جيل من التكامل خالية من الخلايا الجذعية المستحثة متعددة القدرات من الخلايا الطرفية الإنسان الدم وحيدات النوى عن طريق Episomal المتجهات

JoVE Journal
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

الناجم عن الخلايا الجذعية المحفزة (iPSCs) على وعود كبيرة للنمذجة المرض وعلاجات التجدد. ذكرنا فيما سبق استخدام Episomal المتجهات (EV) لتوليد iPSCs خالية من التكامل من الخلايا وحيدة النواة الدموية المحيطية (PB الشركات المتعددة الجنسيات). ناقلات episomal المستخدمة هي البلازميدات الحمض النووي تدمج مع oriP وEBNA1 عناصر من فيروس ابشتاين بار (EB)، والتي تسمح للنسخ المتماثل وطويلة الأجل احتفاظه من البلازميدات في خلايا الثدييات، على التوالي. مع مزيد من التحسين، ويمكن الحصول على الآلاف من المستعمرات IPSC من 1 مل من الدم المحيطي. اثنين من العوامل الحاسمة لتحقيق كفاءة عالية برمجة هي: 1) استخدام 2A "انشقاق عن النفس" الببتيد لربط OCT4 وSOX2، وبالتالي تحقيق التعبير متساوي المولية للعاملين. 2) استخدام متجهين للتعبير عن MYC وKLF4 بشكل فردي. نحن هنا وصف بروتوكول خطوة بخطوة لتوليد خالية من التكامل الملكية الفكريةالمنبوذة من عينات الدم المحيطي الكبار. وiPSCs ولدت خالية من التكامل كما البلازميدات episomal المتبقية لا يمكن اكتشافها بعد خمسة مقاطع. وعلى الرغم من كفاءة إعادة برمجة هي مماثلة لتلك التي من سينداي فيروس (SV) ناقلات، البلازميدات EV هي إلى حد كبير أكثر اقتصادا من ناقلات SV المتاحة تجاريا. يحمل هذا النظام EV إعادة برمجة بأسعار معقولة المحتملين للتطبيقات السريرية في الطب التجديدي، ويقدم نهجا لإعادة برمجة مباشرة من الشركات المتعددة الجنسيات PB إلى الخلايا خالية من التكامل الجذعية الوسيطة، والخلايا الجذعية العصبية، وما إلى ذلك.

Introduction

بعد التعبير القسري لعدة عوامل النسخ (أي OCT4، SOX2، MYC وKLF4)، الخلايا الجسدية يمكن برمجتها لالناجم عن الخلايا الجذعية المحفزة (iPSCs)، الذي عقد الوعد العظيم للتطبيقات في الطب التجديدي وخلية العلاج ببدائل 1-3. حتى الآن، وقد وضعت أساليب متنوعة لزيادة نسبة نجاح إعادة برمجة 4-7. يستخدم ناقلات فيروسية يسببها إعادة البرمجة على نطاق واسع لتوليد كفاءة iPSCs، لأن التكامل الفيروسي يؤدي إلى مستوى عال والتعبير مستقر من العوامل برمجة. ومع ذلك، والتكامل الدائمين في الحمض النووي ناقلات في جينوم الخلية قد تحفز الطفرات إقحامي 5. وبالإضافة إلى ذلك، تعطيل كافية من عوامل إعادة برمجة قد تزعج iPSCs التمايز 8. على هذا النحو، واستخدام iPSCs دون إدماج العوامل برمجة أمر لا بد منه، وخاصة للاستخدام في التطبيقات العلاج بالخلايا.

> Episomal المتجهات (المركبات الكهربائية) وتستخدم على نطاق واسع في توليد iPSCs خالية من التكامل. وEV الأكثر شيوعا هو البلازميد التي تحتوي على عنصرين أو الأصل من تكاثر الفيروس (oriP) وEB النووية مستضد 1 (EBNA1)، من فيروس ابشتاين بار (EB) 9. العنصر oriP يعزز تكرار البلازميد في خلايا الثدييات، بينما العنصر EBNA1 الحبال البلازميد الحمض النووي التي تحتوي على oriP على الحمض النووي الكروموسومات التي تسمح للتقسيم ويصبوغ أثناء انقسام الخلية المضيفة. بالمقارنة بنهج خالية من التكامل الأخرى، بما في ذلك سينداي فيروس (SV) وترنسفكأيشن الحمض النووي الريبي، المركبات الكهربائية تمتلك مزايا متعددة 5،6،10. كما DNA البلازميد، المركبات الكهربائية يمكن أن تنتج بسهولة وتعديلها في المنزل، مما يجعلها بأسعار معقولة للغاية. وبالإضافة إلى ذلك، إعادة برمجة مع EV هي عملية أقل كثيفة العمالة منذ ترنسفكأيشن واحد مع المركبات الكهربائية غير كافية لتوليد التوجيهية، في حين ضرورية لإعادة البرمجة ناجحة عدة تعداء الحمض النووي الريبي.

دوقد استخدمت الخلايا الليفية ermal في العديد من الدراسات برمجة. ومع ذلك، خزعة الجلد ليست فقط عملية الغازية ومؤلمة، ولكن أيضا وقتا طويلا لتوسيع الخلايا على كميات كافية لإعادة البرمجة. من قلق أكبر، وغالبا ما تتعرض خلايا الجلد من المانحين الكبار للإشعاع الأشعة فوق البنفسجية طويلة الأجل، مما قد يؤدي إلى حدوث طفرات المرتبطة الأورام، مما يحد من طلبات iPSCs المستمدة من الخلايا الليفية الجلد 11،12. مؤخرا، تم الإبلاغ عن أن خلايا الجلد البشري العادية تتراكم الطفرات الجسدية وجينات السرطان متعددة، بما في ذلك أكثر من الدوافع الرئيسية لالجلدية سرطان الخلايا الحرشفية، تحت اختيار إيجابية قوية (13).

وعلى النقيض من الخلايا الليفية الجلد والدم المحيطي (PB) الخلايا هي مصدر الأفضل الخلايا لإعادة برمجتها ل1) خلايا الدم يمكن الحصول عليها بسهولة من خلال عملية التنظيرية، 2) خلايا الدم الطرفية هي سلالة من الخلايا الجذعية المكونة للدمالمقيمين في نخاع العظام، وبالتالي حمايتها من الأشعة الضارة. الطرفية خلايا الدم وحيدات النوى (PB الشركات المتعددة الجنسيات) يمكن جمعها في ساعة واحدة من طبقة معطف الشهباء بعد الطرد المركزي التدرج بسيط باستخدام Ficoll-Hypaque (1.077 غرام / مليلتر). وتتكون الشركات المتعددة الجنسيات PB التي تم الحصول عليها من اللمفاويات، وحيدات وعدد قليل من الخلايا المكونة للدم السلف (HPCS) 14. على الرغم من أن الخلايا اللمفية تي الإنسان هي واحدة من أنواع الخلايا الرئيسية في الجريدة الرسمية، ناضجة تحتوي على خلايا T إعادة ترتيب الخلية مستقبلات T (TCR) الجينات وتفتقر إلى الجينوم سليمة مما يحد من قدرتها على التطبيقات 15،16. ومع ذلك، قد يكون تجديد خلايا T عبر الجيل IPSC التطبيقات المحتملة في همي مستضد مستقبلات (CAR) علاج خلايا T 17-19. في المقابل، HPCS لها الجينوم سليمة وغير قابل للبرمجة بسهولة. على الرغم من أن فقط 0،01-،1٪ الخلايا في الدورة الدموية الطرفية هي HPCS، وهذه الخلايا يمكن توسيع فيفو السابقين في المتوسط محمر التي تفضل انتشار erythrالخلايا الاولية إمكانية احتواء 14.

في دراستنا السابقة، استخدمنا عامل بي سي إل-XL بالإضافة إلى العوامل ياماناكا (OCT4، SOX2، MYC وKLF4)، مما أدى إلى زيادة 10X في الجريدة الرسمية برمجة الكفاءه 20. بي سي إل-XL، المعروف أيضا باسم BCL2L1، هو المانع من امكانات موت الخلايا، عن طريق تثبيط تفعيل caspases 21،22. ولكن، بي سي إل-XL قد تلعب أيضا دورا هاما في الحفاظ على تعدد القدرات 21،22. في الآونة الأخيرة، لدينا المزيد الأمثل لدينا نظام EV إعادة برمجة بالإعراب بشكل منفصل MYC وKLF4 مع متجهين، الأمر الذي يؤدي إلى زيادة 100X تقريبا في كفاءة إعادة برمجة 23. باستخدام هذا الأسلوب، وكفاءة برمجة، يحددها عدد مستعمرة مقسوما بدءا عدد الخلايا في ترنسفكأيشن، هو 0،2-0،5٪ من المتبرعين الأصحاء. على النحو التالي، ونحن تصف الإجراء التجريبي التفصيلي لتوليد iPSCs خالية من التكامل من الجريدة الرسمية.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

تم الحصول على جميع عينات PB الإنسان من المانحين الكبار مجهولة من دون تحديد المعلومات المتاحة من مركز الدم تيانجين مع موافقة لجنة أخلاقيات البحوث المحلية.

إعداد البلازميد 1. إندو خالية

  1. استخدام البلازميد تنقية ماكسي كيت التجارية لاستخراج ناقلات episomal من كولاي وفقا لبروتوكول الشركة المصنعة. للخطوة النهائية العازلة TE البديل مع الماء المعقم الخالي من الذيفان الداخلي بحل بيليه الحمض النووي.
  2. قياس تركيز الحمض النووي باستخدام تجاري للأشعة فوق البنفسجية / فيس معمل. تركيز عادة ما يكون أكبر من 1 ميكروغرام / ميكرولتر، مع A260 / A280 و A260 نسب / A230 أكبر من 1.8 و 2.0 على التوالي.

2. وسائل الإعلام الثقافة

  1. إعداد المتوسطة محمر: الجذعية المكونة للدم التوسع خلية متوسطة تستكمل مع 100 نانوغرام / مل الجذعية البشرية خلية عامل (SCF)، و 10 نانوغرام / مل انترلوكين 3 (IL3)، 2 U / مل إريثروبويتين (Eعامل 1 ف ب)، 20 نانوغرام / مل النمو الأنسولين (IGF1)، 1 ميكرومتر ديكساميثازون و 0.2 ملم 1-thioglycerol. تصفية تعقيم مع فلتر حقنة 0.22 ميكرون. ويمكن تخزين المتوسطة محمر عند 4 درجة مئوية لمدة تصل إلى شهر واحد.
  2. إعداد IPSC المتوسطة: المتوسطة DMEM / F12 (Dulbecco لتعديل النسر متوسطة / المغذيات خليط F-12) تستكمل مع 1X L-الجلوتامين، 1X البنسلين / الستربتومايسين، 1X غير الضرورية الأحماض الأمينية الحل، 50 نانوغرام / مل الخلايا الليفية عامل النمو 2 (FGF2 )، ملحق 1X الانسولين ترانسفيرين-السيلينايت (ITS)، و 50 ملغ / مل حامض الاسكوربيك. تصفية تعقيم مع فلتر حقنة 0.22 ميكرون. ويمكن تخزين IPSC المتوسطة في 4 درجة مئوية لمدة تصل إلى شهر واحد.
  3. إعداد MEF المتوسطة: Dulbecco لتعديل النسر متوسطة (DMEM؛ ارتفاع نسبة الجلوكوز) تستكمل مع 1X البنسلين / الستربتومايسين و 10٪ مصل بقري جنيني (FBS). تصفية تعقيم مع فلتر حقنة 0.22 ميكرون. متوسطة MEF يمكن تخزينها في 4 درجة مئوية لمدة شهر واحد أو حديثا إضافة 1X L-الجلوتامين قبل الاستخدام.
  4. Prepare IPSC متوسطة الحفظ بالتبريد (2X): ذوب 5 غرام من مد طرهالوز في 30 مل من الماء المعقم في 37 ° C حمام الماء. تحقيق درجة الحرارة إلى 4 درجات مئوية ثم قم بإضافة 10 مل من FBS و 10 مل من ثنائي ميثيل سلفوكسيد (DMSO). تصفية تعقيم مع فلتر حقنة 0.22 ميكرون. تخزين عند 4 درجات مئوية لمدة تصل إلى 3 أشهر 24.

3. عزل خلايا الدم المحيطي وحيدة النواة (PB الشركات المتعددة الجنسيات)

  1. الجمع بين 10 مل عينة PB جديدة و 10 مل عازلة برنامج تلفزيوني في أنبوب 50 مل وتخلط جيدا. جلب برنامج تلفزيوني لRT أو 37 درجة مئوية قبل الاستخدام.
    ملاحظة: حوالي 1-3 × 10 6 شركات متعددة الجنسيات (الطازجة أو cryopreserved) يمكن الحصول عليها من 1 مل من PB. بعد 6 د للثقافة، ونتوقع أن يكون 0،5-1 × 10 6 مجموع الخلايا بسبب موت خلايا ناضجة خلال الثقافة. حوالي 1 × 10 7 خلايا يمكن الحصول عليها من 10 مل من PB جديدة.
  2. إضافة 10 مل Ficoll إلى أسفل الأنبوب باستخدام حقنة 10 مل تعلق على إبرة طويلة. هذا المواليةوينبغي أن يتم سيس ببطء للتأكد من أن طبقة Ficoll لا يمتزج مع PB.
  3. أجهزة الطرد المركزي في 400 x ج لمدة 30 دقيقة بمعدل تسارع وتباطؤ منخفضة. بعد الطرد المركزي، والشركات المتعددة الجنسيات PB هي في الطبقة البيضاء (الشهباء معطف) الواقعة بين البلازما PB وFicoll.
  4. ببطء نضح ~ 10 مل PB البلازما دون إزعاج طبقة معطف الشهباء. حصاد بعناية الطبقة البيضاء باستخدام ماصة 1 مل إلى 50 مل أنبوب جديد. فإن الحجم الكلي للخلايا التي تم جمعها من الطبقة البيضاء ما بين 3-6 مل.
  5. إضافة برنامج تلفزيوني لتبرزي حجم الإجمالي إلى 30 مل وتخلط جيدا مع ماصة 10 مل. أجهزة الطرد المركزي في 400 x ج لمدة 10 دقيقة.
  6. إزالة طاف و resuspend بيليه الخلية في 20 مل الثقافة المتوسطة (أي Iscove في التعديل المتوسطة Dulbecco و، IMDM) وتخلط جيدا. أجهزة الطرد المركزي في 400 x ج لمدة 10 دقيقة لإزالة الغالبية العظمى من الصفائح الدموية.
  7. إزالة طاف و resuspend بيليه خلية في 1 - 2 مل IMDM. ويمكن استخدام الخلايا وأو ثقافة فورية أو المجمدة إلى أسفل لاستخدامها لاحقا. لحفظ البرودة، إضافة مبلغ مساو من المتوسط ​​الحفظ بالتبريد. الخلايا قسامة في cryovials (0،5-1 مل في القارورة) وcryovials نقل إلى -80 درجة مئوية الثلاجة فورا. قد يتم تخزين الشركات المتعددة الجنسيات PB في الفريزر -80 درجة مئوية لعدة أسابيع أو نقلها إلى خزان النيتروجين السائل لتخزين على المدى الطويل.
    ملاحظة: عند ذوبان الخلايا المجمدة، وعلى الرغم من موقعنا متوسطة الحفظ بالتبريد قد تحافظ على بقاء الخلية، قد يقلل من عدد الخلايا بسبب موت الخلايا أثناء عملية الذوبان. فمن المستحسن أن 1-10 × 10 7 خلايا ستجمد في كل قارورة.

4. التوسع في الشركات المتعددة الجنسيات PB في محمر المتوسطة

  1. إعداد 5 مل المتوسطة IMDM في أنبوب 15 مل. ذوبان الجليد بسرعة الشركات المتعددة الجنسيات PB المجمدة في 37 ° C حمام الماء ثم نقلها إلى أنبوب مع المتوسط ​​IMDM.
    ملاحظة: طول الوقت في حمام مائي يعتمد على حجم الخلايا cryopreserved وش cryovialالحوار الاقتصادي الاستراتيجي. عادة، فإن الخلايا المجمدة ذوبان الجليد في 1 دقيقة.
  2. أجهزة الطرد المركزي في 400 x ج لمدة 5-10 دقائق. إزالة طاف و resuspend بيليه خلية في المتوسط ​​محمر. إضافة 10 ميكرولتر حل التريبان الأزرق إلى تعليق خلية 10 ميكرولتر وتخلط جيدا. التريبان الأزرق بقع الخلايا الميتة داخل 1-3 دقيقة. عد الخلايا تحت المجهر باستخدام عدادة الكريات.
  3. الشركات المتعددة الجنسيات ثقافة PB في الثقافة غير الأنسجة (غير TC) معاملة لوحة 6 جيدا مع 2 مل المتوسطة لكل بئر، في مناطق ذات كثافة خلية من ~ 5 × 10 6 خلية / مل، عند 37 درجة مئوية في 5٪ CO 2 حاضنة مرطب.
  4. إضافة 1 مل محمر الطازجة المتوسطة مباشرة إلى كل بئر من دون تغيير المتوسطة في د 3 و 5.
  5. في د ​​6، حصاد الشركات المتعددة الجنسيات PB لnucleofection.

5. PB MNC Nucleofection وإعادة برمجة

  1. قبل يوم واحد nucleofection، قبل معطف TC المعاملة 6 لوحات بشكل جيد مع الجيلاتين 0.1٪ عند 37 درجة مئوية لمدة 20 دقيقة. ذوبان المعطل الفئران الجنينية بالاليافانفجار (MEF) الخلايا المغذية في 37 ° C حمام الماء وعلى الفور نقلها إلى أنبوب 15 مل تحتوي على 5 مل من المتوسط ​​MEF.
  2. أجهزة الطرد المركزي في 400 x ج لمدة 5 دقائق وإزالة طاف. إزالة الجيلاتين من لوحة 6 جيدا، resuspend الكرية خلية في المتوسط ​​MEF، ونقلها إلى الجيلاتين قبل المعالجة لوحة 6 جيدا. في كل بئر، والبذور 2-4 × 10 5 خلايا MEF المعطل علقت في 2 مل MEF المتوسطة.
  3. ثقافة الخلايا المغذية MEF عند 37 درجة مئوية في 5٪ CO 2 حاضنة مرطب.
  4. في يوم nucleofection، نضح في والمتوسطة MEF واستبدالها مع 1 مل محمر المتوسطة. قبل تتوازن لوحة الثقافة ل10-30 دقيقة عند 37 درجة مئوية في 5٪ CO 2 حاضنة مرطب.
  5. إضافة 2 ميكروغرام PEV-OCT4-2A-SOX2، 1 ميكروغرام PEV-MYC، 1 ميكروغرام PEV-KLF4، و 0.5 ميكروغرام PEV-بي سي إل-XL في أنبوب 1.5 مل العقيمة إيبندورف. تسخين أنبوب عند 50 درجة مئوية لمدة 5 دقائق لمنع التلوث، ويبرد لRT. إضافة57 ميكرولتر nucleofection العازلة و 13 ملحق ميكرولتر.
  6. الحصاد 2 × 10 6 مثقف الشركات المتعددة الجنسيات PB إلى أنبوب 5 مل بواسطة الطرد المركزي في 200 x ج لمدة 7 دقائق. إزالة طاف وإضافة البلازميد وnucleofection مزيج عازلة لبيليه الخلية. مزيج جيد من قبل عبها الأنبوب مع إصبعك.
    ملاحظة: ما يصل الى 2 × 10 5 خلايا يمكن أن تستخدم لnucleofection، ولكن ينبغي يتوقعون انخفاض كفاءة إعادة برمجة كذلك.
  7. نقل الحمض النووي وتعليق خلية لكفيت المنصوص عليها في عدة وسقف كفيت. حدد برنامج U-008 على الجهاز nucleofection. إدراج كفيت في حامل واضغط موافق لتطبيق برنامج U-008.
  8. خذ كفيت خارج حامل، إضافة 0.5 - استعد قبل 1 مل المتوسطة محمر في كل كفيت، ونقل الخلايا إلى لوحة MEF معايرتها قبل على الفور. ويرجع ذلك إلى كفاءة إعادة برمجة عالية وتباين المانحة وزرع البذور أرقام مختلفة من الخلايا تتراوح 1-10 × 10 5 خلايا صإيه جيدا وتشجيع للغاية.
  9. نقل لوحة لغرفة نقص الأكسجة، ومسح الغرفة مع غاز مختلط يتكون من 92٪ N 5٪ CO 2 و 3٪ O 1 - 2 دقيقة بمعدل 20 لتر / دقيقة. بعد اغلاق غرفة والثقافة الخلايا عند 37 درجة مئوية.
  10. في D 2 بعد nucleofection، إضافة 2 مل IPSC المتوسطة مباشرة إلى كل بئر.
  11. في D 4 بعد nucleofection، وإزالة 3 مل من المتوسط ​​وإضافة 2 مل المتوسطة IPSC جديدة. في D 4 بعد nucleofection، سيكون قد تعلق معظم الخلايا الحية إلى الطبقة المغذية.
  12. بعد D 6 بعد nucleofection، تغيير المتوسط ​​كل د 2 من خلال ترك 500 ميكرولتر قضى المتوسطة وإضافة 2 مل المتوسطة E8 جديدة تستكمل مع 0.25 ملي الصوديوم الزبدات حتى D 14-18.
    ويمكن إضافة إضافية الخلايا المغذية في الآبار ثقافة كلما مشيرا إلى أن الخلايا المغذية تم فصل: ملاحظة. بعد ذوبان MEFS (انظر 5.1 و 5.2)، resuspend الكرية خلية في حجم صغير من E8 المتوسطة (أي ~ 0.2 مل لجانب واحد من لوحة 6 جيدا) ثم قم بإضافة MEFS في آبار الثقافة. ما يقرب من 2٪ FBS ويمكن أن يضاف لزيادة مرفق الخلية. بدلا من ذلك، المتوسطة MEF مكيفة يمكن أن تستخدم أيضا، لكنه أكثر شاقة.

6. توسيع iPSCs

ملاحظة: في معظم الحالات، تظهر أعداد كبيرة من المستعمرات التوجيهية في D 8-10 آخر nucleofection. بعد D 14، المستعمرات IPSC كبيرة وعادة ما تكون جاهزة للقطف.

  1. قبل اختيار المستعمرات، إضافة 500 ميكرولتر E8 المتوسطة تستكمل مع مثبط ROCK، Y27632 (10 ميكرون)، في بئر واحدة من تغذية أو Matrigel المغلفة لوحة 24 أيضا. استخدام 10 أو 20 ميكرولتر ماصة الى نقطة الصفر واختيار المستعمرات تحت المجهر. نقل قطع من كل مستعمرة إلى الآبار التي تحتوي على مستنبت.
    ملاحظة: إن تركيز Matrigel يختلف من دفعة واحدة إلى أخرى. عادة، ونحن نستخدم 1: 100 التخفيف من Matrigel.
    1. من أجل تجنب انتقال التلوث، واختيارالمستعمرات التي تكون كبيرة ويفصل جيدا من الآخرين. iPSCs الثقافة عند 37 درجة مئوية في 5٪ CO 2 حاضنة مرطب.
      ملاحظة: يجب أن يكون لاحظ أن السكان التوجيهية قد تكون بولكلونل بسبب هجرة الخلايا عندما تكون هناك عشرات أو مئات من المستعمرات في كل بئر من لوحة 6 جيدا.
  2. لا تغيير المتوسطة للد 2 الأولى. ROCK المانع يمكن أن تعزز بقاء مستعمرات صغيرة 25.
  3. من D 2 فصاعدا، تغيير المتوسط ​​كل يوم عن طريق إزالة المتوسطة المستهلك واضاف المتوسطة E8 500 ميكرولتر جديدة في كل بئر.
  4. وبعد حوالي 1 أسبوع، عندما المستعمرات هي كبيرة بما فيه الكفاية، وإزالة المتوسطة وعلاج الخلايا مع 300 ميكرولتر حل الخلية المفرزة (0.5 ملي EDTA في برنامج تلفزيوني) عند 37 درجة مئوية لمدة 1-3 دقيقة. إزالة حل الخلية المفرزة وإضافة المتوسطة E8 تحتوي على مثبط ROCK (10 ميكرومتر) تعليق iPSCs. لا تتحلل المستعمرات إلى الخلايا واحد، مما قد يؤدي إلى موت الخلايا المفرط. كتل الخلية مع 5-50 خليةالصورة هي مناسبة لIPSC مرور.
  5. نقل 50-100٪ من خلية إلى تعليق كل بئر من على بعد 6 جيدا لوحة 12- أو التي تم المكسوة مسبقا والمحمولة مع مغذيات أو Matrigel.
  6. للثقافة على المدى الطويل في لوحات Matrigel المغلفة (انظر الملاحظة في 6.1)، تغيير المتوسط ​​كل يوم. عندما يصل confluency خلية 40 - 60٪، وعلاج الخلايا مع 1 مل من محلول خلية مفرزة (0.5 ملي EDTA في برنامج تلفزيوني) عند 37 درجة مئوية لمدة ~ 3 دقائق. عندما تبدأ المستعمرات لعقص، وإزالة حل الخلية المفرزة وإضافة E8 المتوسط ​​تحتوي على مثبط ROCK (10 ميكرومتر) تعليق iPSCs. الخلايا مع مرور عامل تقسيم 4 - 8. ينبغي أن يضاف المانع ROCK عند الركض الخلايا لزيادة البقاء على قيد الحياة، وإزالتها في وقت لاحق 1 د لمنع التمييز.
  7. لتجميد أسفل iPSCs، وعلاج الخلايا مع حل الخلية المفرزة عند 37 درجة مئوية لمدة 3-5 دقيقة وفقا لبروتوكول الشركة المصنعة. عندما تبدأ المستعمرات التوجيهية لعقص، ونضح المخزن المؤقت وإضافة 0،5-1 مل E8 المتوسطة.
  8. <لى> إضافة حجم مساو من المتوسط ​​الحفظ بالتبريد إلى تعليق الخلية وتخلط جيدا. المجمدة iPSCs يمكن تخزينها في الفريزر -80 درجة مئوية لعدة أسابيع أو في النيتروجين السائل لتخزين على المدى الطويل.

7. اختيار iPSCs دون المتبقية Episomal البلازميدات

  1. بعد مرور 5، iPSCs الحصاد واستخراج الحمض النووي الجيني.
    ملاحظة: عادة بعد 5 مقاطع من الثقافة، البلازميدات episomal المتبقية لا يمكن اكتشافها. وهكذا، وكلها تقريبا من المستعمرات التوجيهية في الممرات فوق 5 (أي مرور 10) تفتقر البلازميدات episomal المتبقية.
  2. استخدام الحمض النووي الجيني من الشركات المتعددة الجنسيات PB untransfected كعنصر تحكم السلبية. إضافة 1.6 خريج PEV-OCT4-2A-SOX2 البلازميد إلى 1 ميكروغرام الحمض النووي السيطرة السلبي لتقليد الخلايا مع نسخة واحدة من PEV البلازميد لكل خلية.
  3. إضافة 9 ميكرولتر PCR الصف المياه بما في ذلك 100 نانوغرام الحمض النووي الجيني و 1 ميكرولتر الاشعال محددة (10 ميكرومتر كل من الأمام وعكس الاشعال) إلى 10 ميكرولتر عالية الدقة PCR ميكس ماجستير. تطبيع صباحاount من الحمض النووي عن طريق GAPDH. استخدام البادئات التالية لPCR: EBNA1-F TTTAATACGATTGAGGGCGTCT، EBNA1-R GGTTTTGAAGGATGCGATTAAG، WPRE-F GGTTTAAACGCGTCGACAAT، WPRE-R GTTGCGTCAGCAAACACAGT، GAPDH-F GAGTCCACTGGCGTCTTC، GAPDH-R GACTGTGGTCATGAGTCCTTC.
  4. احتضان خليط التفاعل في 98 درجة مئوية لمدة 60 ثانية. تليها 98 درجة مئوية لمدة 10 ثانية و 60 درجة مئوية لمدة 30 ثانية، و 72 درجة مئوية لمدة 30 ثانية. بعد 30 دورات، تمديد رد الفعل عند 72 درجة مئوية لمدة 5 دقائق.
  5. تحميل 5 منتجات ميكرولتر PCR في كل بئر من هلام الاغاروز 1٪. تشغيل هلام ل20 - 30 دقيقة في 100 خامسا اختيار الحيوانات المستنسخة IPSC مع العصابات لا يمكن اكتشافها عن EBNA1 وWPRE لمزيد من الثقافة وتحليل المصب.

8. التدفق الخلوي

  1. حصاد iPSCs بمعاملتها مع Accutase عند 37 درجة مئوية لمدة 3-5 دقيقة للحصول على تعليق خلية واحدة. إضافة 1 ميكرولتر PE-مترافق مكافحة TRA-1-60 أو eFluor 570 مترافق مكافحة SSEA4 أو الأجسام المضادة إسوية النمط إلى 100 ميكرولتر من تعليق خلية (1-5 × 10 5 خلايا) في 5 مل أنابيب. احتضان الأنابيب في مكان مظلم في RT لمدة 20 دقيقة.
  2. بعد تلطيخ لمدة 20 دقيقة في RT، إضافة 2 مل برنامج تلفزيوني وأجهزة الطرد المركزي في 400 x ج لمدة 5 دقائق. Resuspend الخلايا في 300 ميكرولتر برنامج تلفزيوني لتحليل مضان تنشيط الفرز الخلية (نظام مراقبة الأصول الميدانية) باستخدام التدفق الخلوي محلل الخلية. 23،26

9. متحد البؤر التصوير

  1. iPSCs البذور في الشرائح غرفة Matrigel المغلفة.
  2. بعد 3-4 د الثقافة، وإزالة المتوسطة النمو وإصلاح مع بارافورمالدهيد 4٪ (PFA) في RT لمدة 30 دقيقة. غسل الخلايا مرتين مع برنامج تلفزيوني.
    ملاحظة: PFA غير سامة وضارة.
  3. علاج الخلايا مع 0.1٪ تريتون X-100 في برنامج تلفزيوني (PBS-T) في RT لمدة 30 دقيقة. غسل الخلايا مرتين مع برنامج تلفزيوني.
  4. منع الخلايا مع عازلة تمنع (مصل الماعز 5٪ في برنامج تلفزيوني، والخامس: V) في RT لمدة 1 ساعة.
  5. خلال خطوة حجب، يخفف من الأجسام المضادة الأولية (100X) في عرقلة العازلة.
    ملاحظة: يتم سرد المعلومات الأجسام المضادة في جدول المواد / المعدات.
  6. احتضان الخلايا مع الأجسام المضادة المخفف في 4 درجات CO / N.
  7. يغسل مرتين مع برنامج تلفزيوني-T لمدة 15 دقيقة، تليها مرتين مع برنامج تلفزيوني لمدة 15 دقيقة.
  8. احتضان الخلايا مع الأجسام المضادة الثانوية-fluorophore مترافق المخفف في RT لمدة 2 ساعة.
  9. غسل الخلايا مرتين مع برنامج تلفزيوني-T لمدة 15 دقيقة، تليها مرتين مع برنامج تلفزيوني لمدة 15 دقيقة.
  10. وصمة عار على نواة مع دابي (1 ميكروغرام / مل) في برنامج تلفزيوني على RT لمدة 10 دقيقة.
  11. غسل الخلايا مرتين مع برنامج تلفزيوني لمدة 15 دقيقة.
  12. التقاط الصور مع المجهر متحد البؤر. 23،27

10. مسخي الفحص

حصاد 1 × 10 6 iPSCs مع حل الخلية المفرزة (0.5 ملي EDTA في برنامج تلفزيوني) والخلايا resuspend في 200 ميكرولتر DMEM / F12 المخفف (1: 1) Matrigel.

  1. تحت الجلد حقن الخلايا في الكفل الخلفي من الفئران العوز المناعي NOD / SCID.
  2. في 8-12 أسبوع بعد حقن التوجيهية، تشريح وتحديد مسخي المبيض في 10٪ من الفورمالين. 28
  3. بعد microsectioning وتلطيخ مع هيماتوكسيلين ويوزين (H & E)، تحليل العينات. 29

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

باستخدام هذا البروتوكول، يمكننا الحصول على مئات المستعمرات من 1 × 10 5 nucleofected PB الشركات المتعددة الجنسيات (الشكلان 1A و 1B). كفاءة إعادة برمجة حوالي 0،2-0،5٪ والمستعمرات تعبر عن علامات تعدد القدرات (أرقام 1C و1D). iPSCs تم إنشاؤها باستخدام بروتوكول صفها خالية من التكامل ولديها القدرة على تشكيل مسخي تأليف 3 طبقات جرثومية (أرقام 1E و1F).

شكل 1
الشكل 1: جيل من iPSCs خالية من التكامل من خلايا الدم المحيطي وحيدة النواة. (أ): رسم تخطيطي لبروتوكول لإعادة برمجة خلايا الدم الطرفية. (ب): AP تلطيخ بكميات كبيرة (يسار) ومستعمرة IPSC ESC مثل نموذجي (يمين)60 و 14 د بعد PB الشركات المتعددة الجنسيات nucleofection. شريط مقياس: 100 ميكرون. (C): FACS التمثيلية مخططات iPSCs في مرور 5 معربا عن هيئة تنظيم الاتصالات 1-60 أو SSEA4. (D): صور متحد البؤر التمثيلية للمستعمرات IPSC معربا عن NANOG وOCT4. شريط مقياس: 100 ميكرون. (E): صورة الممثل من الصورة الكلية وH & E تلطيخ مسخي تضم جميع الطبقات الجرثومية الثلاث. شريط مقياس: 100 ميكرون. (F): نسخ الأرقام من البلازميدات EV المتبقية في iPSCs بعد خمسة مقاطع. استخدمت بادئات محددة لEBNA1 وWPRE لتضخيم ناقلات episomal. وقد استخدم GAPDH كعنصر تحكم الحمض النووي التحميل. UD، غير قابلة للكشف. ويشير حارة إيجابي على ضبط نسخة واحدة. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

الحصول على عينات الدم من المتبرعين الأصحاء أو المرضى غير مريحة وموسع، مما يجعلها مصدر خلية جذابة للبحوث الأساسية والعلاج بالخلايا السريري. هنا وصفناها بروتوكول لتوليد كفاءة عالية من iPSCs خالية من التكامل من عينات الدم الطرفية. هذا النهج استنساخه وبأسعار معقولة ينبغي أن تستفيد مجال التوجيهية.

لقد ذكرت أن هناك نوعان من العوامل الحاسمة المسؤولة عن كفاءة عالية PB إعادة برمجة 30. واحد هو التعبير متساوي المولية من OCT4 وSOX2 باستخدام رابط 2A 31. ولتحقيق ذلك، يتم استخدام PEV-OCT4-2A-SOX2 في هذا البروتوكول. والآخر هو استخدام اثنين من البلازميدات PEV-MYC وPEV-KLF4 للتعبير عن MYC وKLF4 بدلا من PEV-MYC-2A-KLF4 أننا في وقت سابق قد استخدمت 30. التغيير تبدو بسيطة يؤدي إلى زيادة 100X تقريبا في الكفاءة برمجة PB، والذي يرجع إلى حد كبير إلى زيادة تدريجية وأكبر في MYC: كوالا لمبورنسبة F4 أثناء العملية.

وينبغي النظر في عدة نقاط لتحقيق الكفاءة العالية IPSC جيل من الجريدة الرسمية. الشركات المتعددة الجنسيات PB يتم تربيتها ل~ 1 أسبوع في المتوسط محمر، وهو ما يعزز انتشار وتوسع الخلايا محمر السلف، وبالتالي يزيد من كفاءة إعادة برمجة 20. ومع ذلك، بالنسبة لبعض العينات، وخاصة بالنسبة للخلايا الدم من المرضى بسرطان الدم، وخلايا البقاء على قيد الحياة سيئة عند المثقف في المتوسط ​​محمر. في هذه الحالة، سيكون من المفيد لتقليل وقت زراعة. ومما يشجع أيضا على استخدام 1-2 ميكروغرام متجه pmaxGFP للتحقق من كفاءة nucleofection، الذي يجب أن يكون أكبر من 50٪. وبالإضافة إلى ذلك، ونوعية البلازميد هو المهم. فمن المستحسن استخدام البلازميدات دون تلوث الذيفان الداخلي (أي باستخدام إندو خالية من البلازميد ماكسي كيت لاستخراج البلازميدات). سوء نوعية البلازميد قد يؤدي إلى موت الخلايا كبير، وبالتالي تقلل من كفاءة إعادة برمجة. نحن وآخرون قد أظهرت أن العرض ونقص الأكسجةوفاق IPSC الجيل 14،32. نحن مسح غرفة نقص الأكسجة مع غاز مختلط يتكون من 92٪ N 5٪ CO 2 و 3٪ O 2. إذا تم استخدام normoxia بدلا من ذلك، ما يصل إلى تخفيض بنسبة 80٪ في كفاءة إعادة برمجة يمكن ملاحظة. وبمجرد أن إعادة برمجة كاملة، قد iPSCs يكون مثقف في العادية ترطيب 5٪ CO 2 الحاضنة. عند تغيير المتوسطة، وهو مفيد لترك كمية صغيرة من متوسطة قضى (أي 500 ميكرولتر لكل بئر في لوحة 6 جيدا)، ثم قم بإضافة متوسطة جديدة. تغيير المتوسطة فقط كل يوم خلال إعادة برمجة، وتغيير المتوسطة متكررة جدا قد يقلل iPSCs جيل 33.

حقق البروتوكول الجديد وضعنا برمجة PB رفيعة المستوى التي هي مماثلة لنظام SV إعادة برمجة. نظام EV عدة مزايا واضحة. لأحد، EV هو أكثر بأسعار معقولة من SV. نظام EV يمكن أيضا زيادة تعديلها من قبل بما في ذلك العوامل الإضافية أو combina مختلفةستعقد لعوامل متعددة، في حين أن ناقلات SVS هي نتاج التجارية التي لا يمكن تعديلها من قبل المحققين. ويشمل لدينا البروتوكول الحالي استخدام الخلايا المغذية MEF والمنتجات المشتقة من الحيوانات، والتي قد تحد من التطبيقات السريرية، ولكن يمكن إزالتها بسهولة عن طريق تطوير المزيد من بروتوكول 34،35.

iPSCs ولدت مع هذا النظام يمكن استخدامه ليس فقط لنمذجة المرض وفحص المخدرات، ولكن أيضا للعلاج السريري، لأن البلازميدات على مستوى GMP EV يمكن أن تتولد بسهولة وتم التعرف لا iPSCs مع التكامل EV كبيرا. في التطبيقات السريرية، وخلايا المريض عادة تؤوي الجين الذي يحفز المرض الذي يحتاج إلى تصحيح في iPSCs قبل التمايز إلى خلايا وظيفية للعلاج. وأظهر تقرير صدر مؤخرا أن نظام EV إعادة برمجة يمكن دمجها بسهولة مع نظام / Cas9 كريسبر لتحقيق إعادة برمجة في وقت واحد وتحرير الجينوم بعد nucleofection بسيط 36. هذا هوميزة نوثر من EV على النظام SV. وقد أظهرت لنا بيانات غير منشورة أن ما يصل إلى 20٪ الجينوم كفاءة التحرير لا يمكن أن يتحقق عندما حمل مركبة تحرير الجينوم على EV إعادة برمجة. ويحدونا الأمل في أن التكامل من إعادة برمجة PB مع هش / Cas9R الجينوم التحرير قد يكون التطبيقات المحتملة في علاج الأمراض المتعددة التي هي غير قابلة للشفاء إلا في العقود المقبلة.

وباختصار، يجب أن يكون لدينا تحسين الطرفية بروتوكول إعادة برمجة خلايا الدم مفيد عن طيف واسع من المحققين في البحوث الأساسية والتطبيقات السريرية. ويمكن أيضا أن هذا النظام EV إعادة برمجة كفاءة أن تستخدم، بعد التعديلات، لتوليد خلايا خالية من التكامل الجذعية الوسيطة (اللجان الدائمة) 37، أو الخلايا الجذعية العصبية (NSCs) 38، مباشرة من خلايا الدم الطرفية الكبار دون المرور عبر مرحلة التوجيهية.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics