Bakteriyel Konjugasyon ilgilendim Transferi Proteinlerin Dizi özgü Analiz konjugatif Çiftleşme Tahliller

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Mikro-organizma düzeyinde genler ve proteinlerin transferi bakteriyel hayatta kalma ve evrim yanı sıra enfeksiyon süreçlerinde önemli bir rol oynar. bakteriler arasında ya da bir bakteri, bir hücre arasındaki DNA değişimi dönüşümü, konjugasyon veya vektör iletimi yoluyla elde edilebilir. 1,2 Konjugasyon Escherichia coli gibi gram negatif bakteriler arasında konjugasyon sırasında dönüşüm ve transdüksiyon kıyasla benzersizdir, DNA transferi kompleks makromoleküler sistemi, verici ve alıcı hücrelerin birbirine bağlayan ve böylece bir verici-kontrollü bir şekilde meydana gelir. Konjugasyon ayrıca bakteri hücrelerinin ana bilgisayar sistemleri için genler, proteinler veya kimyasal enjekte konak hücreleri ile etkileşim içinde en doğrudan yoludur. 3 Oldukça sık, bu tür maddelerin transferi evrimini ve adaptasyon barındırmak için patogenez ve karsinogenez arasında değişen ana bilgisayarda olağanüstü etkileri vardır. O konjugatif recombinatio gösterilmiştirn çevresel stres koşullarında yüksek mutasyon oranları ile bakterilerde adaptasyon 3 kat oranını artırır. 4 Dahası, konjugasyon bakteri türleri antibiyotik direnç genleri yayılır, üzerinden kadar en yaygın yol kullanılarak verilir. 5,6

Mikroorganizmalar hücre zarları arasında makromoleküllerin transferini desteklemek için özel salgı sistemlerinin geliştiğini; tarif edilmiştir de gram negatif bakterilere salgılama sistemleri (TSSler) 9 tip şu anda: T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS, hem de SEC (sekresyon) ve Tat (iki arginin translokasyon) yollar. Salgı sistemi 7,8 Her tür daha farklı bakteri suşları nedeniyle protein çeşitliliği ve ilgili yolların ayırt edicilik için, farklı alt tipe bir zorunluluk ayrılmıştır. Örneğin, tip IV sekresyon sistemi (T4SS) 'de, Ti ve Çağ sistemleri F-plazmid ise efektör taşımacılığının kolaylaştırılması, R27 and pKM101 T4SSs bir konjugatif plazmid transferini kolaylaştırmak. Organizmaların bir alıcı ya da çevresindeki çevre ile hücresel içeriği kendi bileşen proteinlerden kendi salgı sistemlerini monte ve paylaşmak hangi mekanizmaların 7,9,10 ayrıntılı bir anlayış patojen mikroorganizmaları ve süreçlerini mücadele etmek için hedeflenen stratejilerin geliştirilmesinde önemli bir faktördür hücresel enfeksiyon.

Lederberg ve Tatum, 11 E. coli içinde, ilk kimlik bakteriyel konjugasyon aşağıdaki mobil ve birleştirici plazmit, çok sayıda belirlenmiş ve karakterize edilmiştir. 12 Bu tür mobil plazmidler ancak tüm mobil plazmidler transferi (oriT) böylece plazmid aktarımını sağlayan kökenini tanıyan bir relaxase içeren, kayda değer aralığı (1 200'den fazla kilobaz (kb) için) boyutu olduğunu gösteriyor. Konjügatif fonksiyonel T4SS montajı için plazmidler daha kodlayan genler aynı zamanda bir türIV birleştirme proteini. 12 Örneğin, E. coli 100 kb F plazmid bir 33.3 kB transferi (tra) bölgedeki tüm konjugatif genleri kodlar. 13 çifti oluşumu (Mpf), DNA transferi ve dışlama fonksiyonlarını çiftleşme pilus oluşumunu kolaylaştırmak tüm proteinler, konjugatif plazmid transferi sırasında F plazmid kodlamak tra bölgesinde genler. 10,14,15 bilginin önemli bir vücut konjugatif T4SSs için kullanılabilir, ancak sadece son zamanlarda kullanılabilir hale gelmektedir konjugatif protein ve komplekslerinin yapısal çalışmalar detaylı. 16-28

konjugatif işlem kapsamlı bir görünümünü monte etmek için, eş transfer proteinlerinin analiz mutasyon için, ayrıntılı yapısal çalışmaların bir bağlantı gereklidir. Bu konjugatif çiftleşme deneyleri ile elde edilebilir. F plazmid için tra bölge içinde kodlanan her protein F aracılı co bir rol oynarnjugation; Bu nedenle, bir transfer geninin nakavt / silme hücre (Şekil 1) konjugatif kapasitesini ortadan kaldıracaktır. küçük mobil plazmidler, F gibi daha büyük konjugatif plasmidler için, standart silme işlemleri için elverişli iken hedef gen, bir farklı antibiyotik dirençli bir gen taşıyıcı ile değiştirilmiş olduğu, bir gen nakavt daha kolay homolog rekombinasyon yoluyla elde edilir. Geçerli protokol, 55 kb F plazmid türevi pOX38-Tc kloramfenikol asetiltransferaz (CAT) ile ilgi bir transfer geni yerine homolog rekombinasyon istihdam; 29,30 Elde edilen nakavt plasmid pOX38-Tc Δgene :: Cm büyüme ortamında kloramfenikol varlığında (cm) karşı direnç kolaylaştırır. pOX38-Tc Δgene :: Cm barındıran donör hücreleri bir çiftleşme testinin kullanımı yoluyla gözlemlenen konjugatif DNA transferi / çiftleşme etkileyecek edemiyoruz; Bir pOX38-Tc Δgene :: Cm donör hücre çiftleşme verimliliği ve normal bir tilki kuyruğusağ- lasa daha sık, kaldırılmasını, azaltmak veya edecektir. pOX38-Tc Δgene :: Cm plazmid konjugatif transferi hedeflenen transferi genini barındıran küçük bir iyileşme plazmid aracılığıyla restore edilebilir. Bu kurtarma plazmid gibi plazmid pK184 (pK184-gen), 31 ya da çok uzun plazmid düzgün hücre (sitoplazma veya periplasmasında) içinde doğru konuma geni hedef olarak uyarılabilir ifade sağlayan biri olarak, kurucu ifade sağlar biri olabilir. Sonuç olarak, bu yeni verici arasındaki birleşme deneylerinde (pOX38-Tc Δgene :: Cm + pK184-geni plazmidler) ve bir alıcı hücre, çiftleşme verimi neredeyse o normal bir alıcı ve verici arasındaki çiftleşme testinin geri yüklemek için bekleniyor. Bu sistem, pK184-gen yapılarına (silme ya da nokta mutasyon) bir dizi nesil boyunca elendikçe genin işlevini prob ve pOX38-Tc Δgene :: Cm barındıran birleşme kapasitesini yeniden kazandırmak için, her yapı yeteneğini test edilmesine imkan verici hücres.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

DNA yapılan, 1. Üretim

  1. Hedef genin homolog rekombinasyon için oligomerler Tasarımı
    1. Aşağıda, tek 55-72 bp ileri oligomer Tasarım: (a), kloramfenikol asetiltransferaz geni 5 'başlangıç ​​sitesinin yukarı bölgesi 10-100 bp bir DNA dizisine homolog olan bir 19-32 bp uzunlukta nükleotit sekansını çekme ticari pBAD33 plazmid olarak, 32 ve (b) bir bölge hedef genin 5 'başlangıç sitesinin alt 10-150 bp'lik bir 36-54 bp uzunlukta nükleotit sekansı homolog seçin ilgi.
      1. dizisi, (a), bu şekilde tek bir 55-72 kadar ileri doğru bir oligomer veren aldı nükleotidin 3 'ucundan (b) 5 için seçilmiş nükleotid dizisinin sonuna' katıl.
    2. Aşağıda, tek 55-72 bp ters oligomer Tasarım: (a) bölgesi 10-100 bp bir DNA dizisine homolog olan bir 19-32 bp uzunlukta nükleotit sekansını çekme aşağı3'ün ilgi hedef genin son sitesinde 'ticari pBAD33 plazmid kloramfenikol geni sonunda, ve (b) 3'ün memba 10-150 bp içinde bir bölgeye bir 36-54 bp uzun nükleotid dizisi homolog seçin' .
      1. dizisi toplanır nükleotidin 3 'ucundan 5 (b)' de seçilmiş nükleotid dizisinin sonuna '(a), tek bir oligomer oluşturmak için birleşim.
      2. mevcut herhangi bir biyoinformatik yazılımı içine bu oligomer kopyalayın ve ters tamamlayıcı içine dizisi dönüştürmek. Bu, tek bir 55-72 bp uzunluğunda ters oligomer verecektir.
    3. Mevcut herhangi bir oligo-analizör programı kullanarak, rekombinasyon oligomerleri% 40-60 arası GC içeriği, düşük firkete erime sıcaklığı (Tm), düşük, kendini-ve hetero-dimerizasyon Tm 'ın sahip olmadığını kontrol edin. herhangi bir tercih biyoteknoloji şirketi sentez ve sevkiyat için primerler sipariş.
  2. PBAD33 elde edilen CAT kaseti (Cm R amplifikasyonu
  3. 200 rpm'de ve 37 ° C de çalkalanarak 20 ug / ml kloramfenikol (cm) steril lizojeni suyu (LB) pBAD33 plazmid DH5α hücrelerinin bir gecelik (O / N, 16-18 saat) kültür büyütün.
  4. Oda sıcaklığında O / N kültürü santrifüj 6-8 mL, 3 dakika boyunca 5,000 x g. Süpernatant boşaltacaktır ve bir plasmid mini hazırlık kiti (Malzeme Tablo) ve üreticinin protokolü kullanılarak pelet pBAD33 plazmid ekstrakte edin.
  5. Verilen sırada steril tüp içine, aşağıdaki eklenerek pBAD33 plazmid DNA'nın bir özet fazlası: iki kez damıtılmış suyun uygun hacmi (GKD 2 O), 50 uL, pBAD33 plazmid 1 ug hacmi, 5 uL 10X nihai bir hacme kadar Aval kısıtlama enzimi enzim reaksiyon tamponu ve 0.5 uL (RE). Yavaşça pipetleme karışım ve reaksiyon, 37 ° C'de 1 saat boyunca devam edelim. Isı 80 ° C'de 20 dakika (dk) için bir reaksiyon inaktive° C. 24 saat daha uzun süre -20 ° C'de saklayın örnekleri yapışkan uç bozulmasını en aza indirmek için.
  6. 250 ml bir erlenmeyer şişe içinde tampon 1x TAE 100 mL (; 20 mM asetik asit, 1 mM EDTA, 40 mM Tris, pH 8.5) ile agaroz 1.2 g karıştırılarak jel ayırma% 1.2 agaroz hazırlayın. Isı ve girdap tamamen bir mikrodalga çözmek için. Sıvı kaynatın ve şişeyi girdap başladığında derhal ısıtma durdurun.
    1. Karıştırırken, oda sıcaklığında 3 dakika boyunca bir sıvı agaroz soğutun karıştırmak için 10 mg / ml etidyum bromid ve girdap 2 uL ilave edin. iyi olarak tarak ile jel tepsisine agaroz dökün ve oda sıcaklığında 1 saat boyunca katılaşmaya sağlar. 1x TAE tamponu içinde 2 gün süre ile, 4 ° C'de saklayın jeller.
  7. Her 1.2.3 dan pipetleme DNA yükleme boyası (50 uL reaksiyon başına boya 10 uL) 0.2 hacmi ile sindirmek RE karıştırın. iyi a başka içine 500 mg / ml DNA ilk kuyuya merdiven ve RE özeti-boya karışımının tüm yük 5 uLgarose jel. jel üzerine reaksiyon hacminde tüm yük 2-3 kuyu kullanın.
    1. tampon ve bir jel elektroforez aygıtı 65 dakika boyunca 45-50 V (4.5-5 V / cm) çalışan ancak 1x TAE batmış jel üzerinde çalıştırıldı.
  8. UV kabini ve steril bir jilet kullanarak, hızlı bir şekilde DNA'nın UV maruziyeti en aza indirmek için jel dışarı CAT dizisine karşılık 2.8 kb bandı kesti. Üreticinin protokolü bir jel özütleme kiti (Malzeme Tablo) ile kesik jel dilimine DNA ekstrakte edin.
    Not: doğrudan UV altında cilt ortaya çıkarmak ve dikkatle jilet işlemek için özen gösterin.
  9. Homolog rekombinasyon için izin vermek için bir gen sekansına benzer çıkıntılar içeren 1.1 tasarlanmış primerler kullanılarak polimeraz zincir reaksiyonu (PCR) ile 1.2.6 elde CAT kaseti yükseltin. PCR reaksiyonları aşağıdaki sırayla üretici yönergeleri (Malzeme Tablosu) kullanarak buz üzerinde kurulur:
    1. İçineSteril bir PCR tüpü, O PCR tamponu, 10 uL, 10 mM dNTP, 10 uM ileri primer 2.5 uL, 10 uM Ters primerden 2.5 uL 1 uL, ardından 50 uL nihai hacmi, GKD 2 uygun bir hacim kazandırmak , 1.2.6 şablon DNA 1-25 ng ve 100 birim / ul DNA polimerazı 0.5 uL.
    2. 1.2.7.1 olarak değil, şablon DNA hariç aynı komponentleri taşıyan bir negatif kontrol ayarlayın. Uygun bir GKD 2 O hacmi yerine şablon DNA kullanın. Şablon DNA ve üretici tarafından pozitif kontrol olarak sağlananlar gibi, bir PCR reaksiyonunda çalışma kanıtlanmıştır primerler kullanılarak, bir pozitif kontrol ayarlayın.
    3. pipetle yavaşça tüm reaksiyon içeriğini karıştırın.
    4. aşağıdaki ayarları kullanılarak PCR ile yükseltin: ilk denatürasyon 30 sn için 98 ° C 'de, denatürasyon 30 döngü 10 sn için 98 ° C, 20 s, amplikon kilobaz başına 20 s için uzatma primer tavlama 72 ° C'de ve en yüzgeç72 ° C'de 10 dakika boyunca ark uzantısı. -20 ° C'de saklayın örnekleri.
  10. Her bir reaksiyonun sadece 5 uL kullanılarak agaroz jel elektroforez ile amplifikasyon doğru boyutu (1.2.4-1.2.5 bakınız) teyit edin. PCR saflaştırma kiti kullanılarak ve imalatçının protokolü kullanılarak PCR amplikon saflaştırılır. Mağaza -20 ° C'de DNA saflaştırılmış.
  • PK184 gen kurtarma Plazmid
    1. onun 5 itibaren 'ucuna ve 3 doğru gidiyor' aşağıdaki sırayla sonunda bir ileri primer Tasarım: (a) bağlı 4 rastgele nükleotidleri bölünme verimliliği için (adenin, timin, guanin ve sitozin bir arada), pick (b) (c) başlangıç ​​kodonu dahil olmak üzere, söz konusu gen, 5 'ucuna homolog olan bir 21-25 bp uzunlukta nükleotid dizisi ve daha sonra, EcoRI kısıtlama enzimi (RE) bir kesme yerine dizisi (GAATTC). hedef genin bir EcoRI sitesi içeriyorsa, pK184 çoklu klonlama bölgesinin başka bir uygun RE seçin.
    2. periplazmik proteinleri kodlayan genlerin durumunda, RE ve ileri primerin start kodonu arasında ek bir lider seri ihtiva etmelidirler.
    3. Mevcut herhangi bir oligo-analizör kullanarak, primerler% 40-60 arası GC içeriği, düşük firkete Tm, düşük, kendini-ve hetero-dimerizasyon Tm 'ın sahip olmadığını kontrol edin. sentezi için primerler sipariş.
    4. steril LB 32 ° C ve 200 rpm'de çalkalanarak 10 ng / ml tetrasiklin (Tc) ihtiva eden DY330R pOX38-Tc hücrelerinin bir O / N kültür büyütün. Oda sıcaklığında O / N kültürü santrifüj 6-8 mL, 3 dakika boyunca 5,000 x g. DurusuSüpernatan bir plazmid mini hazırlık kiti (Malzeme Tablo) ve üreticinin protokolü kullanılarak pelet plazmid DNA ekstrakte edin.
    5. (1.2.7.1-1.2.7.3 bakınız) şablon olarak pOX38-Tc kullanarak 1.3.1-1.3.5 gelen primerleri ile ilgi dolu geni yükseltin.
    6. Her bir reaksiyonun sadece 5 uL kullanılarak agaroz jel elektroforez ile amplifikasyon doğru boyutu (1.2.4-1.2.5 bakınız) teyit edin. PCR saflaştırma kiti kullanılarak ve imalatçının protokolü kullanılarak amplifiye DNA saflaştırılır. -20 ° C'de DNA'yı saflaştırılmıştır.
    7. (. 1.3.7 arasında) ticari olarak temin edilebilen pK184 plazmidi DNA ve çoğaltılmış genin her ikisinin bir çift sindirimi, verilen sırada steril tüp içine, aşağıdaki eklenerek fazlası: GKD 2 O uygun hacmi 50 uL nihai hacme , pK184 plazmidi 1 ug hacmi, 5 uL 10 x enzim reaksiyon tamponu ve her EcoRI ve Hind III ile 1 uL.
      1. Yavaşça pipetleme karışım ve reaksiyon, 1 saat boyunca devam etmesine izin37 ºC'de. Isı 80 ° C'de 20 dakika boyunca reaksiyona etkisiz hale getirirler. 24 saat daha uzun süre -20 ° C'de saklayın örnekleri yapışkan uç bozulmasını en aza indirmek için.
        Not: Burada kullanılan kısıtlama nuclease tip adımlar 1.3.1 ve 1.3.2 primerler içine tasarlanmış olan kısıtlama nükleaz sitesinde bağlıdır.
      2. Bir reaksiyon tüpüne Arş tek eklemek dışında Bir pozitif kontrol olarak, 1.3.8 aynı reaksiyon hazırlanarak pK184 plazmidi tek digests ayarlayın. Her iki RES ile ayrı ayrı yapın.
    8. Çift pK184 ve gen hem fragmanları sindirimi DNA ekstrakte 1.2.4-1.2.5 protokoller kullanılarak% 1.2 agaroz jeli üzerinde digests başlat Çevrede 1.2.6 adımına göre yöntem.
    9. 3 vektör: 10x T4 DNA Ligaz Tamponu, 1 oluşan 100 ng DNA, toplam 2 pL: aşağıdaki sırayla steril tüp içine bileşenler eklenerek pK184 vektörüne gen ınsert Arter takın (pK184: geni) oran, GKD 2 O kadar bir20 uL, 1 uL T4 DNA ligazı toplam hacim. Bir negatif kontrol olarak, uç geni olmadan 100 ng vektör kullanarak benzer bir reaksiyon ayarlayın.
      1. Yavaşça bir mikropipet kullanılarak bütün reaksiyon içerikleri karıştırmak ve 25 ° C'de 30 dakika inkübe edilir. 65 ° C'de 10 dakika süre ile ligasyon reaksiyonu ısı inaktive ve buz üzerine yerleştirin.
    10. Buz üzerinde iken, pK184-geninin 15 mcL aşama Ligasyon reaksiyonu, steril 1.5 mL tüp içinde kimyasal olarak yetkin DH5α hücre 1.3.10 100 uL. Hafifçe pipetleme karıştırın ve 10 dakika boyunca buz üzerinde inkübe edilir. negatif kontrol numunesi için de yapın. Bir pozitif kontrol için, pBAD33 gibi bir plazmidin 20-100 ng kullanımı ve 50 uL DHα hücrelerine dönüştürmek.
    11. Doğrudan 42 ° C su banyosu içine buz örnekleri transferi ve 90 saniye boyunca inkübe edin. Bu hücreler, bir ısı şoku ve kullanıcıların plazmid DNA alma sağlar.
    12. geri başka bir buz üzerine yerleştirin hücreleri5 dakika sonra steril LB 900 mcL 125 rpm'de çalkalanarak 1 saat boyunca 37 ° C'de inkübe edin.
    13. 50 ug / ml kanamisin (Km) ihtiva eden bir agar plaka üzerine 1.3.13 her bağlanma reaksiyonundan örnek 100 uL hacim kısım ve steril bir dağıtıcı kullanarak hücreleri yayıldı. Pozitif kontrol levhası uygun antibiyotik sahip olmalıdır. Steril alanda tutmak ve alev yakınında çalışır. baş aşağı 37 ° C gecede inkübe plakası.
    14. Steril bir pipet veya bir halka ile tek bir hücre farklı bir koloni hasat ve 50 ug / ml Km'ye indirildi ile 20 ml steril LB inoküle. Steril alanda tutmak ve alev yakınında çalışır. 200 rpm'de çalkalanarak 37 ° C'de hücreler O / N büyütün.
    15. Steril cryo tüpler steril% 100 gliserol (son% 50 h / h), 500 uL O / N kültürünün 500 uL karıştırılarak dönüştürülmüş DH5α hücrelerinin 3-5 gliserol stokları sağlayın. -80 ° C'de saklayın.
    16. Oda sıcaklığında O da santrifüj 6-8 ml / N kültürü, 5,003 dakika boyunca 0 xg. Süpernatant boşaltacaktır ve bir plasmid mini hazırlık kiti (Malzeme Tablo) ve üreticinin protokolü kullanılarak pelet pK184 gen kazanım plazmid ekstrakte edin.
  • pK184 - Gen mutantlar
    Not: silmeleri, girmeleri ve / veya nokta mutasyonları için tasarlanmış primerler kolayca üreticilerin çevrimiçi mevcut araçları kullanarak oluşturulabilir.
    1. başlangıç ​​kodonu dahil olmak üzere, söz konusu gen, 5 'ucuna homolog olan bir 18-32 bp uzunlukta nükleotit sekansını çekme her ileri primer tasarımı. Her bir ileri primer uygun uzunluklarda N-terminal peptid fragmanları yoksun silme mutantları ile sonuçlanan, bir öncekinin 30-180 bp'lik alt tavlanan şekilde tasarım primerler.
    2. durdurma kodonu dahil olmak üzere, söz konusu genin 3 'ucuna homolog olan bir 18-32 bp uzunlukta nükleotit sekansını çekme suretiyle ters bir primer tasarımı. Bir içine bu astar kopyalayınny mevcut biyoinformatik programı ve ters tamamlayıcı içine dizisi dönüştürmek. Bu ters astardır.
      1. periplazmik proteinleri kodlayan genlerin durumunda, genin uç ve periplazmada protein ürününün uygun bir lokalizasyonu için gerekli olan 3 '5' dış yan yüzleri bir lider dizisinin sonu 'ters tamamlayıcı olan ters primer tasarımı.
    3. Mevcut herhangi bir oligo-analizör programı kullanarak, silme primerleri% 40-60 arası GC içeriği, düşük firkete erime sıcaklığı (Tm), düşük, kendini-ve hetero-dimerizasyon Tm 'ın sahip olmadığını kontrol edin. mevcut herhangi bir biyoteknoloji şirketi sentez ve sevkiyat için primerler sipariş.
    4. Şablon olarak Protokolde 1.3 elde edilen pK184-gen yapısını ve 1.2.7-1.2.8 yönergeleri kullanarak, PCR pK184-gen Ax amplikonları oluşturmak için adımlar 1.4.1-1.4.3 tasarlanmış primerler ile silme yapıları yükseltmek . Mağaza yükseltilmiş DNAT -20 ° C.
    5. Mevcut herhangi bir mutajenez kiti (Malzeme Tablosu) kullanılarak amplifiye yapı Arter.
    6. Standart bir ısı şok protokolü (1.3.11-1.3.13 bakınız) kullanarak kimyasal yetkili DH5α hücrelerine ayrı pK184-gen Ax ligasyonu her Transform.
    7. 50 ug / ml Km'ye indirildi ihtiva eden bir agar plaka üzerine 1.4.12 her bağlanma reaksiyonundan örnek 100 uL hacim kısım ve steril bir dağıtıcı kullanarak hücreleri yayıldı. Steril alanda tutmak ve alev yakınında çalışır. baş aşağı 37 ° C gecede inkübe plakası.
    8. Steril bir pipet veya bir halka ile tek bir hücre farklı bir koloni hasat ve 50 ug / ml Km'ye indirildi ile 20 ml steril LB ortamını aşılamak. Steril alanda tutmak ve alev yakınında çalışır. 200 rpm'de çalkalanarak 37 ° C'de hücreler O / N büyütün.
    9. (F steril% 100 gliserol, 500 uL O / N kültürünün 500 uL karıştırılarak dönüştürülmüş DH5α hücrelerinin 3-5 gliserol stokları yapmakinal% 50 h / h), steril cryo tüplerde. -80 ° C'de saklayın.
    10. Oda sıcaklığında O / N kültürü santrifüj 6-8 mL, 3 dakika boyunca 5,000 x g. Süpernatant boşaltacaktır ve pK184 geni Ax plazmid plazmid mini hazırlık kiti (Malzeme Tablo) ve üreticinin protokolü kullanılarak pelet oluşturmak ekstrakte edin. -20 ° C'de saklayın DNA.
  • pOX38-Tc Δgene 2. Nesil :: Cm Suşlar

    1. DY330R pOX38-Tc Δgene :: Cm Knockouts
      1. 10 ug / ml Tc içeren 10 ml steril LB DY330R pOX38-Tc hücrelerinin bir O / N kültür hazırlayın. 32 ° C ve 200 rpm'de kültürü O / N büyütün.
      2. Taze steril LB 20 ml O / N kültür 1:70 seyreltme yapmak Orta-log fazı (OD 600Nm 0.4-0.6) büyüme kadar 32 ° C'de hücreleri büyütün.
      3. çalkalanan bir su ba içinde bir steril şişeye kültür devri 10 mL ve 150 rpm'de 15 dakika boyunca 42 ° C'de inkübeinci. Bu DY330R rekombinasyon spesifik proteinlerin ekspresyonunu neden olacaktır.
      4. 10 dakika için bir buz-su banyosu içinde kültür Chill. şu şekilde elektro-hücre hazırlama.
        1. 4 ° C'de 7 dakika boyunca 4.000 xg'de önceden soğutulmuş konik tüpler ve santrifüj içine soğutulmuş hücreleri aktarın. Gelecek adımda kullanılacak olan boru ve pipetler, 4 ° C'de yerleştirilmelidir veya buz üzerinde soğumaya.
        2. Buz soğukluğunda GKD 2 O başka bir 30 mL ekleme Süpernatantı ve yavaşça buz soğukluğunda GKD 2 O. 1 mL hücrelerin yeniden süspansiyon haline getirildi
        3. Santrifüj hücreleri (4000 xg, 7 dakika, 4 ° C), süpernatant atılır ve yavaşça buz soğukluğunda GKD 2 O 1 mL hücrelerin yeniden süspansiyon haline getirildi
        4. 4 ° C'de 1 dakika boyunca 15,000 xg'de önceden soğutulmuş 1.5 ml mikrofüj tüplerine ve santrifüje Yeniden süspanse edilen hücreler aktarın.
        5. Yavaşça 50 uL hacim buz soğukluğunda GKD 2 O ve kısım 200 uL pelet tekrar süspanse edilir. Electrocompetent hücreleri, -80 ° C'de saklanabilir
      5. Yukarı ve aşağı pipetleme yavaşça buz üzerinde karıştırılarak elektro DY330R pOX38-Tc hücreleri 50 uL içinde 1.2 amplifiye CAT kasetinin 300 ng ekleyin. Bir pozitif kontrol olarak, modifiye edilmemiş pBAD33 plasmidi kullanılarak yineleyin.
      6. önceden soğutulmuş (-20 ° C), 1 mm elektroporasyon küvetine hücreleri aktarın. bir elektro-kullanarak, 5.5 ms'lik bir zaman sabiti ile 1.8 kV hücrelerini elektroporasyona. Hemen palsı uygulanarak sonra 1 ml SOC ortamı hücreleri seyreltilmesi ve yeni bir mikrofüj tüpe aktarın. 2 saat boyunca 32 ° C'de inkübe hücreleri.
      7. 10 ug / ml Tc ve 20 ug / ml Cm ihtiva eden steril bir dağıtıcı kullanılarak yayıldı agar plakaları üzerine her örnek kısım 100 uL. Steril alanda tutmak ve alev yakınında çalışır. Başarılı yeniden bileşenler için seçmek için baş aşağı 32 ° C gecede inkübe plakası. hücreye sokulan CAT kaset homolog yeniden uğrayacaktırilgili gen ile kombinasyonu DY330R pOX38-Tc Δgene :: Cm (RIF R Tc R Cm R) klonu yaratmak.
        Not: yüksek sıcaklıklarda uzun süreli büyüme öncesi elektro hücrelerin üretilmesi için Adım 2.1.3 42 ° C 'de 15 dakika indüksiyon hariç olmak üzere, 32 ° C'de DY330R hücreleri büyütmek için önemli üretim nedeniyle hücre ölümü göze DY330R rekombinasyon fonksiyonlarından sorumlu p L operondan toksik ürünler. 33,34
      8. bir O Hazırlama / DY330R pOX38-Tc Δgene K :: Steril bir pipet ya da döngü hücrelerin tek ayrı koloni toplanmış ve 10 ug / ml, Tc, ve 20 ug / ml ile 20 ml steril LB ortamı aşılanarak Cm hücreleri Santimetre. Steril alanda tutmak ve alev yakınında çalışır. 200 rpm'de çalkalanarak 32 ° C'de hücreler O / N büyütün.
      9. Steril% 100 gl 500 uL ile O / N kültürünün 500 mcL karıştırılarak O / N 3-5 gliserol stokları yapmakSteril kriyo-tüpler içinde ycerol (son% 50 h / h). -80 ° C'de saklayın.
      10. Oda sıcaklığında O / N kültürü santrifüj 6-8 mL, 3 dakika boyunca 5,000 x g. Süpernatantı Durusu ve pOX38-Tc Δgene :: Cm ayıklamak bir plasmid mini hazırlık kiti (Malzeme Tablo) ve üreticinin protokolü kullanılarak pelet oluşturmak; -20 ° C'de saflaştırılmış DNA saklayın.
      11. protokole 3.1 uyarınca gen nakavtla konjugasyon bozulması onaylamak için alıcı olarak XK1200 hücrelerini kullanarak bir konjugatif çiftleşme tahlil gerçekleştirin.
    2. DY330R pOX38-Tc Δgene :: Cm + pK184-geni
      1. 2.1.4-2.1.7 adımları göre elektroporasyon ile pK184-gen yapısı 300 ng elektro DY330R pOX38-Tc Δgene :: Cm hücrelerini dönüştürmek. Tüm seçici ortam 20 ug / ml Cm ve 50 ug / ml Km'ye indirildi içermelidir. 32 ° C'de inkübe edin. Electroporated hücrelerde kurtarma plazmid şimdi D nakavt genin işlevini geri olacakY330R pOX38-Tc Δgene :: Cm hücreleri.
      2. bir O Hazırlama / DY330R pOX38-Tc Δgene N :: Steril bir pipet ya da döngü hücrelerin tek ayrı koloni toplanmış ve 20 ug / ml Cm ile 20 mL steril LB ortamını aşılayarak cm + pK184-geni rekombinant hücreler 50 ug / ml Km'ye indirildi. Steril alanda tutmak ve alev yakınında çalışır. 200 rpm'de çalkalanarak 32 ° C'de hücreler O / N büyütün.
      3. Steril cryo tüpler steril% 100 gliserol (son% 50 h / h), 500 uL O / N kültürünün 500 uL karıştırılarak O / N 3-5 gliserol stokları sağlayın. -80 ° C'de saklayın.
      4. Ayrıca XK1200 pOX38-Tc Δgene :: Cm rekombinant hücreler üretmek için protokol 3.1 gerçekleştirin.
    3. XK1200 pOX38-Tc Δgene :: Cm + pK184-geni ve mutantlar
      1. (Aşama 2.2.4) elektro XK1200 pOX38-Tc Δgene :: Cm hücreleri hazırlayın.
      2. Ayrıca ele 50 uL olarak pK184-geni ya da pK184 gen Mutant plazmidlerden 300 ng elektroporasyonactrocompetent XK1200 pOX38-Tc Δgene adımlar göre :: Cm hücreleri 2.1.4-2.1.7. Tüm seçici ortam 10 ug / ml nalidiksik asit (Nal), 20 ug / ml Cm ve 50 ug / ml Km'ye indirildi içermelidir ve 37 ° C'de inkübe edilir.
      3. bir O Hazırlama / XK1200 pOX38-Tc Δgene N :: Steril bir pipet ya da döngü hücrelerin tek ayrı koloni toplanmış ve Nal, 20 ug / ml ile 20 ml steril LB ortamı aşılanarak cm + pK184-geni rekombinant hücreler cm ve 50 ug / ml Km'ye indirildi. Steril alanda tutmak ve alev yakınında çalışır. 200 rpm'de çalkalanarak 37 ° C'de hücreler O / N büyütün.
      4. Steril cryo tüpler steril% 100 gliserol (son% 50 h / h), 500 uL O / N kültürünün 500 uL karıştırılarak O / N 3-5 gliserol stokları sağlayın. -80 ° C'de saklayın.

    3. Konjügatif Çiftleşme Tahliller

    1. Konjugatif Çiftleşme XK1200 pOX38-Tc Δgene :: Cm Hücreleri oluşturmak için
      1. 20 ml steril LB O / N cul hazırlayınDY330R pOX38-Tc Δgene bölgesinin Türe :: steril pipet veya döngü kullanılarak cm + pK184-geni hücreler 20 mL steril LB bir de, bir gliserol stokundan veya tek bir koloni ile 20 ug / ml Cm ve 50 ug / ml Km'ye indirildi ihtiva aşılanması için agar plakası. 200 rpm'de çalkalanarak 32 ° C'de büyütülmüştür. 37 ° C 'de büyümekte, 10 ug / ml Nal 20 ml steril LB XK1200 hücreleri için, bunların hazırlanması.
      2. ayrı ayrı, aynı antibiyotik içeriği ile steril LB 2 mL Her kültürün 1:70 seyreltiler; tüm verici hücreler 100 mM nihai konsantrasyona kadar glikoz ekleyin. 200 rpm'de çalkalanarak, 37 ° C'de orta log fazında (OD 600 0.5-0.7) hücreleri büyütün.
      3. Santrifüj 2 ml soğuk steril LB antibiyotik ve tekrar süspansiyon hücreleri çıkarmak için soğuk steril LB ile bir kez yıkayın, supernatant atmak pelet hücreleri (4000 xg için 5 dakika 4 ° C'de)
      4. Kısım steril LB ortamı 800 uL her bir kültürün 100 uL ve onları çalkalamadan 1 saat boyunca 32 ° C'de çiftleşme sağlar.
      5. <li> vorteks eşleşme çiftleri bozabilir ve daha çiftleşme önlemek için, 10 dakika boyunca buz üzerinde yerleştirmek için 30 s için hücreleri.
      6. XK1200 pOX38-Tc Δgene :: Cm hücreleri seçmek için 10 ug / ml nihai ve 20 ug / ml Cm ihtiva eden bir agar plaka üzerine hücre karışımın alikosu 100 uL. steril dağıtıcısı kullanarak hücrelerin yayıldı. Steril alanda tutmak ve alev yakınında çalışır. 37 ° C baş aşağı plaka O / N inkübe edildi.
      7. Yeni XK1200 pOX38-Tc Δ genin tek bir koloni Hasat :: Cm Steril bir pipet veya döngü ve 20 ug / mL Cm, O / N ile steril LB büyümeye de kullanarak nakavt suşu 200 rpm'de çalkalanarak 37 ° C. Steril cryo tüpler steril% 100 gliserol (son% 50 h / h), 500 uL O / N kültürünün 500 uL karıştırılarak O / N 3-5 gliserol stokları sağlayın. -80 ° C'de saklayın.
        Not: Elde edilen hücreler artık mümkün eşek için pK184-gen yapıları (protokoller 1.3 ve 1.4) ile dönüşümün yetkili yapılacakyeteneği üzerindeki geni ve mutantlar Essing protokole 3.2 eşli transferi kurtarmak için.
    2. Konjugatif Çiftleşme Testi XK1200 Donörleri gelen MC4100 Alıcılara
      1. XK1200 pOX38-Tc Δgene bir O / N kültürünü hazırlayın :: Cm + pK184-gen Bir agar plakasından ve steril bir gliserol stoku ya da tek koloni, 20 ug / ml Cm, 50 ug / ml Km'ye indirildi ve MC4100 50 ug / ml streptomisin ile 5 ml LB içinde hücreler (sm) kullanılarak hücreler steril LB 20 mL hücreler, pipet veya döngü. kültürlerin büyümek 200 rpm'de çalkalanarak 37 ° C.
      2. ayrı ayrı, aynı antibiyotik ile steril LB 2 mL her biri O / N kültüründen 1:70 seyreltiler. tüm verici hücreler 100 mM nihai konsantrasyona kadar glikoz ekleyin. 200 rpm'de çalkalanarak, 37 ° C'de orta log fazında (OD 600 0.5-0.7) hücreleri büyütün.
      3. Santrifüj, supernatant atmak pelet hücreleri Antibiyotik çıkarmak için soğuk steril LB ile bir kez yıkamak için (4000 xg için 5 dakika 4 ° C'de)2 mL soğuk steril LB içinde tikler, ve tekrar süspansiyon hücreleri
      4. mükerrer olarak, steril LB ortamı 800 uL her bir kültürün kısım 100 uL ve onları çalkalamadan 1 saat boyunca 37 ° C'de çiftleşme sağlar.
      5. Vorteks 30 s için hücreler eş çiftleri bozabilir ve daha çiftleşme önlemek için, 10 dakika boyunca buz üzerinde yerleştirmek için.
      6. Adım 3.2.2 ve taze steril LB gelen orta-log kültürleri kullanılarak 10 -7 10 -2 donör ve alıcı hücrelerin 6 seri dilüsyonları hazırlayın.
      7. 10 ug / ml Nal, 20 ug / ml Cm ve 50 ug / ml Km'ye indirildi ihtiva eden bir agar plaka iki yarısı, XK1200 donör hücrelerin her seyreltme için 10 uL'lik temsili miktarları, nokta her birinde, Şekil 2'de gösterildiği gibi. 50 ug / mL SM ihtiva eden agar plakaları üzerinde alıcının MC4100 hücreleri dilüsyonları için tekrarlayın. 37 ° C'de plakalar O / N inkübe edin.
      8. Adım 3.2.5 ve taze steril LB gelen vortekse karışımı kullanılarak, 10 -2 10 -7 6 dilüsyonları (hazırlamak Şekil 2'de olduğu gibi 50 ug / mL SM ve 20 ug / ml Cm ihtiva eden agar plakaları her bir yarısında seyreltme her biri 10 uL hacimde tespit ederek transconjugant için MC4100 pOX38-Tc Δgene :: Cm hücreleri seçin. Her iki yinelenen karışımlar için tekrarlayın. Steril alanda tutmak ve alev yakınında çalışır. 37 ° C'de plakalar O / N inkübe edin.
      9. protokol 3.3 de tarif edildiği gibi, her yapı birleşme verimini belirler.
      10. tüm kurtarma plazmidler konjugasyon verimliliği üzerinde belirli bir mutasyonun etkisini değerlendirmek için bu protokolü tekrarlayın.
    3. Çiftleşme Verimliliği hesaplanması
      1. kendi plakaları üzerinde her donör, alıcı ve transconjugant hücreleri için aynı seyreltme lekelenme gelen koloni sayısını sayın.
      2. verilen seyreltme alıcılara daha transkonjugamn daha büyük bir sayıda olması neden olur herhangi bir önyargı test etmek için alıcı kolonileri sayın.
      3. CDonör koloni sayısına bölünmesiyle transconjugant kolonilerin sayısı olarak birleşme verimliliğini alculate. 100 donör hücre başına verimlilik değerini elde etmek 100 ile çarpın.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    F plazmid odaklı bakteriyel konjugasyon bir işlem pilus sentezi ve karşılıklı DNA transferi kolaylaştırmak için bir T4SS araya F-plazmidinin tra bölgesi içinde transfer proteinleri içeren koordineli bir süreçtir. Protein TRAF (GenBank erişim # BAA97961, UniProt İD P14497) konjugatif F pilus oluşumu için gereklidir. 10,14,35 - katalitik CXXC motifi olmayan da 37 proteini, bir C-terminali tioredoksin-benzeri domain içerir. Bu N-terminal alanı ile Trah proteini ile etkileşime tahmin edilmiş olmasına rağmen 35,38, 39 bir bölge çok başka 37 proteinin yapısal özellikleri hakkında bilinen, C-terminal alanı daha dinamik olduğu gösterilmiştir. Yapısal çalışmalar ile birlikte TRAF proteinin fonksiyonel yönlerini değerlendirmek için, öncelikle homolog yoluyla pOX38-Tc üzerinde TRAF genini nakavtrekombinasyon, E coli DY330R hücrelerinde pOX38-Tc ΔtraF :: Cm plazmid (Tablo 1) üretilmesi. Ayrıca üretilen 33,34 konjugasyon kurtarma sağlamak ve protein dizisi sondalama etkinleştirmek için TRAF -özel primerleri (Tablo 2) den pK184-TRAF plazmid oldu. PK184-TRAF trans sağlandı XK1200 hücre DY330R hücrelerinden 40 içine pOX38-Tc ΔtraF :: Cm plazmid transferi gösterir (Transkonjuganlardaki, 10 ug / ml Tc ve 20 ug / ml Cm 10 ug / ml Nal üzerinde büyümüş) pOx38-Tc ΔtraF :: cm o (a) TRAF nakavt bir çerçeve CAT kaseti sağlar ve (b) pK184-TRAF konjugatif işlevini geri yükleyebilirsiniz.

    TRAF mutantlarının bir dizi XK1200 pOX38-Tc ΔtraF :: Cm + pK184-TRAF Ax ile eşli birleşme deneyi 37 kullanılarak analiz oluşturulanHücreler ve sırasıyla donör ve alıcı olarak 41 MC4100 hücreleri. Bir Örnek mutant TRAF 55-247 (Tablo 1), protein bölgesi Trah etkileşim tahmin kaldıran, bir N-terminal çıkarılması işlemi, mutantıdır. Tam uzunluktaki TRAF proteini donör hücrelerine verildiğinde boş plazmid pK184 sağlayan (Tablo 3) değil ise, eş transfer, (Şekil 2) geri döner. Plazmid pK184-TRAF 55-247 (Tablo 3) ile donatılmış Benzer şekilde, XK1200 donör hücreleri eşli fonksiyonu geri değildir. Bu proteinin kesik bölgesi muhtemelen Trah ile etkileşim yoluyla, konjugasyondan cihaz içinde TRAF fonksiyonu için önemli olduğunu gösterir ve ayrıca mutasyon analizi için hedef proteinin bir bölgesini içerir.

    Şekil 1
    trans sağlanmadıkça konjugasyon kolaylaştırmak için değiştiremiyor plazmid pOX38-Tc Δgene :: Cm, barındırır. Elde edilen pOX38-Tc Δgene :: Cm plazmid MC4100 alıcı (Kademe 3) ile birleşme deneyleri kullanılarak genin ileri değerlendirme için XK1200 suşu (Aşama 2) aktarılır. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

    şekil 2
    Şekil 2: Mattahlil ing konjugasyon hedef genin fonksiyonunu değerlendirmek için. Verici ve alıcı hücreler E. coli XK1200 pOX38-Tc ΔtraF :: Cm sırasıyla pK184-TRAF ve MC4100 ile dönüştürülmüştür. Ortaya çıkan transkonjuganların (MC4100 pOX38-Tc ΔtraF :: Cm) konjugatif fonksiyonun başarılı kurtarma belirten Sm ve Cm içeren plakalar üzerinde büyür. Deney, tek bir agar plakası üzerinde iki kez yapılır ve seri seyreltileri için onar gen mutantlan (Tablo 2) birleşme etkinliğinin hesaplanması kullanılmıştır. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

    Bakteriyel suş / Plazmid ilgili Özellikler Seçici Marker (ler) Referans
    Bakteriyel Suşlar
    DY330R W3110, ΔlacU169 gal490 λc1857 Δ (cro-bioA) Rif R Rif 33,34
    XK1200 F - lacΔU124 Δ (bio gyrA attλ ADA AROG gal) Nal 40
    MC4100 araD139 Δ (argF-lac) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR Sm 41
    Vektörler ve Yapılar
    pBAD33 P ArabAd: altında İfade için plazmid, Santimetre 32
    pK184 Vektör, p15a replikon klonlama 2.4 kb km 31
    pK184-TRAF </ Td> pK184 içinde pOX38 F TRAF km 35
    pK184-TRAF 56-247 pK184-TRAF F TRAF aa 56-247 km
    konjugatif Plazmidler
    pOX38-Tc IncFI Tra + RepFIA + F, mini Tn F1 HindIII fragmanı Tc 29,30
    pOX38-Tc ΔtraF :: Cm CAT ile pOX38-Tc traf takılı tc Cm 35
    † Cm, kloramfenikol; Km, kanamisin; Nal, nalidiksik asit; Rif, rifampisin; Sm, streptomisin; Tc, tetrasiklin
    ‡ Tüm TRAF konstruktları periplazmik boşluğuna lokalizasyon sağlamak için 19-Tortu, lider dizisini ihtiva etmektedir.

    Tablo 1: suşu ve plazmidler bu çalışmada kullanılan.

    inşa etmek astar *
    TRAF-Cm-For 5'-GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC 3 '
    TRAF-CM-Rev 5'-TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG 3 '
    pK184-TRAF-For 5'-TTTTTT GAATTC TATGAATAAAGCATTACTGCCAC 3 '
    pK184-TRAF-Rev 5'-TTTTTT AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA 3 '
    pK184-TRAF 55-247 -Için 5'-TACG CATATG ATGGCCGCACTGCAGACGG 3 '
    pK184-TRAF 55-247 5'-TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA 3 '
    † Lento ark uyarlanmıştır Tablo. Izni ile 2016 35
    * TRAF sarkan bölgeleri italik edilir. (: AAGCTT, EcoRI: GAATTC Ndel: CATATG Hindlll) restriksiyon enzim yerlerinin altları çizilmiştir

    Tablo 2: Bu çalışmada kullanılan primerler listesi.

    Verici plazmit † Kurtarma Plazmid Transkonjuganlardaki ‡ § (hücre ml-1) Çiftleşme Efficiency§ ||
    pOX38-Tc ΔtraF :: Cm Yok 0 0
    pOX38-Tc ΔtraF :: Cm pK184 0 0
    pOX38-Tc ΔtraF :: Cm pK184-TRAF 5 x 10 3 0,0167
    pOX38-Tc ΔtraF :: Cm pK184-TRAF 55-247 0 0
    * Lento ve ark adapte Tablo. Izni ile 2016 35
    † Donör hücreleri, E. coli XK1200 3 x 10 7 hücre mL bir ortalama konsantrasyonu ile, idi -1
    ‡ alıcı hücreler E. coli MC4100 edildi. Pozitif kontrol için transkonjugamn sayısı 10-5 seyreltme arasındadır. 0 10-2 seyreltme hiçbir Transkonjuganlardaki gösterir.
    iki ila dört eş deneylerin §An ortalaması, her bir yapı için gerçekleştirilmiştir.
    || Mating verimi defin olan100 donör hücre başına Transkonjuganlardaki Ed. 0 çiftleşme verimliliği 10-2 seyreltme hiçbir transkonjugamn gösterir

    Tablo 3: TRAF silme yapıları tarafından Mülga çiftleşme verimlilik.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    Bakteriyel konjugasyon işlemi bakterileri gibi antibiyotik direnç belirteçlerin yayılması gibi zorlu ortamlarda büyümesi için evrimsel bir avantaj sağlayan genleri yayılabilir hangi bir araç sağlar. Konjugatif plazmid çok çok büyük olduğundan, konjugatif plazmid kendisini hedef genlerin mutasyon yoluyla transferi cihazının montajı katılan proteinler üzerinde 12 fonksiyonel çalışmalar hantal vardır. Bu tarifnamede ayrıntılı protokolleri, bir daha kolaylıkla daha küçük, daha idare edilebilir sentezleme plazmid (Şekil 1) kullanılarak ilgi konusu hedef genin değerlendirmek için kullanılabilecek bir yöntem sağlarlar. Biz F plazmid aracılı konjugasyon incelemek için F plazmid türevi pOX38-Tc (Tablo 1) istihdam; Diğer konjugatif plazmidler burada ayrıntılı protokoller ve uygun türev plazmidler kullanılarak incelenebilir. Özetlenen çiftleşme deneyleri bazı modifikasyonların ile Frost ve arkadaşları, 42 adapte edilmiştirons. Daha önce yapılan çalışmalarda, pOX38-Tc Δgene :: Cm yapının 8,33,42 oluşturulması, uygun kısıtlama enzimleri ile ilgili geni parçalanması ve pOX38-Tc amplifiye CAT kasetinin sokulmasıyla elde edilmiştir. Geçerli yöntemde 42, biz hedef genin nakavt ve CAT kaset ile değiştirmek için Recombineering E. coli DY330R 33,34 homolog rekombinasyon kullanır. F-T4SS pK184 gen kazanım plasmidi kullanılarak transfer kurtarma ile eş transfer ettiği üzerinden bu pOX38-Tc Δgene :: Cm gen spesifik nakavt için bir kontrol olarak hareket yapıyı taşıyan elde edilen DY330R suşu sağlayan bir avantajı vardır . Bir sebzelik-Cas9 metodolojisi, 43 kullanarak dolguyu oluşturmak mümkün olsa da biz bu imkanı araştırdı şu anda yok.

    Süreç (F türev plazmid pOX38-Tc bir gen nakavt nesil Figür başlıyore 1). Bu DY330R hücrelerinde homolog rekombinasyonla (Tablo 1) ile elde edilir, örneğin DY329, DY331 ve DY378 gibi benzer özelliklere sahip diğer suşları da kullanılabilir. Primerler, ilk pBAD33 plazmit 32 CAT kaseti yükseltmek ve hedef genin (Tablo 2) için spesifik olan bazlar sarkan içeren PCR için tasarlanmıştır; PCR ürünü daha sonra pOX38-Tc barındıran DY330R hücrelerine elektroporasyona edilir. Homolog rekombinasyon CAT kaset Cm direnç sağlarken etkili bir T4SS montaj ve konjugasyon kesintiye, hedef genin içinde çerçeve eklenir knock-out plazmid pOX38-Tc Δgene :: Cm üretir. Aynı zamanda, hedef gen pOX38-TC ile ilgili PCR yükseltilir ve küçük bir ifade plazması içine yerleştirilir; Bu protokolde, eğer arzu edilirse ancak bir hedef genin endüklenebilir ifadesi ile bir plasmid tercih olabilir, konstitütif ekspresyon için pK184 kullanımı. pK184-geni plazmidi daha sonra transforme edilirDY330R pOX38-Tc Δgene :: Cm hücrelerine, ve bu hücreler pOX38-Tc Δgene :: Cm birleşme analizleri için XK1200 hücrelerine konjugasyon yoluyla inşa aktarmak için verici olarak kullanılmaktadır. birleşme deneylerinde, verici ve alıcı hücreler, sırasıyla XK1200 pOX38-Tc Δgene :: Cm ve MC4100 vardır. PK184 gen kazanım plazmid, hem de hedef gen (silme ya da nokta mutasyonları) seri mutantlan, MC4100 alıcı hücrelere (Şekil 2 ile çiftleşme yükleme ve etkinliğini belirlemek için yeteneklerini değerlendirmek için donör hücre temin edilmektedir ; Tablo 3).

    Prosedüre kritik uygun verici ve alıcı suşları (Tablo 1) ve kullanılan primerlerin tasarımı kullanılmasıdır. tasarlanmış her astar için, takip edilmesi gereken genel kurallar vardır. biz kesinlikle% 40-60 GC içeriği ile uymak çalışırken, bu her zaman mümkün olmayabilir. Bu gibi durumlarda, ağ bir primer test deneycinin takdirine,biraz aşağıda veya bu aralığın üstünde i GC içeriği. İleri ve geri primer erime sıcaklığı (Tm) benzer olmalıdır ve tavlama sıcaklığı (T) değeri her zaman PCR için 2-5 ° C Tm daha düşük olması gerekir. Homo ve hetero dimerizasyon Tm 'nin çok düşük olması gerekir iken T a çok daha düşük olmalı geliştirmek için bir saç tokası izin için kullanılabilir serbest enerji, (az -10 kJ ve 30 ° C). Primerler, arzu edildiği gibi, silmeler, girmeler ya da nokta mutasyonları incelemek için dizayn edilebilir. Elde edilen gen yapısı amplifiye ve düzgün eksprese edilir ve böylece çerçeve geri plasmid lige edilmesi elbette önemlidir. yetkin hücrelerin dönüştürülmesi, sırasıyla, elektro-kimyasal olarak, yetkili hücreler kullanılarak elektroporasyon veya ısı şoku ile yapılabilir. Bu elektroporasyon gibi pOX38-Tc ve homolog rekombinasyon oligonucle gibi daha büyük yapıları için daha etkili bulmakotide, örneğin pK184-TRAF gibi küçük sentezleme plasmidleri kolaylıkla ısı şoku yöntemlerle hücrelere transforme edilebilir ise. Son olarak, hem donör ve alıcı suşları konjugatif ve kurtarma plazmidler üzerinde çalışan olanlardan farklı farklı dirençleri gerektiren, protokol boyunca kullanımında birden fazla antibiyotik olacağını hatırlamak önemlidir.

    Kenara Burada anlatılan çiftleşme deneyleri teknikleri, kendi yaklaşım biraz farklı bakteri konjugasyon incelemek için kullanılan başka yöntemler vardır. Yatay gen transferi bakteri türler arası alıcıları dahil olmak üzere bir alıcı hücreye, bir plasmid transferi bir süreçtir. 44 türler arası yatay gen transferi boyutunu belirlemek için bakteri konjugasyon kullanılan Dahlberg ve örneğin arkadaşları 44 tarafından yapılan bir çalışma. Bunlar KT2442 hücrelere klonlanmış bir plazmide yeşil flüoresan protein (GFP) dahil edilmesini kullanılmaktadır; kromozomal lKT2442 hücrelerinde AC q geni GFP ifade bastırmak. Plazmid taşıyan GFP lac q geni olmayan bir türe aktarıldığında, floresan gözlemlenmiştir. Çeşitli türlerde protein belirli bir işlevi sunmak için sınırlama rağmen 44, türler arası konjugasyon deneyi muhtemelen farklı türler arasında protein-protein etkileşimleri için evrimsel tahminler yapmak için burada sunulan protokoller ile birleştiğinde olabilir.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Yazarlar hiçbir rakip mali çıkarları olduğunu beyan ederim.

    Acknowledgments

    Bu araştırma Kanada Doğa Bilimleri ve Mühendislik Konseyi Discovery Grant (NSERC) tarafından desteklenmiştir.

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics