Konjugering Parring Analyser for Sekvens-specifik analyse af Transfer proteiner involveret i konjugation

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Overførsel af gener og proteiner i mikro-organismal niveau spiller en central rolle i bakteriel overlevelse og evolution samt infektion processer. Udveksling af DNA mellem bakterier eller mellem en bakterie og en celle kan opnås ved transformation, konjugation eller vektor transduktion. 1,2 Konjugering er unik i forhold til transformation og transduktion ved, at under konjugering mellem gram-negative bakterier, såsom Escherichia coli, overførsel af DNA sker i en donor-styret måde, hvorved en kompleks makromolekylær system forbinder donor- og recipientceller. Konjugation er også den mest direkte måde, hvorpå bakterieceller interagerer med værtsceller at injicere gener, proteiner eller kemikalier i at værtssystemer. 3 Ofte overførsel af midler har bemærkelsesværdige virkninger på værten, der spænder fra patogenese og carcinogenese at være vært evolution og tilpasning. Det er blevet påvist, at konjugerende recombination Forhøjer tilpasningen 3 gange i bakterier med høje mutationsrater under forhold af miljømæssig stress. 4 Desuden konjugering er langt den mest almindelige vej, hvorigennem antibiotikaresistensgener i bakteriestammer er spredt. 5,6

Mikroorganismer har udviklet specialiserede sekretion systemer til at støtte overførsel af makromolekyler tværs cellemembraner; der i øjeblikket 9 typer af sekretion systemer (TSSs) i gram-negative bakterier, der er blevet beskrevet: T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS, samt Sec (sekretion) og Tat (to-arginin translokation) pathways. 7,8 Hver type sekretionssystem er yderligere opdelt i forskellige undertyper, en nødvendighed på grund af mangfoldigheden af proteiner og særpræg involverede veje, i forskellige bakteriestammer. For eksempel i type IV sekretionssystem (T4SS), Ti og Cag befordrer effektor transport hvorimod F-plasmid, R27 and pKM101 T4SSs lette overførsel af en konjugerende plasmid. 7,9,10 En detaljeret forståelse af de mekanismer, som organismer samler deres respektive sekretion systemer fra deres komponent proteiner og deler cellulære indhold med en modtager eller deres omgivende miljø er en vigtig faktor i udviklingen af målrettede strategier til bekæmpelse af sygdomsfremkaldende mikroorganismer og processer cellulær infektion.

Efter den indledende identifikation konjugation i E. coli ved Lederberg & Tatum, 11 er blevet identificeret og karakteriseret et stort antal mobile og konjugering plasmider. 12 Sådanne mobile plasmider viser betydelig rækkevidde er størrelse (fra 1 til over 200 kilobaser (kb)), men alle mobile plasmider indeholder en relaxase, som anerkender oprindelsen af overførsel (oriT) hvorved transmissionen af plasmidet. Konjugering plasmider yderligere koder gener for samling af en funktionel T4SS samt en typeIV kobling protein. 12 For eksempel 100 kb F plasmid af E. coli koder alle de konjugering gener i en 33,3 kB overførsel (tra) region. 13 Generne i tra region af F-plasmid koder for alle proteiner, der fremmer pilus-dannelse, parring pair formation (MPF), DNA-overførsel og eksklusionskriterier funktioner under konjugativ plasmid overførsel. 10,14,15 En væsentlig mængde af viden er tilgængelig for konjugativ T4SSs dog detaljerede strukturelle undersøgelser af konjugering proteiner og komplekser kun for nylig bliver tilgængelige. 16 - 28

For at samle et overblik over den konjugative proces en kobling af detaljerede strukturelle studier at mutationelle analyser af konjugering transfer proteiner påkrævet. Dette kan opnås gennem konjugering parring assays. For F-plasmid, hvert protein kodet inden for tra region spiller en rolle i F-medieret conjugation; derfor vil knockout / deletion af en overførsel gen afskaffe konjugative kapacitet af cellen (figur 1). Mens mindre mobile plasmider er mere befordrende for standard sletningsprocedurer, for større konjugering plasmider, såsom F, er gen-knockouts mere let opnås via homolog rekombination, hvor målgenet er erstattet med én formidle et distinkt antibiotikaresistensgen. I den nuværende protokol, beskæftiger vi homolog rekombination til at erstatte en overførsel gen af ​​interesse med chloramphenicolacetyltransferase (CAT) i 55 kb F plasmid derivat pOX38-Tc; 29,30 den resulterende knockout plasmid, pOX38-Tc Δgene :: Cm, letter modstand mod chloramphenicol (Cm) i vækstmediet. Donorceller huser pOX38-Tc Δgene :: Cm er ude af stand til at påvirke konjugative DNA-overførsel / parring som observeret ved anvendelse af en dertil passende assay; parring effektiviteten af ​​en pOX38-Tc Δgene :: Cm donor celle og en normal Recipient vil falde eller, oftere, afskaffes. Konjugative overførsel af pOX38-Tc Δgene :: Cm plasmid kan gendannes via en lille opsving plasmid, det målrettede overførsel genet. Dette opsving plasmid kan være en, der giver konstitutiv ekspression, såsom plasmid pK184 (pK184-genet), 31 eller en, der giver inducerbar ekspression så længe denne plasmidet korrekt målretter gen til den korrekte placering i cellen (cytoplasma eller periplasmaet). Følgelig i hinanden passende assays mellem denne nye donor (huser pOX38-Tc Δgene :: Cm + pK184-gen-plasmider) og en modtager celle, forventes parring effektivitet til at gendanne til næsten en normal donor-recipient parring assay. Dette system gør det muligt at undersøge funktionen af ​​det bankede ud genet ved produktion af en række pK184-genkonstruktioner (deletioner eller punktmutationer) og teste hver konstruktion evne til at genoprette den sammenpassende kapacitet pOX38-Tc Δgene :: Cm skjult donorcelles.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Dannelse af DNA-konstruktioner

  1. Designe Oligomerer for homolog rekombination af målgenet
    1. Design en enkelt 55-72 bp fremad oligomer som følger: (a) vælge en 19-32 bp lang nukleotidsekvens, der er homolog med en DNA-sekvens i regionen 10-100 bp opstrøms for 5'-startstedet for chloramphenicolacetyltransferase-gen i den kommercielle pBAD33 plasmid, 32 og (b) vælge en 36-54 bp lang nukleotidsekvens homolog med en region 10-150 bp nedstrøms for 5'startstedet af målgenet af interesse.
      1. Slutte 3'-enden af ​​nukleotidsekvensen plukket i (b) til 5'-enden af ​​nucleotidsekvensen plukket i (a), hvilket giver en enkelt 55-72 lang fremad oligomer.
    2. Design en enkelt 55-72 bp omvendte oligomer som følger: (a) vælge en 19-32 bp lang nukleotidsekvens, der er homolog med en DNA-sekvens i regionen 10-100 bp nedstrømsaf 3'-enden af ​​chloramphenicol-genet i den kommercielle pBAD33 plasmidet, og (b) vælge en 36-54 bp lang nukleotidsekvens homolog til en region i 10-150 bp opstrøms for 3 'enden målstedet genet af interesse .
      1. Slutte 3'-enden af ​​nukleotidsekvensen plukket i (b) til 5'-enden af ​​nucleotidsekvensen plukket i (a) at gøre det en enkelt oligomer.
      2. Kopiere denne oligomer til en ledig bioinformatik-software og konvertere sekvens i dens omvendte komplement. Dette vil give en enkelt 55-72 bp lange reverse oligomer.
    3. Brug alle tilgængelige oligo-analysator program, kontrollere, at rekombination oligomerer har GC-indhold mellem 40-60%, lav hårnål smeltetemperatur (T m), lav selv- og hetero-dimerisering T m 's. Bestil primere til syntese og forsendelse fra enhver foretrukne biotekselskab.
  2. Forstærkning af CAT Cassette fra pBAD33 (Cm R
  3. Grow overnatning (O / N, 16-18 h) kultur af DH5a celler, der huser den pBAD33 plasmid i sterilt lysogeni bouillon (LB) med 20 ug / ml chloramphenicol (Cm) under omrystning ved 200 rpm og 37 ° C.
  4. Centrifuge 6-8 ml af O / N-kulturen ved stuetemperatur, 5.000 xg i 3 min. Dekanteres og udtrække pBAD33 plasmidet fra pillen ved hjælp af et plasmid mini-prep-kit (Materialer Table) og producentens protokol.
  5. Gøre en fordøjelse af den pBAD33 plasmid-DNA ved at tilføje følgende i et sterilt rør i den angivne rækkefølge: passende volumen dobbeltdestilleret vand (Hedeselskabet 2 O) til et slutvolumen på 50 pi, 1 ug volumen pBAD33 plasmid, 5 pi 10x enzymreaktion puffer og 0,5 pi Aval restriktionsenzym (RE). bland forsigtigt ved pipettering og lad reaktionen fortsætte i 1 time ved 37 ° C. Heat inaktivere reaktionen i 20 minutter (min) ved 80° C. Opbevar prøverne ved -20 ° C i højst 24 timer for at minimere klæbrig-ende nedbrydning.
  6. Der fremstilles en 1,2% agarose adskillende gel ved blanding af 1,2 g agarose med 100 ml 1x TAE (40 mM Tris, pH 8,5; 20 mM eddikesyre; 1 mM EDTA) buffer i en 250 ml Erlenmeyer-kolbe. Varme og hvirvel for at opløse i en mikrobølgeovn. Stop opvarmning straks når væsken begynder at koge, og kolben hvirvel.
    1. Afkøl flydende agarose i 3 min ved stuetemperatur, medens hvirvlende, tilsættes 2 pi 10 mg / ml ethidiumbromid og hvirvel for at blande. Hæld agarose til en gel bakke med et godt kam og lad det størkne i 1 time ved stuetemperatur. Opbevar geler ved 4 ° C i op til 2 dage i 1x TAE buffer.
  7. Bland hver RE fordøje fra 1.2.3 med 0,2 volumen af ​​DNA loading dye (10 pi farvestof pr 50 pi reaktion) ved pipettering. Belastning 5 pi 500 pg / ml DNA-stige ind i den første brønd og alle RE digest-farvestofblanding til en anden brønd på engarose gel. Brug 2-3 brønde til at indlæse alle reaktionsvolumenet på gelen.
    1. Kør gelen knapt nedsænket i 1 x TAE buffer og drives ved 45-50 V (4,5-5 V / cm) i 65 minutter i en gelelektroforese enhed.
  8. Anvendelse af en UV kabinet og et sterilt barberblad, skåret hurtigt 2,8 kb bånd, som svarer til CAT sekvensen ud af gelen for at minimere UV-eksponering af DNA. Ekstrahere DNA fra udskæringen gelskive under anvendelse af et Gel Extraction kit (Materialetabel) ifølge fabrikantens protokol.
    Bemærk: Pas på ikke at udsætte huden direkte under UV og håndtere barbermaskine med omhu.
  9. Forstærke CAT-kassetten ekstraheret fra 1.2.6 ved polymerasekædereaktion (PCR) under anvendelse af primerne designet i 1.1, som indeholder udhæng homologe med gensekvensen for at tillade homolog rekombination. PCR-reaktioner er sat op på is under anvendelse af retningslinjerne fabrikanten (Materialetabel) i følgende rækkefølge:
    1. ind i ensterilt PCR-rør, tilsætte en passende volumen af Hedeselskabet 2 O til et endeligt volumen på 50 pi, efterfulgt af 10 pi PCR-buffer, 1 pi 10 mM dNTP'er, 2,5 pi 10 pM Forward primer, 2,5 pi 10 pM Reverse primer , 1-25 ng template-DNA fra 1.2.6 og 0,5 pi 100 enheder / pl DNA-polymerase.
    2. Opsætning af en negativ kontrol, der bærer de samme komponenter som 1.2.7.1 men med undtagelse af template-DNA. Brug en passende mængde Hedeselskabet 2 O i stedet for template-DNA. Opsæt en positiv kontrol ved hjælp template-DNA og primere der har vist sig at arbejde i en PCR-reaktion, såsom dem, som positiv kontrol af producenten.
    3. Bland alle reaktionsindholdet forsigtigt ved pipettering.
    4. Amplificere via PCR under anvendelse af følgende indstillinger: Initial denaturering i 30 sekunder ved 98 ° C, 30 cykler denaturering i 10 sekunder ved 98 ° C, primerannealing i 20 s, forlængelse i 20 s pr kilobase af amplikon ved 72 ° C og en final forlængelse i 10 minutter ved 72 ° C. Opbevar prøverne ved -20 ºC.
  10. Bekræft den korrekte størrelse af forstærkning via agarosegelelektroforese (se 1.2.4-1.2.5) ved hjælp af kun 5 pi af hver reaktion. Oprens PCR-amplikon under anvendelse af et PCR-oprensningskit og fabrikantens protokol. Store oprenset DNA ved -20 * C.
  • Den pK184-gen Recovery plasmid
    1. Design en fremadrettet primer begyndende fra 5'-enden og går mod 3'-enden i følgende rækkefølge: (a) samle 4 tilfældige nucleotider (en kombination af adenin, thymin, guanin og cytosin) til spaltning effektivitet, der er knyttet til (b) EcoRI restriktionsenzym (RE) kløvningspunkt sekvens (GAATTC), efterfulgt af (c) en 21-25 bp lang nukleotidsekvens, der er homolog med 5'-enden af ​​genet af interesse, herunder startkodonen. Hvis målet genet indeholder en EcoRI site, vælge en anden passende RE fra pK184 multiple kloningssted.
    2. I tilfælde af gener kodende periplasmatiske proteiner, omfatte yderligere en ledersekvens mellem VE-stedet og startkodonen på den fremadrettede primer.
    3. Brug alle tilgængelige oligo-analysator, kontrollere, at primerne har GC-indhold mellem 40-60%, lav hårnål T m, lav selv- og hetero-dimerisering T m 's. Bestil primere til syntese.
    4. Grow en O / N-kulturen af ​​DY330R pOX38-TC celler i sterilt LB indeholdende 10 ug / ml tetracyclin (Tc) under omrystning ved 32 ºC og 200 rpm. Centrifuge 6-8 ml af O / N-kulturen ved stuetemperatur, 5.000 xg i 3 min. dekanteressupernatanten og ekstrahere plasmid-DNA fra pelleten under anvendelse af en plasmid mini-prep-kittet (Materialer Table) og fabrikantens protokol.
    5. Amplificere fuld gen af ​​interesse med primerne fra 1.3.1-1.3.5 hjælp pOX38-Tc som template (se 1.2.7.1-1.2.7.3).
    6. Bekræft den korrekte størrelse af forstærkning via agarosegelelektroforese (se 1.2.4-1.2.5) ved hjælp af kun 5 pi af hver reaktion. Oprens amplificeret DNA under anvendelse af et PCR-oprensningskit og fabrikantens protokol. Store oprenset DNA ved -20 ° C.
    7. Gøre en dobbelt fordøjelse af både det kommercielt tilgængelige pK184 plasmid-DNA og det amplificerede gen (fra 1.3.7.), Ved at tilføje følgende i et sterilt rør i den angivne rækkefølge: passende volumen af Hedeselskabet 2 O til et endeligt volumen på 50 pi , 1 ug volumen pK184 plasmid, 5 pi 10x enzymreaktion puffer, og 1 pi af hver EcoRI og HindIII.
      1. bland forsigtigt ved pipettering og lad reaktionen forløbe i 1 timeved 37 ºC. Heat inaktivere reaktionen i 20 minutter ved 80 * C. Opbevar prøverne ved -20 ° C i højst 24 timer for at minimere klæbrig-ende nedbrydning.
        Bemærk: Den type restriktion nuklease bruges her afhænger af begrænsning nuklease websted, der blev manipuleret i primerne i trin 1.3.1 og 1.3.2.
      2. Som en positiv kontrol, der er oprettet enkelte fordøjer af pK184 plasmidet ved at forberede den samme reaktion som i 1.3.8, undtagen kun tilføje én af RES i et reagensglas. Gør dette separat med begge res.
    8. Kør fordøjelser på en 1,2% agarosegel under anvendelse protokoller 1.2.4-1.2.5 Uddrag DNA dobbelt fordøjelse fragmenter af både pK184 og genet af interesse i overensstemmelse med trin 1.2.6.
    9. Ligere genet indsatsen ind i pK184 vektor ved tilføjelse af komponenter i et sterilt rør i følgende rækkefølge: 2 pi 10x T4 DNA ligasepuffer, i alt 100 ng DNA sammensat af en 1: 3-vektoren: Indsæt (pK184: genet) ratio, Hedeselskabet 2 O op til entotalt volumen på 20 pi og 1 pi T4 DNA-ligase. Som en negativ kontrol, der er nedsat af en reaktion lig anvendelse af 100 ng af vektoren uden insert genet.
      1. Bland forsigtigt alle reaktionsindholdet Med en mikropipette og inkuberes i 30 minutter ved 25 ° C. Heat-inaktivere ligeringsreaktionen i 10 minutter ved 65 ° C og derefter placere på is.
    10. Mens på is, tilsæt 15 pi af pK184-genet ligeringsreaktion fra trin 1.3.10 til 100 pi af kemisk kompetente DH5a-celler i en steril 1,5 ml rør. bland forsigtigt ved pipettering og inkuberes på is i 10 min. Gør det samme for den negative kontrolprøve. For en positiv kontrol, bruge 20-100 ng af et plasmid som pBAD33 og omdanne den til 50 uL af DHα celler.
    11. Direkte overfører prøverne fra isen i en 42 ° C vandbad og inkuberes i 90 sekunder. Dette giver cellerne en varmechok og giver dem mulighed for optag plasmid-DNA'et.
    12. Placer celler tilbage på is for en anden5 min og tilsæt derefter 900 uL steril LB. Der inkuberes ved 37 ° C i 1 time under omrystning ved 125 rpm.
    13. Alikvot et volumen prøve fra hver ligeringsreaktion i 1.3.13 100 pi på en agarplade indeholdende 50 ug / ml kanamycin (Km) og stryges cellerne under anvendelse af en steril spreder. Den positive kontrol plade skal have passende antibiotika. Hold området sterile og arbejde i nærheden af ​​en flamme. Inkubér pladen på hovedet ved 37 ° C natten over.
    14. Ved hjælp af en steril pipette eller loop, høste en enkelt særskilt koloni af celler og pode en 20 ml steril LB med 50 ug / ml Km. Hold området sterile og arbejde i nærheden af ​​en flamme. Grow cellerne O / N ved 37 ° C under omrystning ved 200 rpm.
    15. Gør 3-5 glycerol lagre af de transformerede DH5a celler ved at blande 500 pi af O / N-kulturen med 500 pi steril 100% glycerol (endelig 50% v / v) i sterile cryo-rør. Opbevar ved -80 ° C.
    16. Også centrifuge 6-8 ml af O / N-kulturen ved stuetemperatur, 5,000 xg i 3 min. Dekanteres og udtrække pK184-genet opsving plasmid fra pillen ved hjælp af et plasmid mini-prep-kit (Materialer Table) og producentens protokol.
  • pK184 - gen Mutants
    Bemærk: Primere designet til deletioner, indsættelser og / eller punktmutationer kan let genereres ved hjælp af producenternes online tilgængelige værktøjer.
    1. Designe hver fremadrettet primer ved at udvælge en 18-32 bp lang nukleotidsekvens, der er homolog med 5'-enden af ​​genet af interesse, herunder startkodonen. Design primere således at hver fremadrettet primer annealer 30-180 bp nedstrøms for den foregående, hvilket resulterer i deletionsmutanter mangler N-terminale peptidfragmenter af passende længder.
    2. Design en revers primer ved at udvælge en 18-32 bp lang nukleotidsekvens, der er homolog med 3'-enden af ​​genet af interesse, herunder stopkodonet. Kopier denne primer i enny tilgængelige bioinformatik program og konvertere sekvens i dens omvendte komplement. Dette er den reverse primer.
      1. I tilfælde af gener kodende periplasmatiske proteiner, designe den reverse primer, der er den omvendte komplement af 3'-enden af ​​en ledersekvens, der flankerer 5'-enden af ​​genet og er nødvendig for korrekt lokalisering af proteinproduktet i periplasmaet.
    3. Brug alle tilgængelige oligo-analysator program, kontrollere, at sletning primere har GC-indhold mellem 40-60%, lav hårnål smeltetemperatur (T m), lav selv- og hetero-dimerisering T m 's. Bestil primere til syntese og forsendelse fra enhver tilgængelig biotekselskab.
    4. Brug af pK184-genet konstruktion opnået i protokol 1.3 som skabelon og retningslinjerne i 1.2.7-1.2.8, PCR forstærke deletionskonstruktioner med primere designet i trin 1.4.1-1.4.3 at generere pK184-gen AX amplikoner . Store amplificeret DNA at -20 ° C.
    5. Ligere det amplificerede konstrukt anvendelse af enhver tilgængelig mutagenese kit (Materialer tabel).
    6. Transform hver af pK184-gen AX ligerer separat i kemisk kompetente DH5a-celler ved anvendelse af en standard varmechok protokollen (se 1.3.11-1.3.13).
    7. Alikvot et volumen prøve fra hver ligeringsreaktion i 1.4.12 100 pi på en agarplade indeholdende 50 ug / ml Km og sprede cellerne under anvendelse af en steril spreder. Hold området sterile og arbejde i nærheden af ​​en flamme. Inkubér pladen på hovedet ved 37 ° C natten over.
    8. Ved hjælp af en steril pipette eller loop, høste en enkelt særskilt koloni af celler og pode en 20 ml sterilt LB medier med 50 ug / ml Km. Hold området sterile og arbejde i nærheden af ​​en flamme. Grow cellerne O / N ved 37 ° C under omrystning ved 200 rpm.
    9. Gør 3-5 glycerol lagre af de transformerede DH5a celler ved at blande 500 pi af O / N-kulturen med 500 pi steril 100% glycerol (fginal 50% v / v) i sterile cryo-rør. Opbevar ved -80 ° C.
    10. Centrifuge 6-8 ml af O / N-kulturen ved stuetemperatur, 5.000 xg i 3 min. Dekanteres og udtrække pK184 gen AX plasmid konstruere fra pillen ved hjælp af et plasmid mini-prep-kit (Materialer Table) og producentens protokol. Store DNA ved -20 ° C.
  • 2. Frembringelse af pOX38-Tc Δgene :: Cm Stammer

    1. DY330R pOX38-Tc Δgene :: Cm knockouts
      1. Forbered en O / N kultur af DY330R pOX38-Tc celler i 10 ml sterilt LB indeholdende 10 ug / ml Tc. Grow kultur O / N ved 32 ° C og 200 rpm.
      2. Lav en 1:70 fortynding af O / N-kulturen i 20 ml frisk steril LB. Grow cellerne ved 32 ° C indtil midten af log-fase (OD 600 nm 0,4-0,6) vækst.
      3. Overførsel 10 ml kultur til en steril kolbe og inkuberes ved 42 ° C i 15 minutter ved 150 rpm i en rystende vand bath. Dette vil inducere ekspressionen af ​​rekombinations specifikke proteiner i DY330R.
      4. Chill kulturen i et is-vandbad i 10 min. Forbered elektrokompetente celler som følger.
        1. Overfør kølede celler i nedkølede koniske rør og centrifugeres ved 4000 xg i 7 minutter ved 4 * C. Alle rør og pipetter, der skal anvendes i de kommende trin bør placeres ved 4 ° C eller på is til afkøling.
        2. Fjern supernatanten og resuspenderes forsigtigt cellerne i 1 ml iskold Hedeselskabet 2 O. Tilføj en 30 ml iskold Hedeselskabet 2 O.
        3. Centrifuger cellerne (4000 xg 7 min, 4 ° C), kassere supernatanten og forsigtigt resuspenderes cellerne i 1 ml iskold Hedeselskabet 2 O.
        4. Overfør de resuspenderede celler i nedkølede 1,5 ml mikrocentrifugerør og centrifugeres ved 15.000 xg i 1 minut ved 4 * C.
        5. Resuspenderes forsigtigt pellet i 200 pi iskold Hedeselskabet 2 O og alikvot i 50 ul mængder. Electrocompetent celler kan opbevares ved -80 ° C
      5. Tilsættes 300 ng af det amplificerede CAT-kassetten fra 1,2 til 50 pi elektrokompetente DY330R pOX38-TC celler under blanding på is, forsigtigt ved pipettering op og ned. Gentag dette trin ved hjælp af umodificeret pBAD33 plasmid som en positiv kontrol.
      6. Overfør cellerne til en forafkølet (-20 ° C) 1 mm elektroporation cuvette. Elektroporere cellerne ved 1,8 kV med en tidskonstant på 5,5 ms, ved anvendelse af en elektroporator. Umiddelbart efter påføring af puls, fortyndes cellerne med 1 ml SOC medium og overføres til en frisk mikrofugerør. Inkuber cellerne ved 32 ° C i 2 timer.
      7. Alikvot 100 pi af hver prøve på agarplader indeholdende 10 ug / ml Tc og 20 ug / ml Cm og spredt med en steril spreder. Hold området sterile og arbejde i nærheden af ​​en flamme. Inkubér pladen på hovedet ved 32 ° C natten over for at selektere for de vellykkede rekombinanter. CAT-kassetten indføres i cellen vil undergå homolog rekombination med genet af interesse og skabe DY330R pOX38-Tc Δgene :: Cm (Rif R, Tc R, Cm R) klon.
        Bemærk: Det er vigtigt at vokse DY330R celler ved 32 ° C, med undtagelse af 15 min induktion ved 42 ° C i trin 2.1.3 før generering elektrokompetente celler, da langvarig vækst ved forhøjede temperaturer risikerer celledød på grund af produktionen af giftige produkter fra p L operon ansvarlig for rekombination funktioner i DY330R. 33,34
      8. Forbered en O / N for DY330R pOX38-Tc Δgene :: Cm celler ved høst en enkelt særskilt koloni af celler med en steril pipette eller loop, og pode en 20 ml steril LB medier med 10 ug / ml Tc, og 20 mikrogram / ml cm. Hold området sterile og arbejde i nærheden af ​​en flamme. Grow cellerne O / N ved 32 ° C under omrystning ved 200 rpm.
      9. Gør 3-5 glycerolstammer fra O / N ved at blande 500 pi af O / N-kulturen med 500 pi steril 100% glycerol (endelig 50% v / v) i sterile cryo-rør. Opbevar ved -80 ° C.
      10. Centrifuge 6-8 ml af O / N-kulturen ved stuetemperatur, 5.000 xg i 3 min. Dekanteres og udtrække pOX38-Tc Δgene :: Cm konstruere fra pillen ved hjælp af et plasmid mini-prep-kit (Materialer Table) og producentens protokol; gemme oprenset DNA ved -20 ° C.
      11. Udfør en konjugerende parring under anvendelse XK1200 celler som modtageren for at bekræfte afbrydelse af konjugation af gen-knockout som pr protokol 3.1.
    2. DY330R pOX38-Tc Δgene :: Cm + pK184-genet
      1. Omdan elektrokompetente DY330R pOX38-Tc Δgene :: Cm celler med 300 ng af pK184-genet konstruktion via elektroporation som pr trin 2.1.4-2.1.7. Alle selektive medier skal indeholde 20 ug / ml Cm og 50 ug / ml Km. Inkuber ved 32 ° C. Udvindingen plasmid i de elektroporerede celler vil nu genoprette funktionen af ​​slået ud genet i DY330R pOX38-Tc Δgene :: Cm celler.
      2. Forbered en O / N for DY330R pOX38-Tc Δgene :: Cm + pK184-gen rekombinante celler ved høst en enkelt særskilt koloni af cellerne med en steril pipette eller loop, og pode en 20 ml steril LB medier med 20 mikrogram / ml Cm og 50 ug / ml Km. Hold området sterile og arbejde i nærheden af ​​en flamme. Grow cellerne O / N ved 32 ° C under omrystning ved 200 rpm.
      3. Gør 3-5 glycerolstammer fra O / N ved at blande 500 pi af O / N-kulturen med 500 pi steril 100% glycerol (endelig 50% v / v) i sterile cryo-rør. Opbevar ved -80 ° C.
      4. Også udføre protokol 3.1 til at generere XK1200 pOX38-Tc Δgene :: Cm rekombinante celler.
    3. XK1200 pOX38-Tc Δgene :: Cm + pK184-genet og mutanter
      1. Forbered elektrokompetent XK1200 pOX38-Tc Δgene :: Cm celler (fra trin 2.2.4).
      2. Separat elektroporere 300 ng pK184-gen eller pK184-genmutant plasmider i 50 pi electrocompetent XK1200 pOX38-Tc Δgene :: Cm celler som pr trin 2.1.4-2.1.7. Alle selektive medier bør indeholde 10 ug / ml nalidixinsyre (Nal), 20 ug / ml Cm og 50 ug / ml Km, og inkuberes ved 37 ° C.
      3. Forbered en O / N for XK1200 pOX38-Tc Δgene :: Cm + pK184-gen rekombinante celler ved høst en enkelt særskilt koloni af cellerne med en steril pipette eller loop, og pode en 20 ml steril LB medier med Nal, 20 mikrogram / ml cm og 50 ug / ml Km. Hold området sterile og arbejde i nærheden af ​​en flamme. Grow cellerne O / N ved 37 ° C under omrystning ved 200 rpm.
      4. Gør 3-5 glycerolstammer fra O / N ved at blande 500 pi af O / N-kulturen med 500 pi steril 100% glycerol (endelig 50% v / v) i sterile cryo-rør. Opbevar ved -80 ° C.

    3. konjugering Mating Analyser

    1. Konjugering Parringen at generere XK1200 pOX38-Tc Δgene :: Cm Cells
      1. Forbered en 20 ml sterilt LB O / N culstilling af DY330R pOX38-Tc Δgene :: Cm + pK184-gen-celler ved anvendelse af en steril pipette eller loop at pode en 20 ml steril LB indeholdende 20 ug / ml Cm og 50 ug / ml Km med en glycerolstamopløsning eller enkelt koloni på en agarplade. Vokse ved 32 ° C under omrystning ved 200 rpm. Forbered samme for XK1200 celler i 20 ml sterilt LB med 10 ug / ml Nal, vokser ved 37 ° C.
      2. Gør 1:70 fortyndinger af hver kultur adskilt i 2 ml sterilt LB med samme antibiotiske indhold; tilføje glucose til en endelig koncentration på 100 mM til alle donorceller. Grow celler til midten log fase (OD600 0,5-0,7) ved 37 ° C under omrystning ved 200 rpm.
      3. Centrifuge (4.000 xg i 5 min ved 4 ° C) for at pelletere cellerne, skille supernatanten, vaske gang med kold steril LB at fjerne antibiotika og resuspender cellerne i 2 ml koldt sterilt LB.
      4. Alikvot 100 pi af hver kultur i 800 pi sterile LB medier og tillade dem at parre ved 32 ° C i 1 time uden rystning.
      5. <li> Vortex cellerne i 30 s for at forstyrre de samvirkende par og placerer dem på is i 10 minutter for at forhindre yderligere parring.
      6. Alikvot 100 pi af cellen blandingen på en agarplade indeholdende 10 ug / ml Nal og 20 ug / ml Cm at selektere for XK1200 pOX38-Tc Δgene :: Cm-celler. Spred cellerne under anvendelse af en steril spreder. Hold området sterile og arbejde i nærheden af ​​en flamme. Inkuberet pladen O / N ved 37 ° C på hovedet.
      7. Harvest en enkelt koloni af den nye XK1200 pOX38-Tc Δ gen :: Cm knockout-stamme under anvendelse af en steril pipette eller loop og vokse i sterilt LB med 20 ug / ml Cm, O / N ved 37 ° C under omrystning ved 200 rpm. Gør 3-5 glycerolstammer fra O / N ved at blande 500 pi af O / N-kulturen med 500 pi steril 100% glycerol (endelig 50% v / v) i sterile cryo-rør. Opbevar ved -80 ° C.
        Bemærk: De resulterende celler er nu i stand til at blive gjort kompetente til transformation med pK184-genkonstruktioner (protokoller 1.3 og 1.4) for røvEssing genet og dets mutanter på evnen til at inddrive konjugative transfer i protokol 3.2.
    2. Konjugering Parringen Assay fra XK1200 donorer til MC4100 Modtagere
      1. Forbered en O / N kultur af XK1200 pOX38-Tc Δgene :: Cm + pK184-gen celler i 20 ml sterilt LB med 20 ug / ml Cm, 50 ug / ml Km og MC4100 celler i 5 ml LB med 50 ug / ml streptomycin (SM) anvendelse af celler fra en glycerol-bestand eller enkelt koloni på en agarplade og sterilt pipette eller loop. Grow kulturer på 37 ° C med 200 rpm rystning.
      2. Gør 1:70 fortyndinger fra hver O / N-kulturen separat i 2 ml sterilt LB med de samme antibiotika. Tilføj glucose til en endelig koncentration på 100 mM til alle donorceller. Grow celler til midten log fase (OD600 0,5-0,7) ved 37 ° C under omrystning ved 200 rpm.
      3. Centrifuge (4.000 xg i 5 min ved 4 ° C) for at pelletere cellerne, skille supernatanten, vaske gang med kold steril LB at fjerne Antibiotics, og resuspender cellerne i 2 ml koldt sterilt LB.
      4. I to eksemplarer alikvot 100 pL af hver kultur i 800 pi sterile LB medier og tillade dem at parre ved 37 ° C i 1 time uden omrystning.
      5. Vortex cellerne i 30 s for at forstyrre de samvirkende par og placere dem på is i 10 min for at forhindre yderligere parring.
      6. Brug af mid-log kulturer fra trin 3.2.2 og frisk steril LB, forberede 6 serielle fortyndinger af donor- og modtagerlande celler fra 10 -2 til 10 -7.
      7. På hver af to halvdele af en agarplade indeholdende 10 ug / ml Nal, 20 ug / ml Cm og 50 ug / ml Km, Spot 10 pi prøver af hver fortynding af XK1200 donorceller, som vist i figur 2. Gentag for fortyndinger af modtagerens MC4100 celler på agarplader indeholdende 50 mg / ml Sm. Pladerne inkuberes O / N ved 37 ° C.
      8. Brug af hvirvelbehandlet blanding fra trin 3.2.5 og frisk sterilt LB, forberede 6 fortyndinger (10 -2 til 10 -7 figur 2. Gentag for begge dublerede blandinger. Hold området sterile og arbejde i nærheden af ​​en flamme. Pladerne inkuberes O / N ved 37 ° C.
      9. Bestem parring effektivitet hver konstruktion som beskrevet i protokol 3.3.
      10. Gentag denne protokol for alle nyttiggørelses- plasmider at vurdere effekten af ​​en bestemt mutation på effektiviteten af ​​konjugation.
    3. Beregning af Parring Effektivitet
      1. Tæl antallet af kolonier fra samme fortynding spotting for hver donor, modtager og transkonjugantkolonier celler på deres respektive plader.
      2. Tæl modtagerlandene kolonier at afprøve nogen skævhed, der ville følge af at have et større antal transkonjuganter end modtagere på det given fortynding.
      3. Calculate parringen effektivitet som antallet af transkonjugantkolonier kolonier divideret med antallet af donor kolonier. Gang med 100 for at opnå effektivitet værdi pr 100 donorceller.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Processen med F-plasmid-drevet konjugation er en koordineret proces, der involverer overførsel proteiner i tra region af F-plasmid, der samler en T4SS at lette pilus syntese og konjugative DNA-overførsel. Proteinet Traf (GenBank # BAA97961; UniProt ID P14497) er påkrævet for konjugativ F-pilus formation. 10,14,35 - 37 Proteinet indeholder en C-terminal thioredoxin-lignende domæne, selvom det ikke har den katalytiske CXXC motiv. 35,38 Skønt det er blevet forudsagt at interagere med Trah proteinet gennem dets N-terminale domæne, 39 a region vist sig at være mere dynamisk end dets C-terminale domæne, 37 ikke meget andet er kendt om proteinets strukturelle træk. For at vurdere de funktionelle aspekter af TRAF-proteinet sammen med strukturelle studier, vi først slået ud TRAF-genet på pOX38-Tc via homologrekombination, genererer pOX38-Tc ΔtraF :: Cm plasmid (tabel 1) i E. coli DY330R celler. 33,34 Også genereret var pK184-TRAF plasmid fra TRAF -specifikke primere (tabel 2) for at tilvejebringe genvinding af konjugation og muliggøre sondering proteinets sekvens. Overførslen af pOX38-Tc ΔtraF :: Cm plasmidet i XK1200 celler 40 fra DY330R celler, når pK184-Traf blev tilvejebragt i trans (transkonjuganter dyrket på 10 ug / ml Nal, 10 ug / ml Tc og 20 mikrogram / ml Cm) angiver at (a) den TRAF knockout i pOx38-Tc ΔtraF :: Cm giver en i-ramme CAT-kassetten, og (b) at pK184-TRAF kan gendanne konjugerende funktion.

    En serie af Traf mutanter blev genereret til analyse ved hjælp af konjugative parring assay 37 hjælp XK1200 pOX38-Tc ΔtraF :: Cm + pK184-Traf AXceller og MC4100 celler 41 som donorer og modtagere henholdsvis. En repræsentant mutant er TRAF 55-247 (tabel 1), en N-terminal deletion mutant, der fjerner område af proteinet forudsagt at interagere med Trah. Når fuldlængde TRAF-proteinet tilvejebringes til donorcellerne, er konjugative overførsel genoprettet (figur 2), samtidig med at de tomme plasmid pK184 ikke (tabel 3). Tilsvarende er konjugerende funktion i XK1200 donorceller ikke gendannet, når forsynet med plasmid pK184-TRAF 55-247 (tabel 3). Dette indikerer, at den trunkerede område af proteinet er vigtigt for TRAF funktion inden for den konjugative apparat, sandsynligvis gennem interaktion med Trah, og tilvejebringer et område af proteinet til at målrette til yderligere mutationsanalyse.

    figur 1
    i trans via et opsving plasmid (pK184-genet). Den resulterende pOX38-Tc Δgene :: Cm plasmid overføres til en XK1200 stamme (trin 2) for yderligere vurdering af genet ved hjælp af parring analyser med en MC4100 modtager (trin 3). Klik her for at se en større version af dette tal.

    Figur 2
    Figur 2: Mating assay til at vurdere målgenet funktion i konjugation. Donor og recipient celler var E. coli XK1200 pOX38-Tc ΔtraF :: Cm transformeret med pK184-Traf og MC4100 hhv. De resulterende transkonjuganter (MC4100 pOX38-Tc ΔtraF :: Cm) vokser på plader indeholdende Sm og Cm, hvilket indikerer vellykket inddrivelse af konjugativ funktion. Forsøget udføres i to eksemplarer på en enkelt agarplade, og seriefortyndinger anvendes med henblik beregne parring effektivitet genoprettende gen mutanter (tabel 2). Klik her for at se en større version af dette tal.

    Bakteriestamme / Plasmid relevante egenskaber Selektiv Marker (s) Reference
    bakteriestammer
    DY330R W3110 ΔlacU169 gal490 λc1857 Δ (cro-bioA) Rif R Rif 33,34
    XK1200 F - lacΔU124 Δ (Nada aroG gal attλ bio gyrA) Nal 40
    MC4100 araD139 Δ (argF- lac) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR sm 41
    Vektorer og konstruktioner
    pBAD33 Plasmid til ekspression under fra P araBAD cm 32
    pK184 2,4 kb kloningsvektor, p15A-replikon Km 31
    pK184-Traf </ Td> F Traf fra pOX38 i pK184 Km 35
    pK184-Traf 56-247 F Traf aa 56-247 fra pK184-Traf Km
    konjugering plasmider
    pOX38-Tc IncFI, Tra +, RepFIA +, f1 HindIII fragment af F, mini-Tn Tc 29,30
    pOX38-Tc ΔtraF :: Cm pOX38-Tc med CAT indsat i Traf Tc Cm 35
    † Cm, chloramphenicol; Km, kanamycin; Nal, nalidixinsyre; Rif, rifampicin; Sm, streptomycin; Tc, tetracyclin
    ‡ Alle Traf konstrukter indeholder den 19-rest ledersekvens at sikre lokalisering til det periplasmatiske rum.

    Tabel 1: coli-stammer og plasmider anvendt i denne undersøgelse.

    Konstruere Primer *
    Traf-Cm-For 5'GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC -3 '
    TRAF-Cm-Rev 5'TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG -3 '
    pK184-Traf-For 5'TTTTTT GAATTC TATGAATAAAGCATTACTGCCAC -3 '
    pK184-Traf-Rev 5'TTTTTT AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA -3 '
    pK184-Traf 55-247 -For 5'TACG CATATG ATGGCCGCACTGCAGACGG -3 '
    pK184-Traf 55-247 5'TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA -3 '
    † Tabel tilpasset fra Lento et al. 2016 35 med tilladelse
    * Traf overhængende regioner er kursiveret. Restriktionsenzymsteder er understreget (HindIII: AAGCTT, EcoRI: GAATTC, NdeI: CATATG)

    Tabel 2: En liste over primere anvendt i denne undersøgelse.

    Donorplasmid † Recovery Plasmid Transkonjuganter ‡ § (celler ml-1) Parring Efficiency§ ||
    pOX38-Tc ΔtraF :: Cm Ingen 0 0
    pOX38-Tc ΔtraF :: Cm pK184 0 0
    pOX38-Tc ΔtraF :: Cm pK184-Traf 5 x 10 3 0,0167
    pOX38-Tc ΔtraF :: Cm pK184-Traf 55-247 0 0
    * Tabel tilpasset fra Lento et al. 2016 35 med tilladelse
    † Donorceller var E. coli XK1200, med en gennemsnitlig koncentration på 3 x 10 7 celler ml-1
    ‡ Recipientceller var E. coli MC4100. Antallet af transkonjuganter for den positive kontrol er fra en 10-5 fortynding. 0 angiver ingen transkonjuganter fra en 10-2 fortynding.
    §An gennemsnit på to til fire parring blev udført for hver konstruktion.
    || Parringen effektivitet er defined som transkonjuganter pr 100 donorceller. 0 parring effektivitet angiver ingen transkonjuganter fra en 10-2 fortynding

    Tabel 3: Abolished parring effektivitet ved TRAF deletionskonstruktioner.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    Konjugation fremgangsmåde tilvejebringer et middel, hvormed bakterier kan sprede gener tilvejebringe en evolutionær fordel for vækst i udfordrende miljøer, såsom spredning af antibiotikaresistensmarkører. Fordi mange af de konjugering plasmider er så store, 12 funktionelle undersøgelser af involveret i montering af overførsel apparatet gennem mutation af målgener på selve konjugative plasmid proteiner er uhåndterlig. Protokollerne beskrevet heri tilvejebringer et middel, hvormed man kan lettere vurdere target genet af interesse ved anvendelse af mindre, mere håndterbare ekspressionsplasmider (figur 1). Vi anvender F-plasmid-derivat pOX38-Tc (tabel 1) for at studere F plasmid-medieret konjugering; andre konjugering plasmider kan studeres ved hjælp af de protokoller, der er beskrevet her, og passende afledte plasmider. Parringen analyser skitseret er blevet tilpasset fra Frost og kolleger, 42 med nogle modifications. I tidligere undersøgelser, blev 8,33,42 oprettelsen af pOX38-Tc Δgene :: Cm konstruktion opnås ved at spalte genet af interesse med de passende restriktionsenzymer og indsætte det forstærkede CAT kassetten i pOX38-Tc. 42 I den nuværende metode, vi anvender homolog rekombination i recombineering E. coli stamme DY330R 33,34 til knockout målgenet og erstatte det med CAT kassette. Dette har en fordel, at den resulterende DY330R stamme, som huser den pOX38-Tc Δgene :: Cm konstruere til at fungere som en kontrol for det gen-specifikke knockout out F-T4SS medieret konjugative overførsel via inddrivelse af overførslen ved hjælp af pK184-genet opsving plasmid . Mens det kan være muligt at generere knockouts bruger skarpere-Cas9 metodologi, 43 har vi ikke på nuværende tidspunkt undersøgt denne mulighed.

    Processen begynder med frembringelsen af et gen knockout i F-derivat plasmid pOX38-Tc (Figure 1). Dette opnås via homolog rekombination i DY330R celler (tabel 1), kan andre stammer med lignende funktioner som DY329, DY331 og DY378 også anvendes. Primere oprindeligt designet til PCR amplifikation af CAT-kassetten fra pBAD33 plasmidet 32 og indeholder overhængende baser, der er specifikke for målgenet (tabel 2); PCR-produktet dernæst elektroporeret ind DY330R celler, der huser pOX38-Tc. Homolog rekombination genererer knock-out plasmid pOX38-Tc Δgene :: Cm hvor indsættes CAT kassette i-frame i målgenet, effektivt forstyrre T4SS samling og konjugation samtidig give Cm modstand. Samtidig er målgenet PCR amplificeret fra pOX38-Tc og indsættes i en lille ekspressionsplasmid; i denne protokol anvender vi pK184 til konstitutiv ekspression, men man kunne valgte et plasmid med inducerbar ekspression af målgenet, hvis det ønskes. Den pK184-genet plasmid transformeres derefteri DY330R pOX38-Tc Δgene :: Cm celler, og disse celler anvendes derefter som donorer til at overføre pOX38-Tc Δgene :: Cm konstruere via konjugering i XK1200 celler til parring analyser. I parring analyser, donor- og modtagerlande celler er XK1200 pOX38-Tc Δgene :: Cm og MC4100 hhv. Den pK184-genet recovery plasmid, samt serie mutanter af målgenet (deletioner eller punktmutationer), tilvejebringes til donorcellerne at vurdere deres evne til at genoprette parring, og bestemme dens effektivitet, med MC4100 recipientceller (figur 2 ; tabel 3).

    Kritisk for proceduren er anvendelsen af passende donor og modtager stammer (tabel 1), og udformningen af de anvendte primere. For hver primer designet, der er generelle retningslinjer, der bør følges. Mens vi strengt forsøger at overholde med 40-60% GC-indhold, kan dette ikke altid muligt. I sådanne tilfælde er det forsøgslederen skøn at teste en primer wi'te GC-indhold lidt under eller over dette interval. Smeltetemperaturen (T m) af fremadrettet og revers primer skal være ens, og annealing temperatur (T a) værdien bør altid være lavere end T m ved 2-5 ° C til PCR. Den frie energi til rådighed til at tillade en hårnål til at udvikle bør være meget lavere end T a, mens den homo- og hetero- dimerisering Tm 's skal være meget lav (mindre end -10 kJ og 30 ° C). Primere kan designes til at probe deletioner, insertioner eller punktmutationer som ønsket. Det er naturligvis vigtigt, at den resulterende genkonstruktion amplificeres og ligeret ind i recovery plasmidet i ramme, således at det er korrekt udtrykkes. Transformation af kompetente celler kan ske via elektroporering eller varmechok under anvendelse elektrokompetente eller kemisk kompetente celler. Vi finder, at elektroporering er mere effektiv for større konstruktioner såsom pOX38-Tc og den homologe rekombination oligonucleotide, mens de mindre ekspressionsplasmider såsom pK184-TRAF kan let omdannes til celler under anvendelse af varmeshock-metoder. Endelig er det vigtigt at huske, at der vil være flere antibiotika i brug i hele protokollen, som både donor- og modtagerlande stammer kræver forskellige modstande, som er forskellige fra dem, der anvendes på konjugering og nyttiggørelse plasmider.

    Bortset fra de tilsvarende assays teknikker beskrevet her, er der andre metoder, der anvendes til at studere konjugation, varierende smule i deres tilgang. Horisontal genoverførsel er en proces, hvor bakterier overføre et plasmid til en modtager celle, herunder interspecies modtagere. 44 En undersøgelse af Dahlberg og kolleger 44 for eksempel bruges konjugation at bestemme omfanget af arterne horisontal genoverførsel. De udnyttede inkorporeringen af ​​grønt fluorescerende protein (GFP) i et plasmid klonet ind KT2442 celler; det kromosomale lac I q-gen i KT2442 celler undertrykke GFP-ekspression. Når plasmidet bærer GFP overføres til en art uden lac I q-gen, observeres fluorescens. 44 Trods sin begrænsning at tilvejebringe protein bestemt funktion i forskellige arter, kunne interspecies konjugation forsøget eventuelt kobles med de protokoller, der præsenteres her for at gøre evolutionære forudsigelser for protein-protein interaktioner mellem forskellige arter.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Forfatterne erklærer, at de ikke har nogen konkurrerende finansielle interesser.

    Acknowledgments

    Denne forskning blev understøttet af en Discovery Grant fra Natural Sciences & Engineering Council of Canada (NSERC).

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics