Die Erzeugung von Integration freien induzierte pluripotente Stammzellen aus menschlichen peripheren einkernigen Blutzellen Mit Episomale Vektoren

JoVE Journal
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Induzierte pluripotente Stammzellen (iPS-Zellen) sind äußerst viel versprechend für Krankheitsmodelle und regenerative Therapien. Wir zuvor berichtet die Verwendung von episomalen Vektoren (EV) Integration freien iPSCs aus peripheren mononukleären Blutzellen (MNCs PB) zu erzeugen. Die episomale Vektoren verwendet werden DNA - Plasmide integriert mit oriP und EBNA1 Elemente aus dem Epstein-Barr (EB) -Virus, die für die Replikation und Langzeit retainment von Plasmiden in Säugerzellen ermöglichen, respectively. Mit einer weiteren Optimierung kann Tausende von iPS Kolonien von 1 ml peripheren Blut gewonnen werden. Zwei kritische Faktoren zur Erzielung hoher Wirkungsgrade Neuprogrammierung sind: 1) die Verwendung eines 2A "Selbstspaltung" Peptid zu verknüpfen OCT4 und SOX2, wodurch äquimolare Expression der beiden Faktoren zu erreichen; 2) die Verwendung von zwei Vektoren auszudrücken MYC und KLF4 einzeln. Hier haben wir einen Schritt-für-Schritt-Protokoll zur Erzeugung von Integration freien iP beschreibenSCs aus adulten peripheren Blutproben. Die erzeugten iPS-Zellen sind Integration frei als Rest episomalen Plasmiden nach fünf Passagen nicht nachweisbar sind. Obwohl die Umprogrammierung Effizienz der von Sendai-Virus (SV) Vektoren vergleichbar ist, sind EV Plasmiden wesentlich wirtschaftlicher sind als die im Handel erhältlichen Vektoren SV. Dieses günstige EV Umprogrammierung System hält für klinische Anwendungen in der regenerativen Medizin Potenzial und bietet einen Ansatz für die direkte Umprogrammierung von PB MNU zur Integration freien mesenchymalen Stammzellen, neurale Stammzellen, usw.

Introduction

Nach forcierter Expression mehrerer Transkriptionsfaktoren (Dh OCT4, SOX2, MYC und KLF4) können somatischen Zellen zu induzierten pluripotenten Stammzellen (iPS - Zellen) umprogrammiert werden, die für Anwendungen ein großes Versprechen halten in der regenerativen Medizin und Zellersatztherapie 1-3. Bisher wurden verschiedene Methoden entwickelt , um die Erfolgsrate der Umprogrammierung 4-7 zu erhöhen. Virale Vektoren induzierte Reprogrammierung ist für eine effiziente Erzeugung von iPS-Zellen weit verbreitet, weil die virale Integration führt zu einem hohen Niveau, eine stabile Expression der Umprogrammierung Faktoren. Eine permanente Integration der Vektor - DNA in das Zellgenom induzieren Insertionsmutagenese 5. Darüber hinaus kann unzureichende Inaktivierung von Reprogrammierungsfaktoren iPSCs Differenzierung 8 stören. Als solches ist der Einsatz von iPS-Zellen ohne Integration von Reprogrammierungsfaktoren zwingend notwendig, vor allem für den Einsatz in der Zelltherapie-Anwendungen.

9. Das oriP-Element fördert Plasmidreplikation in Säugetierzellen, während das EBNA1 Element den oriP-enthaltenden Plasmid-DNA in die chromosomale DNA anbindet, die für die Unterteilung des Episom während der Teilung der Wirtszelle ermöglicht. Im Vergleich zu anderen Integrationsfreien Ansätze, einschließlich Sendai - Virus (SV) und RNA - Transfektion besitzen EVs mehrere Vorteile 5,6,10. Als Plasmid-DNA kann EVs leicht im Haus hergestellt und modifiziert werden, so dass sie äußerst erschwinglich zu machen. Darüber hinaus mit EV Umprogrammierung ist eine weniger arbeitsintensiver Prozess, da eine einzelne Transfektion mit EVs für iPSC Generation ausreichend ist, während mehrere RNA-Transfektionen für die erfolgreiche Reprogrammierung notwendig sind.

Dermal Fibroblasten wurden in vielen Umprogrammierung Studien verwendet worden. Allerdings ist Hautbiopsie nicht nur eine invasive und schmerzhafter Prozess, sondern auch zeitaufwendig für Zellen zu ausreichenden Mengen für eine Neuprogrammierung zu erweitern. Von größerer Bedeutung, Hautzellen von erwachsenen Spendern haben oft zu langfristigen UV - Licht - Strahlung ausgesetzt worden, die zu Mutationen , die mit Tumoren führen kann, so dass die Anwendungen für aus Fibroblasten der Haut 11,12 abgeleitet iPSCs begrenzen. Kürzlich ist berichtet worden , dass normale menschliche Hautzellen und somatische Mutationen multiple Krebsgene ansammeln, einschließlich die meisten der Schlüsselfaktoren der kutanen squamösen Zellkarzinomen, sind unter starkem positiven Selektions 13.

Im Gegensatz zu Hautfibroblasten, peripherem Blut (PB) Zellen eine bevorzugte Quelle von Zellen für eine Neuprogrammierung sind, weil 1) Blutzellen, können leicht durch eine minimal-invasive Verfahren, 2) periphere Blutzellen sind die Nachkommen von hämatopoetischen Stammzellen erhalten werden,im Knochenmark mit Wohnsitz, also vor schädlicher Strahlung geschützt. Periphere mononukleäre Blutzellen (PB MNCs) können in einer Stunde aus der buffy coat-Schicht nach einem einfachen Gradientenzentrifugation gesammelt werden unter Verwendung von Ficoll-Hypaque (1,077 g / ml). Die erhaltenen PB MNU sind aus Lymphozyten bestehen, Monozyten und einigen hämatopoetischen Vorläuferzellen (HPC) 14. Obwohl menschliche T - Lymphozyten eine der Hauptzelltypen in PB sind, reifen T - Zellen enthalten Neuanordnungen der T - Zell - Rezeptor (TCR) Gene und fehlt somit eine intakte Genom ihr Potential für Anwendungen Begrenzungs 15,16. Kann die Verjüngung von T - Zellen über iPSC Generation haben jedoch potenzielle Anwendungen in chimären Antigenrezeptoren (CAR) T-Zell - Therapie 17-19. Im Vergleich dazu haben HPCs eine intakte Genom und sind leicht umprogrammierbar. Obwohl nur 0,01-0,1% der Zellen in den peripheren Kreislauf HPCs sind, können diese Zellen ex vivo in erythroiden Medium erweitert werden , die Proliferation von erythr begünstigtoid Vorläuferzellen 14.

In unserer früheren Studie haben wir den Faktor BCL-XL zusätzlich zu den Yamanaka Faktoren (OCT4, SOX2, MYC und KLF4), die in einem 10 - fach Anstieg der PB Umprogrammierung efficency 20 geführt. BCL-XL, die auch als BCL2L1 bekannt, ist ein potenter Inhibitor der Zelltod durch 21,22 Aktivierung von Caspasen hemmen. Aber BCL-XL kann auch eine wichtige Rolle spielen Pluripotenz 21,22 aufrechtzuerhalten. Vor kurzem haben wir unsere EV Umprogrammierung System mit zwei Vektoren durch separat exprimierenden MYC und KLF4 optimiert, was in Umprogrammierung Wirkungsgrad 23 auf eine etwa 100 - fache Steigerung führt. Unter Verwendung dieses Verfahrens wird die Umprogrammierung Effizienz, definiert durch Koloniezahl geteilt durch die Zellzahl bei der Transfektion ausgehend ist 0,2-0,5% von gesunden Spendern. Wie folgt beschreiben wir die detaillierte experimentelle Verfahren zur Erzeugung von Integration freien iPSCs von PB.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle der menschlichen PB Proben wurden von anonymen erwachsenen Spendern ohne Identifikationsinformationen von Tianjin Blood Center mit Genehmigung der lokalen Forschungsethikkommission erhalten.

1. Endo-freie Plasmid-Präparation

  1. Verwenden Sie eine kommerzielle Plasmidaufreinigung Maxi Kit zu episomale Vektoren von E. coli - Extrakt nach dem Protokoll des Herstellers. Für den letzten Schritt Ersatz TE-Puffer mit Endotoxin-freiem sterilem Wasser, um das DNA-Pellet aufzulösen.
  2. Messen Sie DNA-Konzentration eines handelsüblichen UV / Vis-Spektralphotometer. Die Konzentration ist in der Regel größer als 1 & mgr; g / & mgr; l, mit A260 / A280 und A260 / A230 Verhältnis von mehr als 1,8 bzw. 2,0.

2. Kultur Medien

  1. Bereiten Sie erythroiden Medium: Blutstammzell-Expansion Medium, ergänzt mit 100 ng / ml menschlichen Stammzellfaktor (SCF), 10 ng / ml Interleukin-3 (IL3), 2 U / ml Erythropoietin (EPO), 20 ng / mL Insulin-Wachstumsfaktor-1 (IGF1), 1 & mgr; M Dexamethason und 0,2 mM 1-Thioglycerin. Filter zu sterilisieren mit einem 0,22 & mgr; m Spritzenfilter. Erythroid Medium kann für bis zu einem Monat bei 4 ° C gelagert werden.
  2. Bereiten Sie iPSC Medium: DMEM / F12-Medium (Dulbecco Modified Eagle Medium / Nährsalzgemisch F-12), ergänzt mit 1x L-Glutamin, 1x Penicillin / Streptomycin, 1x nicht-essentielle Aminosäuren Lösung, 50 ng / ml Fibroblasten-Wachstumsfaktor 2 (FGF2 ), 1x Insulin-Transferrin-Selenit-Ergänzung (ITS) und 50 mg / ml Ascorbinsäure. Filter zu sterilisieren mit einem 0,22 & mgr; m Spritzenfilter. iPSC Medium kann für bis zu einem Monat bei 4 ° C gelagert werden.
  3. Bereiten MEF Medium: Dulbeccos modifiziertem Eagle Medium (DMEM; glucosereichem), supplementiert mit 1x Penicillin / Streptomycin und 10% fötalem Rinderserum (FBS). Filter zu sterilisieren mit einem 0,22 & mgr; m Spritzenfilter. MEF Medium kann für bis zu einem Monat bei 4 ° C gelagert werden oder frisch 1x L-Glutamin vor der Verwendung.
  4. Prepare iPSC Kryokonservierung Medium (2x): Man löst 5 g D-Trehalose in 30 ml sterilem Wasser in einem 37 ° C Wasserbad. Bringen Sie die Temperatur auf 4 ° C abgekühlt und dann wurden 10 ml FBS und 10 ml Dimethylsulfoxid (DMSO). Filter zu sterilisieren mit einem 0,22 & mgr; m Spritzenfilter. Lagerung bei 4 ° C für bis zu 3 Monate 24.

3. Isolierung von peripheren mononukleären Blutzellen (PB MNU)

  1. Kombinieren Sie 10 ml frisch PB Probe und 10 ml PBS-Puffer in einen 50-ml-Röhrchen und gut mischen. Bringen PBS auf RT oder 37 ° C vor der Verwendung.
    HINWEIS: ca. 1 - 3 x 10 6 MNC (frisch oder kryokonserviert) von 1 ml PB erhalten werden. Nach 6 d der Kultur erwarten 0,5 haben - 1 x 10 6 Zellen insgesamt durch Tod von reifen Zellen während der Kultur. Ungefähr 1 x 10 7 Zellen aus 10 ml frischem PB erhalten werden.
  2. Fügen Sie 10 ml Ficoll mit dem Boden des Röhrchens ein 10 ml-Spritze mit einer langen Nadel befestigt werden. Diese progang sollte langsam erfolgen, um sicherzustellen, dass die Ficoll-Schicht nicht mit der PB mischt.
  3. Zentrifuge bei 400 × g für 30 min bei einer niedrigen Beschleunigungs- und Verzögerungsrate. Nach Zentrifugation werden die PB MNCs in der weißen Schicht (buffy coat) zwischen dem PB Plasma und dem Ficoll entfernt.
  4. Langsam ansaugen ~ 10 mL PB Plasma ohne die Leukozytenfilmschicht zu stören. Sorgfältig ernten die weiße Schicht mit einer 1 ml Pipettenspitze auf ein neues 50-ml-Röhrchen mit. 6 mL - das Gesamtvolumen der gesammelten Zellen von der weißen Schicht zwischen 3 sein.
  5. Hinzufügen PBS um das Gesamtvolumen auf 30 ml zu bringen, und auch mit einer 10 ml Pipette mischen. Zentrifuge bei 400 × g für 10 min.
  6. Entfernen Sie den Überstand und resuspendieren Zellpellet in 20 ml Kulturmedium (dh Iscove modifiziertem Dulbecco-Medium, IMDM) und gut mischen. Zentrifuge bei 400 × g für 10 min die Mehrheit der Plättchen zu entfernen.
  7. Entfernen Sie den Überstand und Zellpellet in 1 bis 2 ml IMDM. Die Zellen können f verwendet werdenoder unmittelbare Kultur oder gefroren-down für die spätere Verwendung. Für die Kryokonservierung, eine gleiche Menge an Kryokonservierung Medium hinzuzufügen. Aliquot Zellen in Kryoröhrchen (0,5-1 ml pro Fläschchen) und Transfer Kryovials zu einem -80 ° C Gefrierschrank sofort. PB MNCs kann in -80 ° C Gefrierschrank für mehrere Wochen oder übertragen zu einer flüssigen Stickstofftank für die Langzeitspeicher gespeichert werden.
    HINWEIS: Wenn die gefrorenen Zellen aufgetaut, obwohl unsere Kryokonservierung Medium die Lebensfähigkeit der Zellen unterstützen kann, durch die Zellzahl verringern kann während des Auftauens Prozess zum Zelltod. Es wird empfohlen, 1 bis 10 x 10 7 Zellen werden in jede Ampulle eingefroren werden.

4. Ausbau der PB MNU in Erythroide Medium

  1. Bereiten Sie 5 ml IMDM-Medium in einem 15 ml-Röhrchen. Schnell Auftauen des gefrorenen PB MNC in einem 37 ° C Wasserbad und übertragen sie dann auf das Rohr mit dem IMDM-Medium.
    HINWEIS: Die Zeitdauer, in Wasserbad abhängig vom Volumen der kryokonservierten Zellen und die Kryoröhrchen used. Normalerweise wird die gefrorene Zelle innerhalb von 1 min auftauen.
  2. Zentrifuge bei 400 xg für 5 - 10 min. Entfernen Sie den Überstand und Zellpellet in erythroiden Medium. In 10 ul Trypanblau Lösung auf 10 & mgr; l Zellsuspension und gut mischen. Trypanblau färbt tote Zellen innerhalb von 1 - 3 Minuten. Zählen Sie die Zellen unter dem Mikroskop eine Zählkammer.
  3. Kultur PB MNCs in einem nicht-Gewebekultur (non-TC) pro Vertiefung Platte mit 6 Vertiefungen mit 2 ml Medium behandelt, bei einer Zelldichte von ca. 5 x 10 6 Zellen / ml, bei 37 ° C in einem 5% CO 2 befeuchteten Inkubator.
  4. 1 ml frisch erythroiden Medium direkt in jede Vertiefung ohne Veränderung des Mediums bei D 3 und 5.
  5. Bei D 6, ernten die PB MNU für Nukleofektion.

5. PB MNC Nucleofection und Reprogrammierung

  1. Einen Tag vor Nukleofektion, pre-coat TC-behandelten Platten mit 6 Vertiefungen mit 0,1% Gelatine bei 37 ° C für 20 min. Thaw inaktivierten Murine Embryonale FibroExplosion (MEF) Feeder-Zellen in einem 37 ° C Wasserbad und sofort in ein 15 ml-Röhrchen übertragen 5 ml MEF Medium enthält.
  2. Zentrifuge bei 400 xg für 5 min und entfernen Sie den Überstand. Entfernen Sie die Gelatine aus der 6-Well-Platte, Zellpellet in MEF Medium, und sie auf die Gelatine vorbehandelt 6-Well-Platte. In jede Vertiefung, Samen 2-4 x 10 5 inaktivierten MEF - Zellen in 2 ml MEF Medium suspendiert.
  3. Kultur die MEF - Feeder - Zellen bei 37 ° C in einem 5% CO 2 befeuchteten Inkubator.
  4. Am Tag der Nukleofektion absaugen MEF Medium und ersetzen Sie es mit 1 ml erythroiden Medium. Pre-Äquilibrierung für 10 der Kulturplatte - 30 min bei 37 ° C in einem 5% CO 2 befeuchteten Inkubator.
  5. Hinzufügen 2 ug pEV-OCT4-2A-SOX2, 1 & mgr; g pEV-MYC, 1 & mgr; g pEV-KLF4 und 0,5 ug pEV-BCL-XL in einem 1,5 ml sterilen Eppendorf-Röhrchen. Erhitzen Sie das Rohr bei 50 ° C für 5 min eine Kontamination zu verhindern, und Abkühlen auf RT. Hinzufügen57 & mgr; l Nukleofektion Puffer und 13 & mgr; l zu ergänzen.
  6. Ernte 2 x 10 6 kultiviert PB MNCs zu einem 5 ml - Röhrchen von 7 min bei 200 xg zentrifugiert. Entfernen Sie den Überstand und fügen Sie das Plasmid und Nukleofektion Puffermischung zu dem Zellpellet. Gut mischen, indem das Röhrchen mit dem Finger schnippen.
    HINWEIS: So niedrig wie 2 x 10 5 Zellen können für Nukleofektion verwendet werden, aber eine geringere Umprogrammierung Effizienz sollte auch zu erwarten.
  7. Übertragen Sie die DNA und Zellsuspension in die Küvette im Kit enthalten und die Kappe der Küvette. Wählen Sie das Programm U-008 auf der Nukleofektion Gerät. Setzen Sie die Küvette in die Halterung ein und drücken Sie OK, um die U-008-Programm bewerben.
  8. Nehmen Sie die Küvette aus dem Halter, fügen 0,5-1 ml vorgewärmten erythroiden Medium in jeder Küvette und Transferzellen an die voräquilibriert sofort MEF Platte. Aufgrund der hohen Effizienz und Umprogrammierung Spender Variation eine unterschiedliche Anzahl von Zellen im Bereich von 1-10 x 10 5 Zellen Animpfen per gut ist sehr erwünscht.
  9. Übertragen , um die Platte zu einer Hypoxie Kammer und Spülen der Kammer mit einem Gasgemisch bestehend aus 92% N 2, 5% CO 2 und 3% O 2, für 1 bis 2 min bei einer Geschwindigkeit von 20 l / min. Nach dem Verschließen der Kammer Kultur der Zellen bei 37 ° C.
  10. Bei D 2 Post-Nukleofektion, 2 ml iPSC Medium zu jeder Vertiefung direkt.
  11. Bei D 4 post-Nukleofektion, entfernen 3 ml Medium und 2 mL frisch iPSC Medium. Bei D 4 post-Nukleofektion, werden die meisten der lebenden Zellen auf den Feeder-Schicht angebracht.
  12. Nach D 6 post-Nukleofektion, ändern Sie das Medium alle 2 d um 500 verlassen ul verbrauchten Medium und Zugabe von 2 ml frischem E8-Medium mit 0,25 mM Natriumbutyrat bis D 14 bis 18.
    HINWEIS: Zusätzliche Feeder-Zellen können in den Kulturvertiefungen hinzugefügt werden, wenn die Beobachtung, dass der Feeder-Zellen abgelöst worden. Nach MEFs Auftauen (siehe 5.1 und 5.2), Zellpellet in einem kleinen Volumen von E8 Medium (dh ~ 0.2 ml für eine Vertiefung einer 6-Well-Platte) und fügen Sie dann MEFs in die Kulturvertiefungen. Etwa 2% FBS Zellanheftung zu erhöhen, können zugesetzt werden. Alternativ kann auch MEF-konditioniertes Medium verwendet werden, aber es ist mühsam.

6. Erweiterung der iPS-Zellen

HINWEIS: In den meisten Fällen eine große Anzahl von iPS-Kolonien erscheinen bei D 8 - 10 Post Nukleofektion. Nach D 14, sind große iPSC Kolonien in der Regel bereit für die Kommissionierung.

  1. Vor Kolonien Kommissionierung, 500 & mgr; l E8 Medium mit ROCK-Hemmer ergänzt, Y27632 (10 & mgr; M), in eine Vertiefung einer Zubringer oder Matrigel beschichtet 24-Well-Platte. Verwenden Sie eine 10 oder 20 & mgr; l Pipette zu kratzen und Kolonien unter dem Mikroskop holen. Übertragen die Stücke jeder Kolonie in die Vertiefungen des Kulturmediums enthält.
    HINWEIS: Die Konzentration an Matrigel unterscheidet sich von einer Charge zur anderen. Normalerweise verwenden wir 1: 100 Verdünnung von Matrigel.
    1. Um eine Kreuzkontamination zu vermeiden, wählen SieKolonien, die von anderen großen und gut voneinander getrennt sind. Kultur iPSCs bei 37 ° C in einem 5% CO 2 befeuchteten Inkubator.
      HINWEIS: Es sollte beachten, dass die iPS Bevölkerung Zellmigration durch polyklonalen sein kann, wenn es Dutzende oder Hunderte von Kolonien in jeder Vertiefung einer 6-Well-Platte sind.
  2. Nicht Medium für die ersten 2 d ändern. ROCK - Inhibitor kann das Überleben von kleinen Kolonien 25 fördern.
  3. Von D 2 ab, Medium jeden Tag ändern, indem Sie verbrauchte Medium zu entfernen und in jeder Vertiefung 500 ul frisch E8 Medium hinzufügen.
  4. Etwa 1 Woche später, wenn die Kolonien groß genug sind, entfernen Sie das Medium und Behandlung der Zellen mit 300 & mgr; l Zellablösung Lösung (0,5 mM EDTA in PBS) bei 37 ° C für 1 - 3 Minuten. Entfernen Sie die Zellablösung Lösung und fügen Sie E8-Medium, das ROCK-Inhibitor (10 uM) iPSCs auszusetzen. brechen Sie nicht Kolonien in einzelne Zellen nach unten, was zu einer übermäßigen Zelltod führen kann. Die Zellklumpen mit 5-50 Zelles sind für iPSC Durchgang geeignet.
  5. Dann werden 50 - 100% der Zellsuspension in jede Vertiefung einer 12- oder 6-Well-Platte, die mit Zubringern oder Matrigel schwemmt wurde.
  6. Für langfristige Kultur in Matrigel-beschichteten Platten (siehe Anmerkung in 6.1), ändern Sie das Medium jeden Tag. Wenn die Zelle 40 Konfluenz erreicht - 60%, zu behandeln, die Zellen mit 1 ml Zellentfernungslösung (0,5 mM EDTA in PBS) bei 37 ° C für ~ 3 min. Wenn die Kolonien zum Einrollen beginnen, entfernen Sie die Lösung Zellablösung und fügen E8-Medium, das ROCK-Inhibitor (10 & mgr; M), um die iPS-Zellen einzustellen. Passage-Zellen mit einem Teilungsfaktor von 4 - 8. Der ROCK-Inhibitor hinzugefügt werden sollte, wenn die Zellen Passagierung Überleben zu erhöhen, und entfernt 1 d spätere Differenzierung zu verhindern.
  7. Zum Einfrieren-down iPSCs, behandeln Zellen mit Zellablösung-Lösung bei 37 ° C 3 - 5 min nach dem Protokoll des Herstellers. Wenn iPSC Kolonien zum Einrollen beginnen absaugen Puffer und 0,5 hinzufügen - 1 ml E8 Medium.
  8. <li> ein gleiches Volumen von Kryokonservierung Medium zur Zellsuspension hinzufügen und gut mischen. Gefrorene iPSCs kann in einem -80 ° C Gefrierschrank für mehrere Wochen oder in flüssigem Stickstoff zur Langzeitlagerung gelagert werden.

7. Auswahl von iPS-Zellen ohne Rest episomalen Plasmiden

  1. Nach dem Durchgang 5, Ernte iPSCs und extrahieren genomischer DNA.
    HINWEIS: In der Regel nach 5 Passagen der Kultur, Rest episomalen Plasmiden nicht nachweisbar sind. Somit fast alle der iPSC Kolonien Passagen über 5 (dh Durchgang 10) fehlen Rest episomalen Plasmiden.
  2. Verwenden genomische DNA aus nicht-transfizierten PB MNCs als negative Kontrolle. In 1,6 pg pEV-OCT4-2A-SOX2 Plasmid in 1 ug negativen Kontroll-DNA zu imitieren Zellen mit einer Kopie von pEV Plasmid pro Zelle.
  3. In 9 & mgr; l PCR-grade Wasser einschließlich 100 ng genomischer DNA und 1 & mgr; l-spezifische Primer (10 & mgr; M jeweils von Vorwärts- und Rückwärts-Primer) in 10 ul Hoch Fidelity PCR Master Mix. Normalisieren der Uhrount von DNA von GAPDH. Verwenden Sie die folgenden Primer für die PCR: EBNA1-F TTTAATACGATTGAGGGCGTCT, EBNA1-R GGTTTTGAAGGATGCGATTAAG, WPRE-F GGTTTAAACGCGTCGACAAT, WPRE-R GTTGCGTCAGCAAACACAGT, GAPDH-F GAGTCCACTGGCGTCTTC, GAPDH-R GACTGTGGTCATGAGTCCTTC.
  4. Inkubieren der Reaktionsmischung bei 98 ° C für 60 s; von 98 ° C für 10 s, 60 ° C für 30 s und 72 ° C für 30 s. Nach 30 Zyklen; die Reaktion bei 72 ° C für 5 min verlängern.
  5. Last 5 & mgr; l PCR-Produkte in jeder Vertiefung einer 1% igen Agarosegel. Führen Sie das Gel für 20 - 30 min bei 100 V die iPS-Klone Wählen Sie mit einer nicht nachweisbaren Banden für EBNA1 und WPRE für die weitere Kultur und Downstream-Analyse.

8. Flow Cytometry

  1. Ernte iPSCs indem sie mit Accutase bei 37 ° C für 3 Behandlung - 5 min eine Einzelzellsuspension zu erhalten. 1 & mgr; l PE-konjugiertem anti-TRA-1-60 oder eFluor 570-konjugiertem anti-SSEA4 oder isotypische Antikörper auf 100 ul der Zellsuspension (1 - 5 x 10 5 Zellen) In 5 ml-Röhrchen. Die Röhrchen in einem dunklen Ort bei RT für 20 min.
  2. Nach der Färbung bei RT für 20 min, 2 mL PBS und Zentrifuge bei 400 xg für 5 min. Die Zellen in 300 & mgr; l PBS für fluoreszenzaktivierte Zellsortierung (FACS) Analyse eine Durchflusszytometrie Zell Analyzer. 23,26

9. Die konfokale Imaging

  1. Seed iPSCs in Matrigel beschichtete Kammer gleitet.
  2. Nach 3 bis 4 d der Kultur, das Wachstumsmedium zu entfernen und zu beheben mit 4% Paraformaldehyd (PFA) bei RT für 30 min. Wasche die Zellen zweimal mit PBS.
    Hinweis: PFA giftig und schädlich ist.
  3. Behandlung der Zellen mit 0,1% Triton X-100 in PBS (PBS-T) bei RT für 30 min. Wasche die Zellen zweimal mit PBS.
  4. Blockieren der Zellen mit Blockierungspuffer (5% Ziegenserum in PBS, V: V) bei RT für 1 h.
  5. Während der Blockierungsschritt, verdünne den primären Antikörper (100x) in Blocking-Puffer.
    HINWEIS: Die Antikörper Informationen werden in der Tabelle der Materialien aufgeführt / Ausrüstung.
  6. Inkubiere Zellen mit verdünntem Antikörper bei 4 ° CO / N.
  7. Zweimal waschen mit PBS-T für 15 min, gefolgt von zweimal mit PBS für 15 min.
  8. Inkubiere Zellen mit einer verdünnten Fluorophor-konjugierten sekundären Antikörper bei RT für 2 h.
  9. Wasche die Zellen zweimal mit PBS-T für 15 min, gefolgt von zweimal mit PBS für 15 min.
  10. Beflecken den Kern mit DAPI (1 ug / ml) in PBS bei RT für 10 min.
  11. Wasche die Zellen zweimal mit PBS für 15 min.
  12. Zum Aufzeichnen von Bildern mit einem konfokalen Mikroskop. 23,27

10. Teratoma Assay

Ernte 1 x 10 6 iPSCs mit Zellentfernungslösung (0,5 mM EDTA in PBS) und resuspendieren Zellen in 200 & mgr; l DMEM / F12 , verdünnt (1: 1) Matrigel.

  1. Subkutan-Zellen in den hinteren haunch von NOD / SCID immundefizienten Mäusen injiziert.
  2. Bei 8 - 12 Woche nach iPSC Injektion, sezieren und Teratome in 10% Formalin fixieren. 28
  3. Nach Mikroabtrennen undAnfärben mit Hämatoxylin und Eosin (H & E), zu analysieren Proben. 29

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Unter Verwendung dieses Protokolls können wir Hunderte von Kolonien erhalten , von 1 x 10 5 nucleofected PB MNCs (1A und 1B). Die Umprogrammierung Wirkungsgrad beträgt etwa 0,2 bis 0,5% und die Kolonien exprimieren Pluripotenz Marker (1C und 1D). erzeugt iPSCs sind die beschriebenen Protokoll Integration frei und haben die Fähigkeit , teratoma die drei Keimblätter (Figuren 1E und 1F) Komponieren zu bilden.

Abbildung 1
Abbildung 1: Erzeugung von Integration freien iPSCs von peripheren mononukleären Blutzellen. (A): Eine schematische Darstellung des Protokoll zum Umprogrammieren peripheren Blutzellen. (B): AP - Färbung in der Masse (links) und eine typische ESC-ähnliche iPSC Kolonie (rechts)60; 14 d nach PB MNU Nukleofektion. Maßstabsbalken: 100 & mgr; m. (C): Repräsentative FACS Diagramme von iPS - Zellen bei Passage 5 zum Ausdruck TRA-1-60 oder SSEA4. (D): Repräsentative konfokale Bilder von iPS Kolonien exprimieren NANOG und OCT4. Maßstabsbalken: 100 & mgr; m. (E): Repräsentative Bild des Gesamtbildes und H & E - Färbung von teratoma bestehend aus allen drei Keimblätter. Maßstabsbalken: 100 & mgr; m. (F): Kopieren Sie Zahlen von Rest EV Plasmide in iPS - Zellen nach fünf Passagen. Spezifische Primer für EBNA1 und WPRE wurden verwendet, episomale Vektoren zu amplifizieren. GAPDH wurde als DNA-Ladekontrolle verwendet. UD, nicht nachweisbar. Die positive Spur zeigt eine Ein-Kopierkontrolle. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Der Erwerb von Blutproben von gesunden Spendern oder Patienten ist bequem und nicht-invasive, es eine attraktive Zellquelle für die Grundlagenforschung und klinische Zelltherapie zu machen. Hier haben wir ein Protokoll für die hocheffiziente Erzeugung von Integration freien iPSCs aus peripheren Blutproben beschrieben. Das reproduzierbare und kostengünstige Ansatz sollte das iPSC Bereich profitieren.

Wir haben berichtet , dass es zwei kritische Faktoren , die für die hocheffiziente PB Umprogrammierung 30. Man ist äquimolare Expression von OCT4 und SOX2 durch eine 2A - Linker 31 verwendet wird . Um dies zu erreichen, ist pEV-OCT4-2A-SOX2 in diesem Protokoll verwendet. Die andere ist die Verwendung von zwei Plasmiden pEV-MYC und pEV-KLF4 MYC und KLF4 anstelle von pEV-MYC-2A-KLF4 zu exprimieren , die wir bisher 30 verwendet haben. Die scheinbar einfache Änderung führt zu einer etwa 100-facher Anstieg in PB Umprogrammierung Effizienzen, die zu einer allmählichen und eine größere Erhöhung der MYC weitgehend zurückzuführen ist: KLF4-Verhältnis im Verlauf des Prozesses.

Einige Punkte sollten für die Erreichung hoher Effizienz iPSC Generation von PB in Betracht gezogen werden. PB MNU sind kultiviert ~ 1 Woche im erythroiden Medium, das Zellen - Proliferation und Expansion von erythroiden Vorläufer fördert und erhöht somit die Umprogrammierung Effizienz 20. Bei einigen Proben, insbesondere für Blutzellen von Leukämie-Patienten, Zellen überleben schlecht, wenn sie in erythroiden Medium. In diesem Fall wäre es hilfreich, Kultivierungszeit zu verringern. Es wird auch aufgefordert, mit 1 - 2 ug pmaxGFP Vektor zur Überprüfung der Nukleofektion Wirkungsgrad, der größer als 50% sein sollte. Darüber hinaus ist das Plasmid Qualität wichtig. Es wird empfohlen , die Plasmide ohne Endotoxinkontamination zu verwenden (dh Endo-freie Plasmid Maxi Kit unter Verwendung von Plasmiden zu extrahieren). Schlechte Plasmid Qualität können zu einem signifikanten Zelltod führen und damit eine Anpassung Effizienz reduzieren. Wir und andere haben gezeigt, dass Hypoxie promot gezeigtES iPSC Generation 14,32. Wir spülen die Hypoxie Kammer mit einem Gasgemisch , bestehend aus 92% N 2, 5% CO 2 und 3% O 2. Wenn Normoxie stattdessen verwendet wird, kann ein bis zu 80% ige Verringerung der Umprogrammierung Effizienz beobachtet werden. Sobald die Neuprogrammierung vollständig ist, kann iPSCs in einem regelmäßigen befeuchteten 5% CO 2 -Inkubator kultiviert werden. Wenn Medium ändern, ist es praktisch , eine kleine Menge an verbrauchtem Medium (dh 500 & mgr; l pro Vertiefung in einer 6-Well - Platte), zu verlassen und dann frisches Medium hinzu. Ändern Sie nur das Medium jeden zweiten Tag während der Umprogrammierung, da zu häufige Mediumwechsel kann iPSCs Generation 33 zu reduzieren.

Das neue Protokoll wir entwickelt haben, hat eine High-Level-PB Umprogrammierung erreicht, die der SV Umprogrammierung System vergleichbar ist. Das EV-System hat mehrere offensichtliche Vorteile. Zum einen ist EV günstiger als SV. Das EV-System kann auch weiter durch die Einbeziehung zusätzlicher Faktoren modifiziert werden, oder verschiedene Kombinationen von mehreren Faktoren ab, während die SVs Vektoren sind ein kommerzielles Produkt, das von den Forschern kann nicht geändert werden. Unser aktuelles Protokoll beinhaltet die Verwendung von MEF Feeder - Zellen und tierischen Ursprungs Produkte, die die klinischen Anwendungen einschränken kann, kann aber leicht durch weitere Protokollentwicklung 34,35 entfernt werden.

iPS-Zellen mit diesem System erzeugt wird, kann verwendet werden, nicht nur für Krankheitsmodelle und Wirkstoff-Screening, sondern auch für die klinische Therapie, da die GMP-Ebene EV Plasmide leicht erzeugt werden kann und keine iPSCs mit erheblichen EV Integration identifiziert wurde. In klinischen Anwendungen beherbergen Patientenzellen üblicherweise eine krankheitsauslösenden Gens, das in den iPSCs vor Differenzierung in funktionelle Zellen für die Therapie korrigiert werden muss. Ein kürzlich veröffentlichter Bericht zeigte , dass die EV Umprogrammierung System kann leicht mit dem CRISPR / Cas9 System integriert werden 36 gleichzeitige Neuprogrammierung und Genom Bearbeitung nach einer einfachen Nukleofektion zu erreichen. Das ist einnother Vorteil EV über den SV-System. Unsere nicht veröffentlichte Daten haben, dass bis zu 20% Genome Editing Effizienz gezeigt erreicht werden, wenn Genom Bearbeitung auf EV Umprogrammierung Huckepack. Es ist unsere Hoffnung, dass die Integration von PB Umprogrammierung mit CRISP / Cas9R Genom Bearbeitung mögliche Anwendungen bei der Behandlung von mehreren Krankheiten haben können, die ansonsten unheilbaren in den kommenden Jahrzehnten sind.

Zusammenfassend sollten unsere verbesserte periphere Umprogrammierung Protokoll Blutzellen nützlich sein, um ein breites Spektrum von Forschern in der Grundlagenforschung und klinische Anwendungen. Diese effiziente EV Umprogrammierung System kann auch verwendet werden, nach Modifikationen, Integration freien Mesenchymale Stammzellen (MSCs) 37, oder Neuronale Stammzellen (NSC) 38 direkt aus adultem peripheren Blutzellen zu erzeugen , ohne durch einen iPSC Stufe vorbei.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics