Konjugativ Parning Analyser för sekvensspecifik analys av Transfer proteiner involverade i konjugation

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Överföringen av gener och proteiner i mikroorganismnivå spelar en central roll i bakteriell överlevnad och utveckling samt infektionsprocesser. Utbyte av DNA mellan bakterier eller mellan en bakterie och en cell kan uppnås genom transformation, konjugation eller vektor transduktion. 1,2 Konjugation är unik i jämförelse med transformation och transduktion av att under konjugering mellan gramnegativa bakterier såsom Escherichia coli, sker överföringen av DNA i en donator-kontrollerat sätt varigenom ett komplex makromolekylärt system ansluter donator- och mottagarceller. Konjugation är också det mest direkta sättet på vilket bakterieceller interagerar med värdceller för att injicera gener, proteiner eller kemikalier i till värdsystem. 3 Ganska ofta, överföring av sådana medel har anmärkningsvärda effekter på värden, som sträcker sig från patogenes och cancer att vara värd evolution och anpassning. Det har visats att konjugativ recombination ökar graden av anpassning 3-faldigt i bakterier med höga mutationshastigheter under förhållanden av miljöstress. 4 Dessutom är konjugering i särklass vanligaste vägen genom vilken antibiotikaresistensgener i bakteriestammar sprids. 5,6

Mikroorganismer har utvecklats specialiserade sekretionssystem för att stödja överföring av makromolekyler över cellmembran; Det finns för närvarande 9 typer av sekretionssystem (TSSs) i gramnegativa bakterier som har beskrivits: T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS, liksom Sec (utsöndring) och Tat (två-arginin translokation) vägar. 7,8 Varje typ av sekretionssystemet är indelad i olika undertyper, en nödvändighet på grund av mångfalden av proteiner och särskiljningsförmåga involverade i olika bakteriestammar. Till exempel i den typ IV sekretionssystem (T4SS), Ti och Cag system underlättar effektor transport medan F-plasmiden, R27 ennd pKM101 T4SSs underlätta överföring av en konjugativ plasmid. 7,9,10 En detaljerad förståelse av de mekanismer genom vilka organismer monterar sina respektive sekretionssystem från sina komponentproteiner och dela cellulära innehåll med en mottagare eller deras omgivning är en viktig faktor i utvecklingen av riktade strategier för att bekämpa patogena mikroorganismer och processer cellulär infektion.

Efter den inledande identifieringen konjugation i E. coli av Lederberg & Tatum, 11 ett stort antal mobila och konjugering plasmider har identifierats och karakteriserats. 12 Sådana mobila plasmider visar avsevärt område är storlek (från 1 till över 200 kilobaser (kb)), men alla mobila plasmider innehåller en relaxase, som erkänner ursprung överföring (oriT) varigenom överföring av plasmiden. Konjugering plasmider ytterligare kodar gener för hopsättning av en funktionell T4SS samt en typIV kopplingsprotein. 12 Till exempel 100 kb F plasmiden av E. coli kodar alla konjugering gener inom en 33,3 kB transfer (tra) region. 13 Generna i tra regionen av F-plasmiden koda alla proteiner som underlättar pilus bildande, parning parbildning (MPF), DNA-överföring och uteslutnings funktioner under konjugativ plasmid överföring. 10,14,15 En betydande mängd kunskap är tillgänglig för konjugativ T4SSs dock detaljerade strukturstudier av konjugering proteiner och komplex endast nyligen blivit tillgängliga. 16-28

För att montera en heltäckande bild av konjugativ processen, krävs en koppling detaljerade strukturstudier att mutationsanalyser av konjugering överföringsproteiner. Detta kan uppnås genom konjugering passande analyser. För F-plasmiden, varvid varje protein som kodas inom tra regionen spelar en roll i F-medierad conjugation; Därför kommer knockout / radering av en genöverföring avskaffa konjugativ kapacitet av cellen (Figur 1). Medan mindre mobila plasmider är mer gynnsam för standardförfaranden radering, för större konjugering plasmider såsom F, är genen knockouts mer lätt uppnås via homolog rekombination, där målgenen är ersatt med en transport av en distinkt gen för antibiotikaresistens. I det nuvarande protokollet, använder vi homolog rekombination för att ersätta en genöverföring av intresse med kloramfenikolacetyltransferas (CAT) i 55 kb F plasmidderivat pOX38-Tc; 29,30 den resulterande knockout-plasmiden, pOX38-Tc Δgene :: Cm underlättar motstånd mot förekomst av kloramfenikol (Cm) i tillväxtmediet. Donatorceller som härbärgerar pOX38-Tc Δgene :: Cm är oförmögna att påverka konjugativ DNA-överföring / parning såsom observeras genom användning av en passande analys; parnings effektiviteten hos en pOX38-Tc Δgene :: Cm donatorcell och en normal recipient kommer att minska eller, oftare, avskaffas. Konjugativ överföring av pOX38-Tc Δgene :: Cm plasmid kan återställas via en liten återhämtning plasmid riktade genöverföring. Denna återhämtning plasmid kan vara en som ger konstitutiv expression, såsom plasmiden pK184 (pK184-gen), 31 eller ett som ger inducerbar expression så länge som denna plasmid är inriktad på rätt sätt den gen till rätt läge inuti cellen (cytoplasman eller periplasman). Följaktligen i passande analyser mellan denna nya givare (hyser pOX38-Tc Δgene :: Cm + pK184-gen-plasmider) och en mottagare cell är parnings effektivitet förväntas återställa nästan som en normal givare och mottagare parning analys. Detta system gör det möjligt för en att sondera funktion av den utslagna genen genom generering av en serie av pK184-genkonstruktioner (deletioner eller punktmutationer) och testa varje konstruktion förmåga att återupprätta den hoppassande kapaciteten hos pOX38-Tc Δgene :: Cm hysande donatorcells.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Framställning av DNA-konstruktioner

  1. Utforma Oligomerer för homolog rekombination av målgenen
    1. Utforma ett enhetligt 55-72 bp framåt oligomer enligt följande: (a) välja en 19-32 bp lång nukleotidsekvens som är homolog med en DNA-sekvens i regionen 10-100 bp uppströms om 5 'startstället för kloramfenikolacetyltransferasgenen i den kommersiella pBAD33 plasmiden, 32 och (b) välja ett 36-54 bp lång nukleotidsekvens homolog med en region 10-150 bp nedströms om 5'-startstället av målgenen av intresse.
      1. Ansluta sig till 3'-änden av nukleotidsekvensen som plockats i (b) till 5'-änden av nukleotidsekvensen plockade i (a), vilket sålunda ger en enda 55-72 långsträckt främre oligomer.
    2. Utforma ett enhetligt 55-72 bp omvända oligomer enligt följande: (a) välja en 19-32 bp lång nukleotidsekvens som är homolog med en DNA-sekvens i regionen 10-100 bp nedströmsav 3'-änden av kloramfenikol-genen i den kommersiella pBAD33 plasmiden, och (b) välja ett 36-54 bp lång nukleotidsekvens homolog med en region inom 10-150 bp uppströms om 3'-änden platsen för målgenen av intresse .
      1. Gå med i 3 'änden av nukleotidsekvensen plockas i (b) till 5' änden av nukleotidsekvensen plockade i (a) för att göra det en enda oligomer.
      2. Kopiera denna oligomer i alla tillgängliga bioinformatik programvara och konvertera sekvensen i sin omvända komplementet. Detta kommer att ge en enda 55-72 bp lång omvänd oligomer.
    3. Använda alla tillgängliga oligo-analysator program, kontrollera att rekombination oligomererna har GC-innehåll mellan 40-60%, låg hårnål smälttemperatur (Tm), låg själv- och hetero-dimerise T M: s. Beställa primers för syntes och transport från valfri bioteknikföretag.
  2. Amplifiering av CAT Cassette från pBAD33 (Cm ^
  3. Växa en över natten (O / N, 16-18 h) kultur av DH5a-celler som härbärgerar pBAD33 plasmid i sterilt lysogeni-buljong (LB) med 20 | j, g / ml kloramfenikol (Cm) med skakning vid 200 rpm och 37 ° C.
  4. Centrifug 6-8 ml av O / N-kulturen vid rumstemperatur, 5000 xg i 3 min. Dekantera supernatanten och extrahera pBAD33 plasmiden från pelleten med hjälp av en plasmid mini-prep kit (Material tabell) och tillverkarens protokoll.
  5. Gör ett sammandrag av pBAD33 plasmid-DNA genom att lägga till följande i ett sterilt rör i nämnd ordning: lämplig volym av dubbeldestillerat vatten (DDH 2 O) till en slutlig volym av 50 mikroliter, 1 mikrogram volym pBAD33 plasmid, 5 mikroliter 10x enzymreaktionsbuffert, och 0,5 mikroliter av Aval-restriktionsenzym (RE). Blanda försiktigt genom att pipettera och låta reaktionen fortgå under 1 h vid 37 ° C. Värme inaktivera reaktionen under 20 minuter (min) vid 80° C. Förvara proverna vid -20 ° C under högst 24 timmar för att minimera klibbig-end nedbrytning.
  6. Bered en 1,2% agaros separerande gel genom att blanda 1,2 g agaros med 100 ml 1x TAE (40 mM Tris, pH 8,5; 20 mM ättiksyra; 1 mM EDTA) -buffert i en 250 ml Erlenmeyer-kolv. Värme och virvla runt för att fullständigt lösa i en mikrovågsugn. Sluta uppvärmning omedelbart när vätskan börjar koka och snurra kolven.
    1. Kyla den flytande agaros under 3 min vid rumstemperatur under det virvlande, tillsätt 2 mikroliter av 10 mg / ml etidiumbromid och virvla runt för att blanda. Häll agaros till en gel bricka med en väl kam och låt det stelna under 1 h vid rumstemperatur. Förvara geler vid 4 ° C i upp till 2 dagar i 1x TAE buffert.
  7. Blanda varje RE smälta från 1.2.3 med 0,2 volym av DNA laddningsfärg (10 mikroliter av färgämne per 50 mikroliter reaktion) genom pipettering. Belastning 5 mikroliter av 500 mikrogram / ml DNA-stege i den första brunnen och alla av RE digere-färgämnesblandning in i en annan brunn på engarose gel. Använd 2-3 brunnar för att ladda alla reaktionsvolymen på gelén.
    1. Kör gelen knappt nedsänkt i 1x TAE buffert och arbetar vid 45-50 V (4,5-5 V / cm) för 65 minuter i en gelelektrofores enhet.
  8. Med användning av en UV-skåp och en steril rakkniv, skär snabbt 2,8 kb-bandet som motsvarar den CAT-sekvensen ut från gelén för att minimera UV-exponering av DNA. Extrahera DNA från den utskurna gel segment med hjälp av en gelextraktionskit (Material tabell) enligt tillverkarens protokoll.
    Obs: Var noga med att inte utsätta huden direkt under UV och hantera rakkniv med omsorg.
  9. Amplifiera CAT kassett extraheras från 1.2.6 genom polymeraskedjereaktion (PCR) med användning av primrarna designade i 1,1 som innehåller överhäng homologa med gensekvensen för att möjliggöra homolog rekombination. PCR-reaktioner sätts upp på is med hjälp av riktlinjerna tillverkaren (Material tabell) i följande ordning:
    1. In i ensterilt PCR-rör, tillsätt en lämplig volym av DDH 2 O till en slutlig volym av 50 | il, följt av 10 | il av PCR-buffert, 1 | il av 10 mM dNTP, 2,5 | il av 10 | iM framåtriktad primer, 2,5 | il av 10 | iM Omvänd primer , 1-25 ng schablon-DNA från 1.2.6 och 0,5 mikroliter av 100 enheter / mikroliter DNA-polymeras.
    2. Inrätta en negativ kontroll som bär samma komponenter som 1.2.7.1 men med undantag av templat-DNA. Använd en lämplig volym av DDH 2 O i stället för mall-DNA. Inrätta en positiv kontroll med användning av DNA-templat och primrar som har visat sig fungera i en PCR-reaktion, såsom de som tillhandahålls som positiv kontroll av tillverkaren.
    3. Blanda alla reaktions innehåll försiktigt genom pipettering.
    4. Amplify via PCR med hjälp av följande inställningar: Initial denaturering under 30 s vid 98 ° C, 30 cykler av denaturering under 10 s vid 98 ° C, primerhybridisering för 20 s, förlängnings för 20 s per kilobas av amplicon vid 72 ° C och en fenaal förlängning i 10 min vid 72 ° C. Förvara proverna vid -20 ° C.
  10. Bekräfta den korrekta storleken av amplifiering via agarosgelelektrofores (se 1.2.4-1.2.5) genom att använda endast fem mikroliter av varje reaktion. Rena PCR-amplikon med användning av ett PCR-reningskit och tillverkarens protokoll. Store renat DNA vid -20 ° C.
  • Den pK184-genen Recovery Plasmid
    1. Utforma en framåtriktad primer med början från dess 5 'ände och går mot 3'-änden i följande ordning: (a) plocka 4 slumpmässiga nukleotider (en kombination av adenin, tymin, guanin och cytosin) för klyvning effektivitet, knutna till (b) EcoRI-restriktionsenzym (RE) cut ställesekvens (GAATTC), följt av (c) ett 21-25 bp lång nukleotidsekvens som är homolog med 5'-änden av genen av intresse, inklusive startkodonet. Om målgenen innehåller ett EcoRI-ställe, välja en annan lämplig RE från pK184 multipla kloningsstället.
    2. I fallet med gener som kodar för periplasmatiska proteiner, omfatta en ytterligare ledarsekvens mellan RE-stället och startkodonet på den framåtriktade primern.
    3. Använda alla tillgängliga oligo-analysator, kontrollera att primers har GC-innehåll mellan 40-60%, låg hårnål Tm, låg själv- och hetero-dimerise T M: s. Beställa primrarna för syntes.
    4. Växa en O / N-kulturen av DY330R pOX38-Tc-celler i sterilt LB innehållande 10 | j, g / ml tetracyklin (Te) med skakning vid 32 ° C och 200 rpm. Centrifug 6-8 ml av O / N-kulturen vid rumstemperatur, 5000 xg i 3 min. dekanterasupernatant och extrahera plasmid DNA från pelleten med hjälp av en plasmid mini-prep kit (Material tabell) och tillverkarens protokoll.
    5. Förstärk hela genen av intresse med primers från 1.3.1-1.3.5 använder pOX38-Tc som mall (se 1.2.7.1-1.2.7.3).
    6. Bekräfta den korrekta storleken av amplifiering via agarosgelelektrofores (se 1.2.4-1.2.5) genom att använda endast fem mikroliter av varje reaktion. Rena den amplifierade DNA med användning av ett PCR-reningskit och tillverkarens protokoll. Store renat DNA vid -20 ° C.
    7. Gör en dubbel uppslutning av både den kommersiellt tillgängliga pK184 plasmid-DNA och den förstärkta genen (från 1.3.7.), Genom att lägga till följande i ett sterilt rör i nämnd ordning: lämplig volym av DDH 2 O till en slutlig volym av 50 mikroliter , 1 | ig volym av pK184 plasmid, 5 mikroliter 10 x enzymreaktionsbuffert, och 1 mikroliter av varje EcoRI och Hindlll.
      1. Blanda försiktigt genom att pipettera och låta reaktionen fortskrida under 1 hvid 37 ° C. Värme inaktivera om reaktionsblandningen under 20 min vid 80 ° C. Förvara proverna vid -20 ° C under högst 24 timmar för att minimera klibbig-end nedbrytning.
        Obs: Den typ av begränsning nukleas används här beror på restriktions nukleas webbplats som var konstruerad i primers i steg 1.3.1 och 1.3.2.
      2. Som en positiv kontroll inrätta ett enda digereringar av den pK184 plasmiden genom framställning av samma reaktion som i 1.3.8 med undantag lägga endast en av RES till ett reaktionsrör. Gör detta separat med båda RES.
    8. Köra digereringarna på en 1,2% agarosgel med användning av protokoll 1.2.4-1.2.5 Extrahera DNA-dubbel smälta fragment av både pK184 och genen av intresse enligt steg 1.2.6.
    9. Ligera genen insatsen i pK184 vektorn genom att tillsätta komponenterna till ett sterilt rör i följande ordning: 2 ^ il 10 x T4 DNA-ligasbuffert, totalt 100 ng DNA sammansatt av en 1: 3 vektor: sätt in (pK184: gen) förhållande, DDH 2 O upp till entotal volym av 20 mikroliter och 1 mikroliter T4 DNA-ligas. Som en negativ kontroll, skapa en liknande reaktion med användning av 100 ng av vektorn utan insatsen genen.
      1. Blanda försiktigt alla reaktionsinnehållet med en mikropipett och inkubera i 30 minuter vid 25 ° C. Värmeinaktivering av ligeringsreaktionen under 10 min vid 65 ° C och sedan placera på is.
    10. Medan på is, tillsätt 15 | il av pK184-genen ligeringsreaktion från steg 1.3.10 till 100 mikroliter av kemiskt kompetenta DH5a-celler i ett sterilt 1,5 ml rör. Blanda försiktigt genom att pipettera och inkubera på is under 10 min. Gör samma sak för det negativa kontrollprovet. För en positiv kontroll, använd 20-100 ng av en plasmid såsom pBAD33 och omvandla det till 50 mikroliter av DHα celler.
    11. Direkt överföra proverna från is i en 42 ° C vattenbad och inkubera under 90 sekunder. Detta ger cellerna en värmechock och tillåter dem att upptag av plasmid-DNA.
    12. Placera cellerna tillbaka på is för en annan5 min och sedan lägga till 900 mikroliter av steril LB. Inkubera vid 37 ° C under 1 h under skakning vid 125 rpm.
    13. Alikvot en 100 mikroliter volym av prov från varje ligeringsreaktion i 1.3.13 på en agarplatta innehållande 50 ug / ml kanamycin (Km) och sprida cellerna med en steril spridare. Den positiva kontrollplatta bör ha lämpliga antibiotika. Håll området steril och arbeta nära en eld. Inkubera plattan upp och ner vid 37 ° C över natten.
    14. Med användning av en steril pipett eller ögla, skörda en enda distinkt koloni av celler och inokulera en 20 ml steril LB med 50 | j, g / ml Km. Håll området steril och arbeta nära en eld. Odla cellerna O / N vid 37 ° C med skakning vid 200 rpm.
    15. Göra 3-5 glycerollager av de transformerade DH5a-celler genom att blanda 500 mikroliter av O / N-kulturen med 500 mikroliter av steril 100% glycerol (slutlig 50%, volym / volym) i sterila Cryo-rör. Förvara vid -80 ° C.
    16. Också centrifug 6-8 ml av O / N-kulturen vid rumstemperatur, 5,000 xg i 3 min. Dekantera supernatanten och extrahera pK184-genen återhämtning plasmid från pelleten med hjälp av en plasmid mini-prep kit (Material tabell) och tillverkarens protokoll.
  • pK184 - gen Mutants
    Note: Primrar utformade för deletioner, insättningar och / eller punktmutationer lätt kan genereras med användning av tillverkarnas nätet tillgängliga verktyg.
    1. Utforma varje framåtriktad primer genom att plocka en 18-32 bp lång nukleotidsekvens som är homolog med 5'-änden av genen av intresse, inklusive startkodonet. Konstruktions primers så att varje framåtriktad primer annelerar 30-180 bp nedströms om den föregående, vilket resulterar i deletionsmutanter som saknar N-terminala peptidfragment av lämpliga längder.
    2. Utforma en omvänd primer genom att plocka en 18-32 bp lång nukleotidsekvens som är homolog med 3'-änden av genen av intresse, inklusive stoppkodonet. Kopiera primer i enny tillgängliga bioinformatik program och konvertera sekvensen i sin omvända komplementet. Detta är den omvända primern.
      1. I fallet med gener som kodar för periplasmatiska proteiner, utforma den omvända primern som är det omvända komplementet av 3'-änden av en ledarsekvens som flankerar 5'-änden av genen och krävs för korrekt lokalisering av proteinprodukten i periplasman.
    3. Använda alla tillgängliga oligo-analysator program, kontrollera att strykningen primers har GC-innehåll mellan 40-60%, låg hårnål smälttemperatur (Tm), låg själv- och hetero-dimerise T M: s. Beställa primers för syntes och transport från alla tillgängliga bioteknikföretag.
    4. Använda pK184-genkonstruktion som erhållits i protokoll 1,3 som mall och riktlinjerna i 1.2.7-1.2.8, PCR förstärka deletionskonstruktioner med primers utformade i steg 1.4.1-1.4.3 att generera pK184-gen AX amplikoner . Store amplifierat DNA ettt -20 ° C.
    5. Ligate den förstärkta konstruktionen med hjälp av alla tillgängliga mutagenes kit (Material tabell).
    6. Omvandla varje pK184-gen AX ligater separat i kemiskt kompetenta DH5a-celler med en vanlig värmechock protokoll (se 1.3.11-1.3.13).
    7. Alikvot en 100 mikroliter volym av prov från varje ligeringsreaktion i 1.4.12 på en agarplatta innehållande 50 ug / ml Km och sprida cellerna med en steril spridare. Håll området steril och arbeta nära en eld. Inkubera plattan upp och ner vid 37 ° C över natten.
    8. Med användning av en steril pipett eller ögla, skörda en enda distinkt koloni av celler och inokulera en 20 ml steril LB-medium med 50 mikrogram / ml Km. Håll området steril och arbeta nära en eld. Odla cellerna O / N vid 37 ° C med skakning vid 200 rpm.
    9. Göra 3-5 glycerollager av de transformerade DH5a-celler genom att blanda 500 mikroliter av O / N-kulturen med 500 mikroliter av steril 100% glycerol (fInal 50% volym / volym) i sterila Cryo-rör. Förvara vid -80 ° C.
    10. Centrifug 6-8 ml av O / N-kulturen vid rumstemperatur, 5000 xg i 3 min. Dekantera supernatanten och extrahera pK184 genen AX plasmidkonstruktion från pelleten med hjälp av en plasmid mini-prep kit (Material tabell) och tillverkarens protokoll. Store DNA vid -20 ° C.
  • 2. Framställning av pOX38-Tc Δgene :: Cm Stammar

    1. DY330R pOX38-Tc Δgene :: Cm knockouts
      1. Framställa en O / N-kulturen av DY330R pOX38-Tc-celler i 10 ml steril LB innehållande 10 | ig / ml Te. Växa kultur O / N vid 32 ° C och 200 rpm.
      2. Göra en 1:70 spädning av O / N-kulturen i 20 ml färsk steril LB. Odla cellerna vid 32 ° C fram till mitten av log-fasen (OD 600 nm från 0,4 till 0,6) tillväxt.
      3. Överföring 10 ml kultur till en steril kolv och inkubera vid 42 ° C under 15 min vid 150 rpm i ett skakande vattenbad bath. Detta kommer att leda till uttryck av rekombination specifika proteiner i DY330R.
      4. Chill kulturen i ett is-vattenbad i 10 min. Förbereda elektrokompetenta celler enligt följande.
        1. Överför kylda celler i pre-kylda koniska rör och centrifugera vid 4000 xg under 7 minuter vid 4 ° C. Alla rör och pipetter som skall användas i de kommande stegen bör placeras vid 4 ° C eller på is för att svalna.
        2. Avlägsna supernatanten och försiktigt återsuspenderade cellerna i 1 ml iskall DDH 2 O. Lägg till ytterligare 30 ml iskall DDH 2 O.
        3. Centrifugera cellerna (4000 xg, 7 min, 4 ° C), kassera supernatanten och försiktigt återsuspenderade cellerna i 1 ml iskall DDH 2 O.
        4. Överför resuspenderade cellerna i förväg kylda 1,5 ml mikrofugrör och centrifugera vid 15.000 xg under 1 min vid 4 ° C.
        5. Resuspenderades försiktigt pelleten i 200 mikroliter av iskall DDH 2 O och delprov i 50 mikroliter volymer. Electrocompetent-celler kan lagras vid -80 ° C
      5. Tillsätt 300 ng av det amplifierade CAT kassetten från 1,2 till 50 mikroliter av elektrokompetenta DY330R pOX38-Tc-celler under blandning på is, försiktigt genom pipettering upp och ned. Upprepa detta steg med hjälp av omodifierad pBAD33 plasmid som en positiv kontroll.
      6. Överföra celler till en i förväg kyld (-20 ° C) 1 mm elektroporeringskyvett. Electroporate cellerna vid 1,8 kV med en tidskonstant på 5,5 ms, med användning av en elektroporator. Omedelbart efter applicering av pulsen, späd cellerna med 1 ml SOC media och överföra till ett nytt mikrofugrör. Inkubera cellerna vid 32 ° C under 2 h.
      7. Alikvot 100 mikroliter av varje prov på agarplattor innehållande 10 | ig / ml Tc och 20 mikrogram / ml Cm och sprids med en steril spridare. Håll området steril och arbeta nära en eld. Inkubera plattan upp och ner vid 32 ° C över natten för att selektera för de framgångsrika rekombinanter. CAT kassetten införs i cellen kommer att genomgå homolog rekombination med den intressanta genen och skapa DY330R pOX38-Tc Δgene :: Cm (Rif ^, Tc ^, Cm ^) klon.
        OBS: Det är viktigt att växa DY330R celler vid 32 ° C, med undantag av 15 min induktion vid 42 ° C i steg 2.1.3 före generering av elektrokompetenta celler, eftersom förlängd tillväxt vid förhöjda temperaturer riskerar celldöd på grund av produktionen av giftiga ämnen från p L operonet ansvarig för rekombination funktioner i DY330R. 33,34
      8. Framställa en O / N av DY330R pOX38-Tc Δgene :: Cm-celler genom att skörda en enda distinkt koloni av celler med en steril pipett eller ögla, och inokulering av ett 20 ml sterilt LB-medium med 10 mikrogram / ml Tc, och 20 mikrogram / ml Centimeter. Håll området steril och arbeta nära en eld. Odla cellerna O / N vid 32 ° C med skakning vid 200 rpm.
      9. Gör 3-5 glycerollager från O / N genom att blanda 500 mikroliter av O / N-kulturen med 500 mikroliter av steril 100% glycerol (slutlig 50%, volym / volym) i sterila Cryo-rör. Förvara vid -80 ° C.
      10. Centrifug 6-8 ml av O / N-kulturen vid rumstemperatur, 5000 xg i 3 min. Dekantera supernatanten och extrahera pOX38-Tc Δgene :: Cm konstruera från pelleten med hjälp av en plasmid mini-prep kit (Material tabell) och tillverkarens protokoll; lagra renat DNA vid -20 ° C.
      11. Utför en konjugativ parning analys med hjälp av XK1200 celler som mottagaren att bekräfta avbrott av konjugering av genen knockout enligt protokoll 3,1.
    2. DY330R pOX38-Tc Δgene :: Cm + pK184-gen
      1. Transformera elektro DY330R pOX38-Tc Δgene :: Cm celler med 300 ng av pK184-genkonstruktion via elektroporering enligt steg 2.1.4-2.1.7. Alla selektiva medier måste innehålla 20 mikrogram / ml Cm och 50 mikrogram / ml Km. Inkubera vid 32 ° C. Återhämtningen plasmid i de elektroporerade cellerna kommer nu återställa funktionen hos den utslagna genen i DY330R pOX38-Tc Δgene :: Cm celler.
      2. Framställa en O / N av DY330R pOX38-Tc Δgene :: Cm + pK184-gen-rekombinanta celler genom att skörda en enda distinkt koloni av cellerna med en steril pipett eller ögla, och inokulering av ett 20 ml sterilt LB-medium med 20 | ig / ml Cm och 50 | j, g / ml Km. Håll området steril och arbeta nära en eld. Odla cellerna O / N vid 32 ° C med skakning vid 200 rpm.
      3. Göra 3-5 glycerolstamlösningar från O / N genom att blanda 500 mikroliter av O / N-kulturen med 500 mikroliter av steril 100% glycerol (slutlig 50%, volym / volym) i sterila Cryo-rör. Förvara vid -80 ° C.
      4. Utför även protokoll 3,1 att generera XK1200 pOX38-Tc Δgene :: Cm rekombinanta celler.
    3. XK1200 pOX38-Tc Δgene :: Cm + pK184-genen och mutanter
      1. Förbered elektrokompetent XK1200 pOX38-Tc Δgene :: Cm celler (från steg 2.2.4).
      2. Separat electroporate 300 ng pK184-gen eller pK184-gen muterade plasmider i 50 mikroliter av electrocompetent XK1200 pOX38-Tc Δgene :: Cm celler som per steg 2.1.4-2.1.7. Alla selektiva medier bör innehålla 10 mikrogram / ml nalidixinsyra (Nal), 20 | ig / ml Cm och 50 mikrogram / ml Km och inkuberas vid 37 ° C.
      3. Framställa en O / N av XK1200 pOX38-Tc Δgene :: Cm + pK184-gen-rekombinanta celler genom att skörda en enda distinkt koloni av cellerna med en steril pipett eller ögla, och inokulering av ett 20 ml sterilt LB-medium med Nal, 20 | ig / ml cm och 50 ^ g / ml Km. Håll området steril och arbeta nära en eld. Odla cellerna O / N vid 37 ° C med skakning vid 200 rpm.
      4. Göra 3-5 glycerolstamlösningar från O / N genom att blanda 500 mikroliter av O / N-kulturen med 500 mikroliter av steril 100% glycerol (slutlig 50%, volym / volym) i sterila Cryo-rör. Förvara vid -80 ° C.

    3. konjugativ Parning Analyser

    1. Konjugativ Mating att generera XK1200 pOX38-Tc Δgene :: Cm Cells
      1. Förbered en 20 ml steril LB O / N culning av DY330R pOX38-Tc Δgene :: Cm + pK184-gen-celler genom användning av en steril pipett eller slinga för att inokulera en 20 ml steril LB innehållande 20 | ig / ml Cm och 50 mikrogram / ml Km med en glycerol lager eller enstaka koloni på en agarplatta. Växa vid 32 ° C med skakning vid 200 rpm. Förbereda densamma för XK1200 celler i 20 ml steril LB med 10 | ig / ml Nal, växer vid 37 ° C.
      2. Göra 1:70 spädningar av varje kultur separat i 2 ml sterilt LB med samma antibiotiska innehållet; lägga glukos till en slutlig koncentration av 100 mM till alla givarceller. Odla celler till mitten av log-fasen (OD 600 0,5 till 0,7) vid 37 ° C med skakning vid 200 rpm.
      3. Centrifug (4000 x g under 5 min vid 4 ° C) för att pelletera celler, kasta supernatanten, tvätta en gång med kall steril LB för att avlägsna antibiotika, och återsuspendera cellerna i 2 ml kallt sterilt LB.
      4. Alikvot 100 mikroliter av varje kultur in i 800 mikroliter av sterila LB media och tillåta dem att para vid 32 ° C under 1 h utan skakning.
      5. <li> Vortex cellerna under 30 s för att störa de mötande par och placera dem på is i 10 min för att förhindra ytterligare parning.
      6. Alikvot 100 mikroliter av cellblandningen på en agarplatta innehållande 10 ug / ml Nal och 20 mikrogram / ml Cm för att selektera för XK1200 pOX38-Tc Δgene :: Cm celler. Sprid cellerna med hjälp av en steril spridare. Håll området steril och arbeta nära en eld. Inkuberades plattan O / N vid 37 ° C upp-och-ner.
      7. Skörda en enda koloni av den nya XK1200 pOX38-Tc Δ gen :: Cm knockout-stammen med hjälp av en steril pipett eller slinga och växa i steril LB med 20 mikrogram / ml Cm, O / N vid 37 ° C med skakning vid 200 rpm. Göra 3-5 glycerolstamlösningar från O / N genom att blanda 500 mikroliter av O / N-kulturen med 500 mikroliter av steril 100% glycerol (slutlig 50%, volym / volym) i sterila Cryo-rör. Förvara vid -80 ° C.
        Obs: De resulterande cellerna kan nu göras kompetenta för transformation med pK184-genkonstruktionerna (protokoll 1.3 och 1.4) för assEssing genen och dess mutanter på förmågan att återvinna konjugativ transfer i protokoll 3,2.
    2. Konjugativ parning analys från XK1200 Donatorer till MC4100 Mottagare
      1. Förbered en O / N-kulturen av XK1200 pOX38-Tc Δgene :: Cm + pK184-gen celler i 20 ml steril LB med 20 | ig / ml Cm, 50 mikrogram / ml Km och MC4100-celler i 5 ml LB med 50 | ig / ml streptomycin (Sm) med användning av celler från en glycerolstock eller enstaka koloni på en agarplatta och steril pipett eller slinga. Väx kulturer på 37 ° C med 200 rpm skakning.
      2. Göra 1:70 spädningar från varje O / N-kulturen separat i 2 ml sterilt LB med samma antibiotika. Lägga glukos till en slutlig koncentration av 100 mM till alla givarceller. Odla celler till mitten av log-fasen (OD 600 0,5 till 0,7) vid 37 ° C med skakning vid 200 rpm.
      3. Centrifug (4000 x g under 5 min vid 4 ° C) för att pelletera celler, kasta supernatanten, tvätta en gång med kall steril LB att avlägsna antibiotics, och återsuspendera cellerna i 2 ml kall steril LB.
      4. I två exemplar, alikvot 100 mikroliter av varje kultur in i 800 mikroliter av sterila LB media och tillåta dem att para vid 37 ° C under 1 h utan skakning.
      5. Vortex cellerna under 30 s för att störa de hoppassande par och placera dem på is under 10 min för att förhindra ytterligare parning.
      6. Med hjälp av mellanlogg kulturer från steg 3.2.2 och färsk steril LB, förbereda 6 serieutspädningar av givar- och mottagarceller från 10 -2 till 10 -7.
      7. På var och en av två halvor av en agarplatta innehållande 10 ug / ml Nal, 20 | ig / ml Cm och 50 mikrogram / ml Km, fläck 10 mikroliter alikvoter av varje utspädning av XK1200 donatorceller, såsom visas i figur 2. Upprepa för utspädningar av mottagande MC4100 cellerna på agarplattor innehållande 50 mikrogram / ml Sm. Inkubera plattorna O / N vid 37 ° C.
      8. Använda virvlades blandningen från steg 3.2.5 och färsk steril LB, förbereda 6 utspädningar (10 -2 till 10 -7 figur 2. Upprepa för båda dubblerade blandningar. Håll området steril och arbeta nära en eld. Inkubera plattorna O / N vid 37 ° C.
      9. Bestämma parning effektiviteten hos varje konstruktion som beskrivs i protokoll 3,3.
      10. Upprepa detta protokoll för alla indrivnings plasmider för att utvärdera effekten av en viss mutation på effektiviteten av konjugering.
    3. Beräkning av parning Effektivitet
      1. Räkna antalet kolonier från samma utspädnings observation för varje givare, mottagare och transconjugant celler på deras respektive plattor.
      2. Räkna mottagande kolonier att testa någon bias som skulle bli följden av att ha ett större antal transkonjuganter än mottagarna på att med tanke på utspädning.
      3. Calculate sammankopplingseffektiviteten som antalet transconjugant kolonier dividerat med antalet givar kolonier. Multiplicera med 100 för att få effektivitet värde per 100 donatorceller.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Processen för F-plasmid-driven konjugation är en koordinerad process som involverar överföringsproteiner inom tra regionen av F-plasmid som monterar en T4SS att underlätta pilus syntes och konjugativ DNA-överföring. Proteinet TRAF (GenBank anslutning # BAA97961, UniProt ID P14497) krävs för konjugativ F-pilus bildande. 10,14,35 - 37 Proteinet innehåller en C-terminal tioredoxin-liknande domänen, även om det inte har den katalytiska CXXC motiv. 35,38 Även om det har förutsagts att interagera med Trah proteinet genom dess N-terminal domän, 39 en region visat sig vara mer dynamisk än dess C-terminala domänen, 37 inte mycket annat är känt om proteinets strukturella drag. För att bedöma de funktionella aspekterna av TRAF-proteinet i kombination med strukturella studier, att rå vi ut den TRAF-genen på pOX38-Tc via homologrekombination, generering av pOX38-Tc ΔtraF :: Cm-plasmiden (tabell 1) i E. coli DY330R celler. 33,34 Också genereras var pK184-TRAF plasmiden från TRAF -specifika primers (tabell 2) för att tillhandahålla återvinning av konjugering och möjliggöra sondering proteinets sekvens. Överföringen av pOX38-Tc ΔtraF :: Cm plasmiden i XK1200 celler 40 från DY330R celler när pK184-TRAF lämnades i trans (transkonjuganter odlas på 10 mikrogram / ml Nal, 10 mikrogram / ml Tc och 20 mikrogram / ml Cm) indikerar att (a) den TRAF knockout i pOx38-Tc ΔtraF :: Cm tillhandahåller en in-frame CAT kassett, och (b) att pK184-TRAF kan återställa konjugativ funktion.

    En serie TRAF mutanter genererades för analys med hjälp av konjugativ parning analys 37 med hjälp av XK1200 pOX38-Tc ΔtraF :: Cm + pK184-Traf AXceller och MC4100 celler 41 som givare och mottagare, respektive. En representativ mutant är TRAF 55-247 (tabell 1), en N-terminal deletionsmutant som tar bort den region av proteinet förutsägs interagera med trah. När fullängds TRAF-protein tillhandahålls till donatorcellerna, är konjugativ transfer återställd (figur 2), samtidigt som den ger de tomma plasmiden pK184 inte (Tabell 3). På liknande sätt är konjugativ funktion i XK1200 givarceller inte återställas när den förses med plasmiden pK184-TRAF 55-247 (tabell 3). Detta indikerar att den trunkerade region av proteinet är viktig för TRAF s funktion inom konjugativ apparaten, troligen genom interaktion med Trah, och ger en region av proteinet till målet för ytterligare mutationsanalys.

    Figur 1
    in träns via en återhämtnings plasmid (pK184-gen). Den resulterande pOX38-Tc Δgene :: Cm plasmiden överförs till en XK1200 stam (steg 2) för ytterligare bedömning av genen med hjälp av parnings analyser med en MC4100 mottagare (steg 3). Klicka här för att se en större version av denna siffra.

    figur 2
    Figur 2: Mating analys för att bedöma målet genens funktion i konjugering. Givare och mottagare celler E. coli XK1200 pOX38-Tc ΔtraF :: Cm transformerad med pK184-Traf och MC4100, respektive. De resulterande transkonjuganter (MC4100 pOX38-Tc ΔtraF :: Cm) växa på plattor innehållande Sm och Cm, vilket indikerar en lyckad återhämtning av konjugativ funktion. Experimentet utförs i duplikat på en enda agarplatta, och seriespädningar används för att beräkna den hoppassande effektivitet reparativ genprodukter mutanter (tabell 2). Klicka här för att se en större version av denna siffra.

    Bakteriestam / Plasmid relevanta egenskaper Selektiv markör (er) Referens
    bakterie~~POS=TRUNC
    DY330R W3110 ΔlacU169 gal490 λc1857 Δ (cro-bioA) Rif R Rif 33,34
    XK1200 F - lacΔU124 Δ (nadA aroG gal attλ bio gyrA) Nal 40
    MC4100 araD139 Δ (argF-lac) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR sm 41
    Vektorer och konstruktioner
    pBAD33 Plasmid för uttryck under från P araBAD Centimeter 32
    pK184 2,4 kb kloningsvektor, p15a replikon km 31
    pK184-TRAF </ Td> F TRAF från pOX38 i pK184 km 35
    pK184-TRAF 56-247 F TRAF aa 56-247 från pK184-TRAF km
    konjugering Plasmider
    pOX38-Tc IncFI, Tra +, RepFIA + F1 Hindlll-fragmentet av F, mini-Tn tc 29,30
    pOX38-Tc ΔtraF :: Cm pOX38-Tc med CAT insatt i TRAF tc Cm 35
    † Cm, kloramfenikol; Km, kanamycin; Nal, nalidixinsyra; Rif, rifampicin; Sm, streptomycin; Tc, tetracyklin
    ‡ Alla TRAF-konstruktioner innehåller den 19-resters ledarsekvens för att säkerställa lokalisering till det periplasmatiska utrymmet.

    Bord 1: coli-stammar och plasmider som används i denna studie.

    Konstruera Primer*
    TRAF-Cm-For 5'GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC -3 '
    TRAF-Cm-Rev 5'TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG -3 '
    pK184-Traf-For 5'tttttt GAATTC TATGAATAAAGCATTACTGCCAC -3 '
    pK184-Traf-Rev 5'tttttt AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA -3 '
    pK184-TRAF 55-247 -För 5'-TACG CATATG ATGGCCGCACTGCAGACGG -3 '
    pK184-TRAF 55-247 5'-TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA -3 '
    † tabell anpassat från Lento et al. 2016 35 med tillstånd
    * Traf hängande regioner kursiv. Restriktionsenzymställen är understrukna (Hindlll: AAGCTT, EcoRI: GAATTC, Ndel: CATATG)

    Tabell 2: En lista över primrar som används i denna studie.

    Donatorplasmid † återhämtning Plasmid Transkonjuganter ‡ § (celler ml -1) Parning Efficiency§ ||
    pOX38-Tc ΔtraF :: Cm Ingen 0 0
    pOX38-Tc ΔtraF :: Cm pK184 0 0
    pOX38-Tc ΔtraF :: Cm pK184-TRAF 5 x 10 3 0,0167
    pOX38-Tc ΔtraF :: Cm pK184-TRAF 55-247 0 0
    * Tabell anpassat från Lento et al. 2016 35 med tillstånd
    † Donator celler E. coli XK1200, med en genomsnittlig koncentration av 3 x 10 7 celler mL -1
    ‡ Mottagande cellerna var E. coli MC4100. Antalet transkonjuganter för den positiva kontrollen är från en 10-5 utspädning. 0 indikerar inga transkonjuganter från en 10-2 utspädning.
    §An genomsnitt två till fyra parning experiment utfördes för varje konstruktion.
    || Parning effektiviteten är defined som transkonjuganter per 100 donatorceller. 0 parning effektivitet visar inga transkonjuganter från en 10-2 utspädning

    Tabell 3: Abolished parning effektivitet genom tra deletionskonstruktioner.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    Konjugation process bildar ett medel med vilka bakterier kan spridas gener som ger en evolutionär fördel för tillväxten i krävande miljöer, såsom spridning av antibiotikaresistensmarkörer. Eftersom många av de konjugering plasmider är så stor, 12 funktionella studier på proteiner som är involverade i montering av överföringsapparaten genom mutation av målgener på konjugativ plasmiden själv är otymplig. De protokoll som beskrivs häri tillhandahåller ett medel med vilket en kan lättare bedöma målgenen av intresse genom användning av mindre, mer hanterbara expressionsplasmider (Figur 1). Vi använder F plasmidderivat pOX38-Tc (tabell 1) för att studera F-plasmid-medierad konjugation; andra konjugering plasmider kan studeras med hjälp av de protokoll som beskrivs här och lämpliga derivat plasmider. De passande analyser som beskrivs har anpassats från Frost och kollegor, 42 med vissa modifications. I tidigare studier har 8,33,42 skapandet av pOX38-Tc Δgene :: Cm konstruktion uppnås genom att klyva den intressanta genen med lämpliga restriktionsenzymer och sätta den förstärkta CAT kassetten i pOX38-Tc. 42 I den nuvarande metoden, använder vi homolog rekombination i recombineering E. coli-stam DY330R 33,34 till knockout målgenen och ersätta det med CAT kassetten. Detta har en fördel av att låta den resulterande DY330R stam härbärgerande pOX38-Tc Δgene :: Cm konstruera att fungera som en kontroll för genspecifika knockout ut F-T4SS medierad konjugativ överföring via återvinning av med hjälp av det pK184-genen återhämtning plasmid . Även om det kan vara möjligt att generera knockouts med hjälp av en skarpare-Cas9 metodik, 43 har vi inte just nu undersökt denna möjlighet.

    Processen börjar med genereringen av en gen knockout i F-derivatet plasmiden pOX38-Tc (Figure 1). Detta uppnås via homolog rekombination i DY330R-celler (Tabell 1), kan andra stammar med liknande funktioner som DY329, DY331 och DY378 också användas. Primers är ursprungligen tänkt att PCR förstärka CAT kassetten från pBAD33 plasmiden 32 och innehåller överhängande baser som är specifika för målgenen (tabell 2); PCR-produkten är sedan elektroporerades in DY330R celler som härbärgerar pOX38-Tc. Homolog rekombination genererar knock-out plasmid pOX38-Tc Δgene :: Cm där CAT kassetten är insatt i ram inom målgenen effektivt störa T4SS montering och konjugering samtidigt som Cm motstånd. Samtidigt, är målgenen PCR amplifierades från pOX38-Tc och sattes in i en liten expressionsplasmid; i detta protokoll använder vi pK184 för konstitutivt uttryck, men en skulle kunna valde en plasmid med inducerbar expression av målgenen om så önskas. Den pK184-genen plasmiden transformeras därefteri DY330R pOX38-Tc Δgene :: Cm celler, och dessa celler används sedan som givare att överföra pOX38-Tc Δgene :: Cm konstruera via konjugering i XK1200 celler för parning analyser. I de passande analyser, donator- och mottagarceller är XK1200 pOX38-Tc Δgene :: Cm och MC4100, respektive. Den pK184-genen återvinning plasmiden, liksom mutanter av målgenen (deletioner eller punktmutationer) serien, är anordnad för att donatorcellerna för att bedöma deras förmåga att återställa parning, och bestämma dess effektivitet, med MC4100 mottagarceller (Figur 2 ; Tabell 3).

    Kritiskt för förfarandet är användningen av lämpliga givare och mottagare stammar (tabell 1), och utformningen av de primrar som används. För varje primer utformad, det finns allmänna riktlinjer som bör följas. Även om vi strikt försöker följa med 40-60% GC-innehåll, kan detta inte alltid möjligt. I sådana fall är det försöksledaren gottfinnande för att testa en primer wte GC-halt strax under eller över detta område. Smälttemperaturen (Tm) hos den fram- och back primern måste vara lika, och glödgningstemperaturen (T a) värdet bör alltid vara lägre än Tm av 2-5 ° C under PCR. Den fria energi som finns tillgänglig för att tillåta en hårnål att utveckla bör vara mycket lägre än den T a, medan den homo- och heterodimerisering T m 's måste vara mycket låg (mindre än -10 kJ och 30 ° C). Primrar kan utformas för att sondera deletioner, insertioner eller punktmutationer som önskas. Det är naturligtvis kritiskt att den resulterande genkonstruktionen amplifieras och ligeras in i återvinnings plasmid i-ramen så att den är korrekt uttryckas. Transformation av kompetenta celler kan göras via elektroporering eller värmechock med användning av elektrokompetenta eller kemiskt kompetenta celler, respektive. Vi finner att elektroporation är effektivare för större konstruktioner såsom pOX38-Tc och homolog rekombination oligonucleotide, medan de mindre expressionsplasmider såsom pK184-TRAF kan lätt transformeras till celler med användning av värmechock metoder. Slutligen är det viktigt att komma ihåg att det kommer att finnas flera antibiotika som används i hela protokollet, som både givare och mottagare stammar kräver olika resistanser som skiljer sig från de som används på konjugering och återvinning plasmider.

    Bortsett från de samverkande analyser tekniker som beskrivs här, finns det andra metoder som används för att studera konjugation, varierar något i sin strategi. Horisontell genöverföring är en process där bakterier överföra en plasmid till en mottagande cell, inklusive mellan arter mottagare. 44 En studie av Dahlberg och kollegor 44 till exempel används konjugation att fastställa omfattningen av mellan arter horisontell genöverföring. De utnyttjade inkorporeringen av grönt fluorescerande protein (GFP) i en plasmid klonades in KT2442 celler; det kromosomala lac Ig-genen i KT2442 cellerna undertrycka GFP uttryck. När plasmid som bär GFP överförs till en art utan lacl q-genen, är fluorescens som observeras. 44 Trots sin begränsning att ge protein specifik funktion i olika arter, kunde mellan arter konjugering experimentet eventuellt i kombination med de protokoll som presenteras här att göra evolutionära prognoser för protein-proteininteraktioner mellan olika arter.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Författarna förklarar att de inte har några konkurrerande ekonomiska intressen.

    Acknowledgments

    Denna forskning stöds av en Discovery Grant från Naturvetenskaps & Engineering Council of Canada (NSERC).

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics