्त XK1200 pOX38-टीसी Δgene :: सेमी कोशिकाओं के लिए चयन करने के लिए पर सेल मिश्रण की μL। एक बाँझ स्प्रेडर का उपयोग कोशिकाओं बिखरा हुआ है। क्षेत्र बाँझ रखें और एक लौ के पास काम करते हैं। Incubated प्लेट हे / एन 37 डिग्री सेल्सियस ऊपर से नीचे पर।
      7. नई XK1200 pOX38-टीसी Δ जीन का एक भी कॉलोनी हार्वेस्ट :: सेमी नॉकआउट तनाव एक बाँझ पिपेट या पाश और के साथ 20 माइक्रोग्राम / एमएल सेमी, हे / एन बाँझ लेग में बढ़ने पर प्रयोग 200 rpm पर झटकों के साथ 37 डिग्री सेल्सियस। बाँझ क्रायो-ट्यूब में बाँझ 100% ग्लिसरॉल (अंतिम 50% वी / वी) के 500 μL के साथ हे / एन संस्कृति के 500 μL के मिश्रण से हे / एन से 3-5 ग्लिसरॉल शेयरों बनाओ। -80 डिग्री सेल्सियस पर स्टोर।
        नोट: परिणामी कोशिकाओं को अब सक्षम हैं pK184-जीन निर्माणों (प्रोटोकॉल 1.3 और 1.4) के लिए गधा के साथ परिवर्तन के लिए सक्षम बना दिया जाएक्षमता पर जीन और उसके म्यूटेंट essing प्रोटोकॉल 3.2 में संयुग्मी हस्तांतरण ठीक करने के लिए।
    2. संयुग्मी संभोग परख XK1200 दाताओं से MC4100 प्राप्तकर्ताओं को
      1. एक हे / XK1200 pOX38-टीसी Δgene के एन संस्कृति तैयार :: सेमी + pK184-जीन एक अगर प्लेट और बाँझ पर 50 माइक्रोग्राम / एमएल स्ट्रेप्टोमाइसिन के साथ 5 एमएल लेग में 20 माइक्रोग्राम / एमएल सेमी, 50 माइक्रोग्राम / एमएल किमी और MC4100 कोशिकाओं (एस) एक ग्लिसरॉल स्टॉक या एकल कॉलोनी से कोशिकाओं का उपयोग के साथ बाँझ लेग के 20 एमएल में कोशिकाओं पिपेट या पाश। पर संस्कृतियों आगे बढ़ें 200 आरपीएम झटकों के साथ 37 डिग्री सेल्सियस।
      2. अलग से एक ही एंटीबायोटिक दवाओं के साथ बाँझ लेग के 2 एमएल में प्रत्येक हे / एन संस्कृति से 1:70 dilutions बनाओ। सभी दाता कोशिकाओं के लिए 100 मिमी की एक अंतिम एकाग्रता के लिए ग्लूकोज जोड़ें। 200 rpm पर झटकों के साथ 37 डिग्री सेल्सियस पर मध्य लॉग चरण (600 आयुध डिपो 0.5-0.7) के लिए कोशिकाओं को विकसित।
      3. अपकेंद्रित्र गोली कोशिकाओं, सतह पर तैरनेवाला त्यागें, antibio दूर करने के लिए ठंड बाँझ लेग के साथ एक बार धोने के लिए (4000 XG 5 4 डिग्री सेल्सियस पर मिनट)tics, और 2 मिलीलीटर ठंड बाँझ पौंड में resuspend कोशिकाओं
      4. दो प्रतियों में, विभाज्य बाँझ लेग मीडिया के 800 μL में प्रत्येक संस्कृति के 100 μL और उन्हें मिलाते हुए बिना 1 घंटे के लिए 37 डिग्री सेल्सियस पर दोस्त के लिए अनुमति देते हैं।
      5. भंवर 30 एस के लिए कोशिकाओं संभोग जोड़े को बाधित और आगे संभोग को रोकने के लिए 10 मिनट के लिए बर्फ पर उन्हें जगह है।
      6. कदम 3.2.2 और ताजा बाँझ लेग से मध्य लॉग संस्कृतियों का प्रयोग, 10 -7 के लिए 10 -2 से दाता और प्राप्तकर्ता कोशिकाओं के 6 धारावाहिक dilutions तैयार करते हैं।
      7. एक अगर प्लेट 10 माइक्रोग्राम / एमएल नाल, 20 माइक्रोग्राम / एमएल सेमी और 50 माइक्रोग्राम / एमएल किमी युक्त के दो हिस्सों, हाजिर XK1200 दाता कोशिकाओं में से प्रत्येक के कमजोर पड़ने के 10 μL aliquots, में से प्रत्येक पर चित्रा 2 में दिखाया गया है। 50 माइक्रोग्राम / एमएल एस.एम. युक्त अगर प्लेटों पर प्राप्तकर्ता MC4100 कोशिकाओं के dilutions के लिए दोहराएँ। 37 डिग्री सेल्सियस पर प्लेटों हे / एन सेते हैं।
      8. कदम 3.2.5 और ताजा बाँझ लेग से vortexed मिश्रण का प्रयोग, 6 dilutions (10 -2 10 -7 के लिए तैयार चित्रा 2 के रूप द्वारा transconjugant के लिए चयन करें MC4100 pOX38-टीसी Δgene :: सेमी कोशिकाओं। दोनों डुप्लीकेट मिश्रण के लिए दोहराएँ। क्षेत्र बाँझ रखें और एक लौ के पास काम करते हैं। 37 डिग्री सेल्सियस पर प्लेटों हे / एन सेते हैं।
      9. प्रोटोकॉल 3.3 में वर्णित के रूप में प्रत्येक निर्माण के संभोग क्षमता का निर्धारण।
      10. इस प्रोटोकॉल दोहराएँ सभी वसूली plasmids विकार की दक्षता पर एक विशेष उत्परिवर्तन के प्रभाव का मूल्यांकन करने के लिए।
    3. संभोग क्षमता की गणना
      1. प्रत्येक दाता, प्राप्तकर्ता और उनके संबंधित प्लेटों पर transconjugant कोशिकाओं के लिए एक ही कमजोर पड़ने खोलना से कालोनियों की संख्या की गणना।
      2. प्राप्तकर्ता कालोनियों गणना किसी भी पूर्वाग्रह है कि यह देखते हुए कि कमजोर पड़ने पर प्राप्तकर्ताओं से transconjugants की एक बड़ी संख्या होने से नतीजा होगा परीक्षण करने के लिए।
      3. सीदाता कालोनियों की संख्या से विभाजित transconjugant कालोनियों की संख्या के रूप में संभोग दक्षता alculate। 100 से गुणा 100 दाता कोशिकाओं प्रति दक्षता मूल्य प्राप्त करने के लिए।

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    एफ प्लाज्मिड संचालित बैक्टीरियल विकार की प्रक्रिया एक समन्वित प्रक्रिया है कि एफ प्लाज्मिड कि एक T4SS pilus संश्लेषण और संयुग्मी डीएनए हस्तांतरण की सुविधा के लिए assembles के टीआरए क्षेत्र के भीतर हस्तांतरण प्रोटीन शामिल है। प्रोटीन traf (परिग्रहण # BAA97961; UniProt आईडी P14497) संयुग्मी एफ pilus गठन के लिए आवश्यक है। 10,14,35 - हालांकि यह उत्प्रेरक CXXC मूल भाव नहीं है 37 प्रोटीन, एक सी टर्मिनल thioredoxin-जैसे डोमेन में शामिल है। 35,38 हालांकि यह अपने एन टर्मिनल डोमेन के माध्यम से TraH प्रोटीन के साथ बातचीत करने के लिए भविष्यवाणी की गई है, 39 एक क्षेत्र से 37 ज्यादा नहीं है और प्रोटीन की ढांचागत सुविधाओं के बारे में जाना जाता है अपनी सी टर्मिनल डोमेन की तुलना में अधिक गतिशील, होना दिखाया। संरचनात्मक अध्ययन के साथ संयोजन के रूप में traf प्रोटीन के कार्यात्मक पहलुओं का आकलन करने के लिए, हम पहली बार बाहर traf जीन pOX38-टीसी पर मुताबिक़ के माध्यम से दस्तक दीपुनर्संयोजन, ई कोलाई DY330R कोशिकाओं में pOX38-टीसी ΔtraF :: सेमी प्लाज्मिड (तालिका 1) पैदा होता है। 33,34 भी उत्पन्न से traf विशिष्ट प्राइमरों (तालिका 2) pK184-traf प्लाज्मिड विकार की वसूली प्रदान करते हैं और प्रोटीन के अनुक्रम की जांच कर रही सक्षम करने के लिए किया गया था। XK1200 कोशिकाओं 40 DY330R कोशिकाओं से में pOX38-टीसी ΔtraF :: सेमी प्लाज्मिड के हस्तांतरण जब pK184-traf ट्रांस में प्रदान किया गया (transconjugants 10 माइक्रोग्राम / एमएल नल पर हो, 10 माइक्रोग्राम / एमएल टीसी और 20 माइक्रोग्राम / एमएल सेमी) को इंगित करता है कि (क) pOx38-टीसी ΔtraF :: मुख्यमंत्री में traf पीटकर एक में फ्रेम कैट कैसेट प्रदान करता है, और (ख) कि pK184-traf संयुग्मी समारोह बहाल कर सकते हैं।

    Traf म्यूटेंट की एक श्रृंखला संयुग्मी संभोग परख 37 XK1200 pOX38-टीसी ΔtraF :: सेमी + pK184-traf ΔX का उपयोग कर का उपयोग कर विश्लेषण के लिए उत्पन्न किया गयाकोशिकाओं और MC4100 कोशिकाओं 41 दानदाताओं और प्राप्तकर्ताओं, क्रमशः के रूप में। एक प्रतिनिधि उत्परिवर्ती traf 55-247 (तालिका 1), एक एन टर्मिनल विलोपन उत्परिवर्ती निकालता है कि प्रोटीन के क्षेत्र TraH के साथ बातचीत करने की भविष्यवाणी की है। पूर्ण लंबाई traf प्रोटीन दाता कोशिकाओं के लिए प्रदान किया जाता है, संयुग्मी हस्तांतरण, (चित्रा 2) बहाल करते हुए खाली प्लाज्मिड pK184 उपलब्ध कराने (3 टेबल) नहीं करता है। इसी तरह, XK1200 दाता कोशिकाओं में संयुग्मी समारोह बहाल नहीं किया जाता है, जब प्लाज्मिड pK184-traf 55-247 (तालिका 3) के साथ प्रदान की। यह इंगित करता है संयुग्मी तंत्र के भीतर traf के समारोह के लिए महत्वपूर्ण है कि प्रोटीन का छोटा क्षेत्र है, TraH के साथ बातचीत के माध्यम से होने की संभावना है, और आगे mutational विश्लेषण के लिए लक्षित करने प्रोटीन का एक क्षेत्र है।

    आकृति 1
    ट्रांस में प्रदान की जाती है विकार की सुविधा के लिए असमर्थ है बंदरगाहों। परिणामी pOX38-टीसी Δgene :: सेमी प्लाज्मिड जीन एक MC4100 प्राप्तकर्ता (चरण 3) के साथ संभोग assays का उपयोग के आगे मूल्यांकन के लिए एक XK1200 तनाव (चरण 2) को सौंप दिया है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

    चित्र 2
    चित्रा 2: चटाईआईएनजी परख विकार में लक्ष्य जीन के समारोह का आकलन करने के लिए। दाता और प्राप्तकर्ता कोशिकाओं ई कोलाई XK1200 pOX38-टीसी ΔtraF :: मुख्यमंत्री क्रमश: pK184-traf और MC4100 के साथ तब्दील हो गया। जिसके परिणामस्वरूप transconjugants (MC4100 pOX38-टीसी ΔtraF :: सेमी) एस.एम. और मुख्यमंत्री युक्त प्लेटों पर हो जाना, संयुग्मी समारोह के सफल वसूली का संकेत है। प्रयोग एक भी अगर प्लेट पर दो प्रतियों में किया जाता है, और धारावाहिक dilutions आदेश दृढ जीन म्यूटेंट (तालिका 2) के संभोग दक्षता की गणना में इस्तेमाल किया जाता है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

    बैक्टीरियल तनाव / प्लाज्मिड प्रासंगिक विशेषताओं चयनात्मक मार्कर (s) संदर्भ
    जीवाणु उपभेद
    DY330R W3110 ΔlacU169 gal490 λc1857 Δ (सीआरओ-bioA) राइफल्स आर राइफल्स 33,34
    XK1200 एफ - lacΔU124 Δ (जैव Gyra attλ नाडा aroG लड़की) नल 40
    MC4100 araD139 Δ (argF-एलएसी) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR एस.एम. 41
    वैक्टर और constructs
    pBAD33 पी araBAD से के तहत अभिव्यक्ति के लिए प्लाज्मिड से.मी 32
    pK184 2.4 केबी क्लोनिंग वेक्टर, p15a replicon किमी 31
    pK184-traf </ Td> pK184 में pOX38 से एफ traf किमी 35
    pK184-56-247 traf एफ traf हूँ 56-247 pK184-traf से किमी
    संयुग्मी प्लास्मिड
    pOX38-टीसी IncFI, ट्रा +, RepFIA +, एफ, मिनी तमिलनाडु की F1 HindIII टुकड़ा टीसी 29,30
    pOX38-टीसी ΔtraF :: सेमी बिल्ली के साथ pOX38-टीसी traf में डाला टीसी सेमी 35
    † सेमी, chloramphenicol; किमी, केनामाइसिन; एनएएल, nalidixic एसिड; राइफल्स, रिफैम्पिसिन; एस.एम., स्ट्रेप्टोमाइसिन; टीसी, टेट्रासाइक्लिन
    ‡ सभी traf निर्माणों 19-अवशेषों नेता अनुक्रम periplasmic अंतरिक्ष के लिए स्थानीयकरण सुनिश्चित करने के लिए होते हैं।

    तालिका एक: उपभेदों और plasmids इस अध्ययन में इस्तेमाल किया।

    निर्माण प्राइमर *
    Traf सेमी के लिए 5'- GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC -3 '
    Traf सेमी रेव 5'- TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG -3 '
    pK184-Traf-के लिए 5'- TTTTTT GAATTC TATGAATAAAGCATTACTGCCAC -3 '
    pK184-Traf-प्रका 5'- TTTTTT AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA -3 '
    pK184-traf 55-247 के लिए इस 5'- TACG CATATG ATGGCCGCACTGCAGACGG -3 '
    pK184-55-247 traf 5'- TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA -3 '
    † टेबल Lento एट अल से अनुकूलित। 2016 35 अनुमति के साथ
    * Traf overhanging क्षेत्रों italicized रहे हैं। प्रतिबंध एंजाइम साइटों को रेखांकित कर रहे हैं (HindIII: AAGCTT, EcoRI: GAATTC, NdeI: CATATG)

    तालिका 2: इस अध्ययन में इस्तेमाल प्राइमरों की एक सूची।

    प्लाज्मिड दाता † वसूली प्लाज्मिड Transconjugants ‡ § (कोशिकाओं एमएल -1) संभोग Efficiency§ ||
    pOX38-टीसी ΔtraF :: सेमी कोई नहीं 0 0
    pOX38 टीग ΔtraF :: सेमी pK184 0 0
    pOX38-टीसी ΔtraF :: सेमी pK184-traf 5 एक्स 10 3 0.0167
    pOX38-टीसी ΔtraF :: सेमी pK184-55-247 traf 0 0
    * टेबल Lento एट अल से अनुकूलित। 2016 35 अनुमति के साथ
    † दाता कोशिकाओं ई कोलाई XK1200 3 एक्स 10 7 कोशिकाओं एमएल के एक औसत एकाग्रता के साथ थे, -1
    ‡ प्राप्तकर्ता कोशिकाओं ई कोलाई MC4100 थे। सकारात्मक नियंत्रण के लिए transconjugants की संख्या एक 10-5 कमजोर पड़ने से है। 0 एक 10-2 कमजोर पड़ने से कोई transconjugants इंगित करता है।
    दो से चार संभोग प्रयोगों के §An औसत प्रत्येक निर्माण के लिए प्रदर्शन किया गया।
    || संभोग दक्षता defin है100 दाता कोशिकाओं प्रति transconjugants के रूप में एड। 0 संभोग दक्षता एक 10-2 कमजोर पड़ने से कोई transconjugants इंगित करता है

    तालिका 3: traf विलोपन निर्माणों द्वारा समाप्त कर दिया संभोग दक्षता।

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    बैक्टीरियल विकार प्रक्रिया एक साधन है जिसके द्वारा बैक्टीरिया ऐसे एंटीबायोटिक प्रतिरोध मार्करों के प्रसार के रूप में चुनौतीपूर्ण वातावरण में विकास के लिए एक विकासवादी लाभ प्रदान जीन फैल सकता है। क्योंकि संयुग्मी plasmids से कई तो बड़े हैं, संयुग्मी प्लाज्मिड पर ही लक्ष्य जीन उत्परिवर्तन के माध्यम से स्थानांतरण तंत्र की सभा में शामिल प्रोटीन पर 12 कार्यात्मक अध्ययन बोझल हैं। प्रोटोकॉल के साथ साथ विस्तृत एक साधन है जिसके द्वारा एक और अधिक आसानी से छोटे, अधिक प्रबंधनीय अभिव्यक्ति plasmids (चित्रा 1) के उपयोग के माध्यम से ब्याज का लक्ष्य जीन का आकलन कर सकते हैं। हम एफ प्लाज्मिड की मध्यस्थता विकार अध्ययन करने के लिए एफ प्लाज्मिड व्युत्पन्न pOX38-टीसी (तालिका 1) को रोजगार; अन्य संयुग्मी plasmids प्रोटोकॉल यहाँ विस्तृत और उचित व्युत्पन्न plasmids का उपयोग कर अध्ययन किया जा सकता है। संभोग उल्लिखित assays कुछ modificati साथ फ्रॉस्ट और उनके सहयोगियों, 42 से अनुकूलित किया गया हैons। पिछले अध्ययनों में, 8,33,42 pOX38-टीसी Δgene :: सेमी निर्माण के निर्माण के लिए उचित प्रतिबंध एंजाइमों के साथ ब्याज की जीन cleaving और pOX38-टीसी में परिलक्षित कैट कैसेट डालने से हासिल की थी। 42 वर्तमान पद्धति में, हम recombineering ई कोलाई तनाव DY330R 33,34 में मुताबिक़ पुनर्संयोजन लक्ष्य जीन पीटा और कैट कैसेट के साथ इसे बदलने के लिए रोजगार। इस परिणामी DY330R तनाव को शरण देने pOX38-टीसी Δgene :: सेमी जीन विशिष्ट पीटकर के लिए एक नियंत्रण के रूप में कार्य करने के लिए निर्माण की इजाजत देने का एक फायदा बाहर एफ T4SS pK184-जीन वसूली प्लाज्मिड का उपयोग कर हस्तांतरण की वसूली के माध्यम से संयुग्मी हस्तांतरण मध्यस्थता है । यह एक crisper-Cas9 पद्धति, 43 का उपयोग करते हुए नॉकआउट उत्पन्न करने के लिए संभव हो सकता है जब तक हम इस समय इस संभावना का पता लगाया है पर नहीं है।

    प्रक्रिया एफ व्युत्पन्न प्लाज्मिड pOX38-टीसी में एक जीन पीटा की पीढ़ी के साथ शुरू होता है (Figurई 1)। इस DY330R कोशिकाओं में मुताबिक़ पुनर्संयोजन (तालिका 1) के माध्यम से हासिल की है, इस तरह के DY329, DY331 और DY378 के रूप में इसी तरह की सुविधाओं के साथ अन्य नस्लों का भी इस्तेमाल किया जा सकता है। प्राइमर शुरू में pBAD33 प्लाज्मिड 32 से बिल्ली कैसेट बढ़ाना और उस लक्ष्य जीन (तालिका 2) के लिए विशिष्ट हैं ठिकानों overhanging शामिल पीसीआर तैयार कर रहे हैं; पीसीआर उत्पाद तो शरण pOX38-टीसी DY330R कोशिकाओं में electroporated है। मुताबिक़ पुनर्संयोजन नाकआउट प्लाज्मिड pOX38-टीसी Δgene :: सेमी जहां कैट कैसेट लक्ष्य जीन के भीतर में फ्रेम डाला जाता है, प्रभावी ढंग से T4SS विधानसभा और विकार में खलल न डालें, जबकि सेमी प्रतिरोध प्रदान उत्पन्न करता है। इसी समय, लक्ष्य जीन पीसीआर pOX38-टीसी से परिलक्षित और एक छोटे से अभिव्यक्ति प्लाज्मिड में डाला जाता है; इस प्रोटोकॉल में हम विधान अभिव्यक्ति के लिए pK184 उपयोग करते हैं, लेकिन एक लक्ष्य जीन की inducible अभिव्यक्ति के साथ एक प्लाज्मिड चुना सकता है अगर वांछित। pK184-जीन प्लाज्मिड तो तब्दील हो जाता हैDY330R pOX38-टीसी Δgene :: सेमी कोशिकाओं में, और इन कोशिकाओं को फिर दाताओं के रूप में स्थानांतरण करने के लिए pOX38-टीसी Δgene :: सेमी संभोग assays के लिए XK1200 कोशिकाओं में विकार के माध्यम से निर्माण किया जाता है। संभोग assays में, दाता और प्राप्तकर्ता कोशिकाओं XK1200 pOX38-टीसी Δgene :: मुख्यमंत्री और MC4100, क्रमशः रहे हैं। PK184-जीन वसूली प्लाज्मिड, साथ ही लक्ष्य जीन (विलोपन या बिंदु उत्परिवर्तन) की श्रृंखला म्यूटेंट, MC4100 प्राप्तकर्ता कोशिकाओं (चित्रा 2 के साथ, दाता कोशिकाओं के लिए प्रदान की जाती है संभोग बहाल, और अपनी क्षमता का निर्धारण करने के लिए अपनी क्षमता का आकलन करने के लिए ; 3 टेबल)।

    प्रक्रिया के लिए महत्वपूर्ण उचित दाता और प्राप्तकर्ता उपभेदों (तालिका 1), और उपयोग प्राइमरों के डिजाइन का इस्तेमाल होता है। डिज़ाइन किया गया प्रत्येक प्राइमर के लिए, वहाँ सामान्य दिशा निर्देशों का पालन किया जाना चाहिए रहे हैं। जब तक हम कड़ाई से 40-60% जीसी सामग्री के साथ पालन करने के लिए कोशिश करते हैं, यह हमेशा संभव नहीं हो सकता है। ऐसे मामलों में, यह प्रयोगकर्ता की एक किताब डब्ल्यू परीक्षण करने के लिए विवेक हैथोड़ा नीचे या इस सीमा से ऊपर ith जीसी सामग्री। आगे और रिवर्स प्राइमर के पिघलने के तापमान (टी एम) के समान होना चाहिए, और annealing तापमान (टी ए) मूल्य हमेशा पीसीआर के लिए 2-5 डिग्री सेल्सियस से टी मीटर से कम होना चाहिए। मुक्त ऊर्जा विकसित करने के लिए टी एक की तुलना में काफी कम होना चाहिए एक बाल के लिये कांटा इजाजत देने के लिए उपलब्ध है, जबकि होमो और hetero- dimerization टी एम के बहुत कम होना चाहिए (कम से कम -10 जूल और 30 डिग्री सेल्सियस)। प्राइमर के रूप में वांछित विलोपन, सम्मिलन या बिंदु उत्परिवर्तन की जांच के लिए तैयार किया जा सकता। यह निश्चित रूप से महत्वपूर्ण है कि परिणामी जीन का निर्माण प्रवर्धित और वसूली प्लाज्मिड में फ्रेम ऐसी है कि यह ठीक से व्यक्त किया जाता है में ligated किया है। सक्षम कोशिकाओं के परिवर्तन electrocompetent या रासायनिक सक्षम कोशिकाओं का उपयोग कर electroporation या गर्मी झटका के माध्यम से किया जा सकता है, क्रमशः। हम पाते हैं कि इस तरह के electroporation pOX38-टीसी और मुताबिक़ पुनर्संयोजन oligonucle के रूप में बड़ा निर्माणों के लिए और अधिक कुशल हैotide, ऐसे pK184-traf के रूप में छोटे अभिव्यक्ति plasmids आसानी से गर्मी झटका तरीकों का उपयोग कोशिकाओं में तब्दील किया जा सकता है। अंत में, यह याद है कि वहाँ प्रोटोकॉल भर में उपयोग में कई एंटीबायोटिक दवाओं के लिए किया जाएगा, के रूप में दोनों दाता और प्राप्तकर्ता उपभेदों अलग resistances कि संयुग्मी और वसूली plasmids पर कार्यरत लोगों से अलग कर रहे हैं की आवश्यकता होती है महत्वपूर्ण है।

    यहाँ वर्णित संभोग assays तकनीकों के अलावा, वहाँ अन्य तरीकों कि बैक्टीरियल विकार अध्ययन करने के लिए इस्तेमाल कर रहे हैं, उनके दृष्टिकोण में थोड़ा अलग हैं। क्षैतिज जीन स्थानांतरण एक प्रक्रिया है, जहां बैक्टीरिया interspecies प्राप्तकर्ताओं सहित एक प्राप्तकर्ता सेल, के लिए एक प्लाज्मिड हस्तांतरण है। 44 Dahlberg और उदाहरण के लिए सहयोगियों 44 ने एक अध्ययन में बैक्टीरियल विकार इस्तेमाल किया interspecies क्षैतिज जीन स्थानांतरण की सीमा निर्धारित करने के लिए। वे एक प्लाज्मिड KT2442 कोशिकाओं में क्लोन में हरी फ्लोरोसेंट प्रोटीन (GFP) के समावेश के लिए उपयोग; गुणसूत्र एलKT2442 कोशिकाओं में एसी मैं क्यू जीन GFP अभिव्यक्ति को दबाने। प्लाज्मिड ले जाने GFP लाख मैं क्यू जीन के बिना एक प्रजाति को हस्तांतरित किया जाता है, प्रतिदीप्ति मनाया जाता है। 44 अपनी सीमा विभिन्न प्रजातियों में प्रोटीन विशेष समारोह में प्रदान करने के बावजूद, interspecies विकार प्रयोग संभवतः यहाँ प्रस्तुत विभिन्न प्रजातियों के बीच प्रोटीन, प्रोटीन बातचीत के लिए विकासवादी भविष्यवाणी करने के लिए प्रोटोकॉल के साथ मिलकर किया जा सकता है।

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    लेखकों घोषणा की कि वे कोई प्रतिस्पर्धा वित्तीय हितों की है कि।

    Acknowledgments

    इस शोध कनाडा के प्राकृतिक विज्ञान और इंजीनियरिंग परिषद से एक डिस्कवरी अनुदान (NSERC) द्वारा समर्थित किया गया।

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics