Bitki Protoplastlarından mRNA İnteraktom Yakalama

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Burada, Arabidopsis thaliana yaprak mezofil protoplastlarına uygulanan bir etkileşimli yakalama protokolünü sunuyoruz. Bu yöntem kritik olarak in vivo UV çapraz bağlanmaya dayanır ve fizyolojik bir ortamdan bitki mRNA'ya bağlanan proteinlerin izole edilmesine ve tanımlanmasına izin verir.

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

RNA bağlayıcı proteinler (RBPler) RNA'ların kaderini belirler. Bütün RNA biyogenez yollarına katılırlar ve özellikle haberci RNA'ların (mRNA'lar) post-transkripsiyonel gen regülasyonuna (PTGR) katkıda bulunurlar. Son birkaç yılda, maya ve memeli hücresi soylarından elde edilen bir dizi mRNA'ya bağlı proteom, "mRNA etkileşimli yakalama" adı verilen ve mRNA'ya bağlanan proteinlerin (mRBP'lerin) tanımlanmasına izin veren yeni bir yöntem kullanılarak başarıyla izole edilmiştir. Doğrudan bir fizyolojik ortamdan. Yöntem in vivo ultraviyole (UV) çapraz bağlama, oligon (dT) boncuklar ile haberci ribonükleoprotein komplekslerinin (mRNPs) aşağı çekilmesi ve saflaştırılması ve ardından kütle spektrometresi (MS) ile çapraz bağlanmış proteinlerin tanımlanmasından oluşur. Çok yakın bir tarihte, aynı yöntemi uygulayarak, çeşitli Arabidopsis doku kaynaklarına eşzamanlı olarak birkaç bitki mRNA'ya bağlı proteom rapor edilmiştir: etiyole edilmiş fideler, yaprak dokusu,Yaprak mezofil protoplastları ve kültür kökü hücreleri. Burada, Arabidopsis thaliana yaprak mezofil protoplastları için optimize edilmiş mRNA etkileşimli yakalama yöntemini sunuyoruz. Bu hücre türü, çeşitli hücresel tahliller içeren deneyler için çok yönlü bir araç olarak hizmet etmektedir. Optimum protein verimi için koşullar, başlangıç ​​dokusu miktarını ve UV ışınlama süresini içerir. Orta ölçekli bir deneyden (10 7 hücre) elde edilen mRNA'ya bağlı proteomda, RNA bağlama kapasitesine sahip olduğu kaydedilen RBP'lerin aşırı temsil edildiği bulundu ve birçok yeni RBP tespit edildi. Deney ölçeklenebilir (10 9 hücre) ve optimize yöntem, bitkilerdeki mRNA bağlı proteomları geniş ölçüde izole etmek, kataloglamak ve karşılaştırmak için diğer bitki hücre tiplerine ve türüne uygulanabilir.

Introduction

Ökaryotlar, hücresel biyolojik süreçleri korumak için çoklu RNA biyogenez düzenleyici yollarını kullanır. Bilinen RNA türleri arasında mRNA çok çeşitlidir ve proteinlerin ve izoformlarının kodlama kapasitesini taşır 1. PTGR yolu, pre-mRNA'ların 2 , 3'ün kaderini yönlendirir. Farklı gen ailelerinden RBP'ler RNA regülasyonunu kontrol eder ve PTGR'da spesifik mRBPler mRNA'ları doğrudan fiziksel etkileşimler yoluyla yönlendirerek fonksiyonel mRNA'ları oluştururlar. Bu nedenle, tanımlanması ve mRBPs karakterize ve mRNPs son üç yıl .Over hücresel mRNA metabolizması 2 düzenleme anlamak için kritiktir, çeşitli in vitro yöntemler - RNA elektroforetik mobilite kayma (Remsa) analizleri, üstel zenginleştirme deneyleri ile ligandların sistematik evrimi dahil olmak üzere (SELEX), kütüphane türevli yapılara, RNA Bind-n-Seq (RBNS), radyoaktif işaretlenmiş veya nicelikselFloresan RNA bağlama deneyleri, X-ışını kristalografisi ve NMR spektroskopisi 4 , 5 , 6 , 7 , 8 , 9 - esas olarak memeli hücrelerinden RBP çalışmalarına uygulanmıştır. Bu memeli RBP çalışmalarının sonuçları, yayınlanmış gözlemleri toplayan RNA-bağlayıcı Protein Veri Tabanı (RBPDB) vasıtasıyla aranabilir ( 10) .

Bu in vitro yaklaşımlar güçlü araçlar olmasına rağmen, belirli bir RNA dizisi havuzundan bağlı RNA motiflerini belirler ve bu nedenle yeni hedef RNA'ları keşfetme yetenekleri sınırlıdır. Aynı şey, protein dizisinin ve yapısının 15 korunmasına dayanan genom çapında RBP'leri öngörmek için hesaplama stratejileri için de geçerlidir. Bunun üstesinden gelmek için, yeni bir deneysel yöntem haBir RBP'nin etkileşime girdiği RNA motiflerinin tanımlanmasına ve bağlanmanın tam yerinin belirlenmesine izin veren bir dizi kurulmuştur. "Çapraz bağlama ve immüno çökeltme" (CLIP) adı verilen bu yöntem, in vivo UV çapraz bağlanma ve ardından immüno çökeltme 11'den oluşur . Erken yapılan çalışmalar, DNA ve RNA nükleotidlerinin fotoaktifleşmesinin, 245 nm'den daha yüksek uyaran UV dalga boylarında oluşabileceğini göstermiştir. 12: timidin ile reaksiyonu (dT ≥ dC> rU> Re, dA, dG azalma photoreactivity sırasına göre sıralama) tercih görünüyor. 254 nm dalga boyunda (UV-C) UV ışığı kullanarak RNA nükleotidleri ve protein kalıntıları arasındaki kovalent bağların sadece birkaç Angstrom (Å) aralığında oluştuğu gözlemlendi. Dolayısıyla fenomen, RNA ve RBP'nin "sıfır uzunluklu" çapraz bağlanması olarak adlandırılır. Bunu takiben katı bir arındırma işlemi izlenebilir Az arka planla dür 13 , 14 .

CLIP'i tamamlayan bir strateji, RBP'lerin manzarasını tanımlamak için protein tanımlaması ile in vivo UV çapraz bağlamayı birleştirmektir. "MRNA etkileşimli yakalama" adı verilen bu yeni deneysel yaklaşımı kullanarak maya hücrelerinden, embriyonik kök hücrelerden (ESC'ler) ve insan hücre çizgilerinden ( örn., HEK293 ve HeLa) izole edilmiş bu tür genom çapında mRNA'ya bağlı proteomlar 18 , 19 , 20 , 21 . Yöntem in vivo UV çapraz bağlanma, ardından mRNP saflaştırması ve MS tabanlı proteomiklerden oluşur. Bu stratejiyi uygulayarak, kanonik olmayan RBD'ler içeren birçok yeni "ay ışığı alan" RBP keşfedildi ve daha fazla proteininin önceden tahmin edildiğinden daha fazla RNA bağlama kapasitesine sahip olduğu netleşti."> 15 , 16 , 17. Bu yöntemin kullanılması yeni başvurulara ve RBP'leri araştırırken yeni biyolojik soruları cevaplama yeteneğine izin verir Örneğin son zamanlarda yapılan bir araştırma mRNA'ya bağlı proteomun (ana RBP) korunmasını araştırmıştır Proteom) maya ve insan hücreleri arasında 22 .

Bitki RBP'leri, büyümede ve gelişmede ( örneğin , çiçeklenme zamanının transkripsiyon sonrası düzenlenmesinde, sirkadyere ait saatte ve mitokondriyum ve kloroplastlarda gen ifadesi gibi) 24 , 25 , 26 , 27 , 28 , 29 . Dahası, abiyotik streslere ( örn. Soğuk, kuraklık, sönümlenme) yanıt veren hücresel süreçlerde işlevleri yerine getirdiği düşünülmektedirLinity ve absisik asit (ABA)) 31 , 32 , 33 , 34'tür . Arabidopsis thaliana genomunda RNA tanıma motifi (RRM) ve K homoloji (KH) alan dizisi motiflerine dayanan 200'den fazla tahmini RBP geni vardır; Pirinçte yaklaşık 250, 35 , 36 olarak kaydedildi. Birçok tahmin RBPS birçok yeni fonksiyonlara hizmet verdiği düşündüren 35 (RRM alanını içeren tahmin Arabidopsis RBPS yaklaşık% 50'ye örneğin hiçbir metazoan ortologlarıyla) bitkilere özgü olduğu söylenemez dikkat çekicidir. Tahmini RBP'lerin çoğu işlevleri tanımlanmamış halde kalır 23 .

Arabidopsis etiylü fidelerden, yaprak dokusundan, kültür kök hücrelerinden ve yaprak mezofil protoplastlarından mRNA'ya bağlı proteomların izolasyonu,mRNA interaktom yakalama geçenlerde, 39 38 bildirilmiştir. Bu çalışmalar, yakın gelecekte bitkilerde fonksiyonel RBP'lerin sistematik olarak kataloglanmasının güçlü potansiyelini ortaya koymaktadır. Burada, bitki protoplastlarından ( yani, hücre duvarları olmayan hücrelerden) mRNA interaksiyonu yakalamak için bir protokol sunuyoruz. Arabidopsis thaliana yaprak mezofil protoplastları, en önemli yaprak hücresi türüdür. İzole edilmiş protoplastlar, UV ışığının hücrelere en iyi şekilde erişilmesine izin verir. Bu hücre tipi, fonksiyonel karakterizasyon için proteinleri geçici olarak ifade eden tahlillerde kullanılabilir 40 , 41 . Ayrıca protoplast, birkaç diğer bitki hücre türüne ve tür 42 , 43 , 44'e uygulanmıştır ( örneğin, Petersson ve diğerleri , 2009; Bargmann ve Birnbaum, 2010; ve Hong ve ark ., 2012).

<P class = "jove_content"> Yöntem toplam 11 basamağı kapsamaktadır ( Şekil 1A ). Arabidopsis yaprak mezofil protoplastları önce izole edilir (aşama 1) ve sonra çapraz bağlanmış mRNP'leri oluşturmak için UV ışınlarına maruz bırakılır (aşama 2). Protoplastlar denatüre edici şartlar altında parçalandığında (basamak 3), çapraz bağlanmış mRNPler liziz / bağlama tamponunda serbest bırakılır ve oligo-d (T) 25 boncuklar tarafından çekilir (adım 4). Sıkı yıkamalar birkaç tur sonra, mRNPs saflaştırılmış ve daha da analiz edilir. MRBP'lerin denatüre peptitleri, çapraz bağlı mRNA'lar saflaştırılmadan ve RNA kalitesi qRT-PCR ile doğrulanmadan önce proteinaz K ile sindirilir (adımlar 5 ve 6). RNaz işlemi ve protein konsantrasyonundan (7. adım) sonra, protein kalitesi SDS poliakrilamid jel elektroforezi (SDS-PAGE) ve gümüş boyama (adım 8) ile kontrol edilir. Protein band örüntülerindeki fark, çapraz bağlı bir numune (CL) ile çapraz bağlanmamış bir numune (CL olmayan;UV ışınlamasına tabi tutulmayan protoplastlardan gelen negatif kontrol örneği). Proteinlerin tanımlanması, MS tabanlı proteomikler aracılığıyla gerçekleştirilir. CL örneğinden gelen proteinler olası arka plan kontaminasyonunu gidermek için tek boyutlu poliakrilamid jel elektroforezi (1D-PAGE) ile ayrılır, tripsin kullanılarak kısa peptidlere "in-jel ile sindirilir" ve saflaştırılır (adım 9). Nano ters faz sıvı kromatografisi, kütle spektrometrisine (nano-LC-MS) bağlı olarak, mRNA'ya bağlı proteomdaki kesin protein miktarının belirlenmesine olanak tanır (basamak 10). Son olarak tanımlanan mRNA'lar, biyoenformatik analiz (adım 11) kullanılarak karakterize edilir ve kataloglanır.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Arabidopsis Yaprak Mezofil Protoplast İzolasyonu

NOT: Arabidopsis yaprak mezofil protoplastları, Yoo ve diğerleri , 2007 tarafından çeşitli dönüşümleri 40 ile tarif edildiği gibi temel olarak izole edilir.

  1. Bitkilerde büyüme
    1. Tabakalaşma için yaklaşık 200 Arabidopsis thaliana Col-0 ekotip tohumlarını sterilize edilmiş suda 4 ° C'de karanlıkta 2 gün süreyle bekletin.
      NOT: Bu tohum sayısı bir CL olmayan örnek ve bir CL örneği için yeterlidir (adım 1.3'e bakın).
    2. Kapları% 50 ( v / v ) toprak ve vermikülit karışımı ile hazırlayın ve toprağı ıslatmak için kapları damıtılmış su ile bir tepside bekletin.
    3. Katmanlı tohumları ıslak toprakta toplayın ve dağıtın. Arabidopsis tohumlarının çimlenmeye ışık tutması gerektiği için tohumları ek toprakla kaplamayın.
      NOT: Bitki büyüme koşulları 23 ° C'de 12 saat aydınlık / 12 saat karanlık döngüsüdür,Çiçeklenme öncesi 5 hafta boyunca bir büyüme odasında 100 μmol m -2 s -1 ışık şiddeti ile. 4 haftalık bitkiler de kullanılabilir 40 .
      NOT: Adım 1.2.1 ila adım 3.2.3'teki tüm açıklanan malzemeler ve reaktifler, iki örnek için ( yani bir CL olmayan numune (UV-C ışınlamasına tabi tutulmayan kontrol örneği) ve bir CL örneğinde (araştırma UV-C radyasyona maruz bırakılan numune)).
  2. İzotonik enzim çözeltisinin hazırlanması
    1. 80 mL primer izotonik enzim solüsyonu (400 mM manitol, 20 mM KCl ve 20 mM MES tampon (pH 5.7)) haline getirin ve 10 dakika boyunca 60 ° C inkübatörde çözeltiyi hemen ısıtın.
    2. 1.2 g Selülaz R10 ( w / v % 1.5) ve 0.32 g Macerozyme R10 ( w / v % 0.4) tozu, sıcak primer izotonik enzim solüsyonuna ilave edin.
    3. Nazikçe karıştırarak enzim tozu özenle çözeltiye getirin. tıklatmaEnzim solüsyonu açık kahverengi oluncaya kadar, 60 ° C'lik inkübatörde boşa ısıtın, 10 dakika kadar ısıtın.
    4. Çözeltiyi 3 dakika boyunca buzda soğutun ve çözeltiye 800 μL 1 M CaCl 2 ve 800 μL% 10 ( a / a ) BSA ilave edin.
    5. Pipetleme ve 0.22 um'lik bir filtreyle filtreleme ile çözeltiyi homojen hale getirin. Bu nihai izotonik enzim solüsyonunu iki büyük ölçekli Petri tabağına (150 mm x 20 mm) alın.
  3. Arabidopsis rozet yaprak şeritlerinin hazırlanması
    NOT: Her bir Petri kabı için 150 yaprak, bir CL olmayan numune veya bir CL örneği için önerilir.
    1. Yeni ve keskin bir tıraş bıçağı kullanarak 0.5 ila 1 mm arasında yaprak şeritler halinde toplam 300 genişletilmiş 2. veya 3. sıra gerçek yaprakları (ortalama: rozet başına 3-4) seçin ve kesin.
    2. Şeritleri hemen izotonik enzim solüsyonuna aktarın ve daldırın.
      NOT: Işıkla temas etmesini önlemek için, daima tO Petri yemekleri alüminyum folyo ile. Yaprakları ezme. Tüm şeritlerin çözeltiye battığını ve yüzeyde yüzmediğini doğrulayın.
  4. Arabidopsis yaprak mezofil protoplastlarının izolasyonu
    1. Alüminyum folyo kaplı Petri kaplarını vakum desikatörlerine yerleştirin ve 30 dakika süreyle yaprak şeritlerine vakum altında sızdırın. Ardından, Petri kaplarını 2.5 saat boyunca oda sıcaklığında çalkalanmadan karanlıkta inkübe edin.
    2. Yavaşça ve kısaca bulaşıkları elle yatay olarak sallayın, protoplastları enzim çözeltisine tamamen boşaltmaya çalışın.
  5. Protoplastları toplamak ve saymak
    1. Protoplast süspansiyonu 35 ila 75 μm'lik naylon örgü vasıtasıyla filtreleyin. Her numunenin süzüntüsünü iki 50 mL yuvarlak tabanlı tüpe (her tüpte yaklaşık 20 mL filtrat) alete bırakın.
    2. Her bir Petri kabını 10 mL W5 tamponu (154 mM NaCl, 125 mM CaCl
    3. Protoplastları peletlemek için dört tüpe 100 xg'de 5 dakika döndürün. Süpernatantı atın ve her tüpteki protoplast pelletlerini yavaşça 10 mL W5 tamponu ile tekrar süspanse edin.
      NOT: Protoplast pelletlerini tekrar askıya alırken, tüpü ters çevirerek hafifçe ters çevirin ve peletler kaybolana kadar tüpü hafifçe elle döndürün. Hücrelerin zarar görmesini önlemek için pelleti doğrudan doğruya pipetle göndermeyin.
    4. Adım 1.5.3'ü bir kez tekrarlayın ve her bir numunenin iki tüpünden alınan protoplast süspansiyonunu bir adet 50 mL'lik yuvarlak tabanlı tüpe birleştirin. Tüpleri buzda tutun.
    5. Bir hemositometre kullanarak protoplastları sayın.
      Not: 25 küpleri içindeki her 20 hücre ml / 2 x 10 5 protoplast eşittir. 150 yaprak yaklaşık 1 x 107 hücre vermelidir.CL ve CL olmayan örneklerde eşit sayıda protoplasta sahip olacak şekilde modüle edin.
    6. Protoplastları 30 dakika boyunca buzda tutun. Daha sonra tüpleri 100 x g'de 5 dakika döndürün. Süpernatant atılır ve mmg çözeltisinin 20 mL (400 mM Mannitol, 15 mM MgCl2, 4 mM MES tamponu (pH 5.7)) ile, her bir tüp içinde protoplast tekrar süspansiyon.

2. UV ışınlamayla In Vivo mRNA-protein Çapraz Bağlama

NOT: CL olmayan numune tüpünü buz üzerinde tutun. CL örneği derhal UV radyasyona tabi tutulmalıdır.

  1. CL örnek tüpünden 1 x 10 7 hücre içeren protoplast süspansiyonunu yeni büyük ölçekli bir Petri kabına (150 mm x 20 mm) aktarın ve plaka yüzeyini örtmek için 30 mL buz soğuk MMg solüsyonu ilave edin. Nazik pipetleme ile tüm MMg tamponundaki hücreleri yayın. Petri kabını derhal üst kapak olmadan bir UV çapraz bağlama aparatı içine yerleştirin.
    NOT: UV lambası arasındaki yükseklikVe Petri kabı 8 cm'dir.
  2. 254 nm dalga boylu UV ışığı ve 0,00875 W / 1 dk, 3 dakika ya da 5 dakika için cm2 UV yoğunluğu ile örnek ışın tedavisi. Işınlama sonrasında, hızla iki yeni 50 mL yuvarlak tabanlı tüp içine protoplast süspansiyonu alikotu. Kalıbın alt kısmını, protoplastların geri kalanını toplamak için ilave 5 mL buz soğukluğundaki MMg solüsyonuyla yıkayın ve bu hücre süspansiyonunu bu iki tüpe ekleyin.
    NOT: en uygun koşul olarak 1 dakika seçildi. Açıklama Temsilcilik Sonuçlarında bulunabilir .

Denatürasyon Koşulları Altındaki Protoplast Lizizasyonu

  1. Lizizme yönelik protoplast pelletlerinin hazırlanması
    1. CL olmayan numune tüpünü, adım 2'deki iki CL numune tüpü ile birlikte 100 xg'de 5 dakika boyunca döndürün ve süpernatanı atın. CL olmayan numune protoplast topağının tüpünü tekrar buz üzerine yerleştirin.
    2. Her CL numune tüpüne 10 mL buz soğuk MMg solüsyonu ekleyin, genPeletleri tekrar süspansiyon haline getirin ve birer 50 mL yuvarlak tabanlı tüpe geri birleştirin. Boruyu 100 xg'de 5 dakika döndürün. Süpernatantı çıkardıktan sonra, CL örnek tüp protoplastı peletini buz üzerinde tutun.
  2. Protoplast lizisi ve homojenleştirici protoplast lizatı
    1. 9 mL buzda soğutulmuş liziz / bağlama tamponu (500 mM LiCl,% 0.5 ( w / v ) Lityum Dodesil Sülfat (LiDS), 5 mM Ditiyotreitol (DTT), 20 mM Tris-HC1 (pH 7.5) ve 1 mM EDTA (pH 8.0)) her numunenin hücre pelletine eklendi. Süspansiyon homojen olarak açık yeşil olana kadar yaklaşık 20 kez yukarı ve aşağı pipetleyerek protoplastları iyice parçalayın.
    2. Homojenizasyon için dar bir iğne (0.9 x 25 mm x 2) 50 mL'lik bir cam şırınga yoluyla protoplast lizatı, iki kez geçmek. Lizatı 10 dakika boyunca buz üzerinde inkübe edin. Lizatları sıvı nitrojende dondurun ve 3 haftaya kadar -80 ° C'de saklayın.

4. mRNP Çekme ve SaflaştırmaOligo-d (T) tarafından 25 Boncuklar

NOT: Adım 4.1'den adım 4.4'e kadar aşağıda tanımlanan tüm malzemeler ve reaktifler, yalnızca bir örnek ( yani, bir CL olmayan örnek veya bir CL örneği) içindir. Boncuk süpernatantı lizizi / bağlama tamponu atıldıktan sonra protoplast lizat hemen boncuk içeren tüplere eklenmelidir.

  1. Oligo (dT) yakalama için oligo-d (T) 25 manyetik boncukların hazırlanması
    1. Donmuş protoplast lizatını oda sıcaklığında çözdürün. Lizat tamamen eritildiğinde, lizat tüpünü buz üzerinde tutun.
    2. Buz üzerinde 6 yeni 2 mL'lik yuvarlak tabanlı mikro santrifüj tüplerine 1.8 mL oligo-d (T) 25 manyetik boncuk (5 mg / mL) ilave edin. Her bir tüpte boncuk süspansiyonunu kısaca yukarı ve aşağı pipetleme ve hafifçe 4 ° C'de 2 dakika döndürerek 600 μL liziz / bağlama tamponu ile homojen olarak yıkayın. Boncukları buzda tutun.
  2. bağlayıcı
    1. yerTüm 6 tüp, boncukları manyetik bir rafta 4 ° C'de 3 dakika boyunca tutarak, boncukların manyetik olarak tutulması ve süspansiyonun temizlenmesine neden olacak.
      NOT: Tüpler manyetik rafa yerleştirildiğinde, boncuklar tamamen yakalanana kadar bekleyin, en az 3 dakika.
    2. Süpernatantı atın ve hemen bu 6 tüp içine 9 mL protoplast lizat alikotu. Homojen bir kahverengi süspansiyon görününceye kadar pipetle iyice karıştırın ve boncukları protoplast lizat içerisinde 4 ° C'de hafifçe döndürerek 1 saat inkübe edin.
      NOT: 30 dakikadan 1 saate kadar inkübasyon süresi önerilir.
  3. Yıkama
    1. Tüpleri manyetik rafa tekrar 4 ° C'de 3 dakika yerleştirin. Tüm boncuklar tüplerin yan tarafında tutulduktan sonra, protoplast lizatını 6 yeni 2 mL'lik yuvarlak tabanlı mikrosantrifüj tüplerine alın ve geçici olarak 4 ° C'de saklayın. Protoplast lisatını derhal ÇIKARMAYIN; Lisatı tutmak4 ° C'de.
    2. Boncuklara 1.5 mL buz soğukluğunda yıkama tamponu 1 (500 mM LiCI,% 0.1 ( a / h ) LiDS, 5 mM DTT, 20 mM Tris-HC1 (pH 7.5) ve 1 mM EDTA Her tüpte Boncukları tekrar süspanse edin ve 1 dakika boyunca hafifçe döndürün. Tüpleri 4 ° C'de 3 dakika manyetik rafa geri yerleştirin ve süpernatanı atın. Bu yıkama adımını yıkama tamponu ile bir kez tekrarlayın.
    3. 1.5 mL buz soğukluğunda yıkama tamponu 2 (500 mM LiCl, 5 mM DTT, 20 mM Tris-HCl (pH 7.5) ve 1 mM EDTA (pH 8.0)) kullanılarak iki kez aynı yıkama basamağını tekrarlayın ve bir kez 1.5 mL buz soğukluğundaki düşük tuzlu tampon (200 mM LiCl, 20 mM Tris-HC1 (pH 7.5) ve 1 mM EDTA (pH 8.0)).
      NOT: Eğer mRNP'ler protoplast lizattan etkin bir şekilde izole edilmişse yıkama tamponu 2 ile yıkama aşaması sırasında CL örneğinde boncuk taneciği çevresinde görülebilecek bir "halo" olmalıdır ( Şekil 1B ).
  4. elüsyon
    1. 500 mcL ekleHer tüp içindeki boncuklara elüsyon tamponunun (20 mM Tris-HCl (pH 7.5) ve 1 mM EDTA (pH 8.0)) eklenmesi. Boncukları yavaşça tekrar süspanse edin ve poli (A) -tailed RNA'ları serbest bırakmak için 3 dakika 50 ° C'de inkübe edin. Pipetleme ile boncukları bir kez hafifçe tekrar süspanse edin. Tüpleri 4 ° C'de 5 dakika süreyle tekrar manyetik rafa yerleştirin.
    2. Tüm eluentları (toplamda yaklaşık 3 mL) buzda temiz, steril RNaz içermeyen, 15 mL'lik konik alt boruya aktarın ve birleştirin.
      NOT: RNA'nın kalitesi ve miktarı bir spektrofotometre cihazı kullanılarak derhal tespit edilebilir.
      NOT: Her numunenin RNA konsantrasyonu yaklaşık 10 ng / μL, A 260 / A 280 oranı 1.9'dur. A 260 / A 280 oranı 1.6 ve 2.0 arasında olmalıdır, çünkü izole poli (A) -tailed RNA'lar genelde% 70'den daha saftır. RNA konsantrasyonu çok düşükse, başlangıç ​​protoplastlarının sayısını maksimum 10 9'a yükseltin. NumunelerSıvı nitrojende dondurulabilir ve uzun süreli depolamada 80 ° C'de tutulabilir.
    3. Proteoplast lisatından poli (A) kuyruklu RNA'ları boşaltmak için ek bir iki mermi için adım 4.2 ile adım 4.4 arasında tekrarlayın ve oligo-d (T) 25 boncukları tekrar kullanın.
      NOT: Üç tur çekme prosedüründen sonra, CL veya CL olmayan her numune için toplam 9 mL temizleyici olmalıdır. RNA'nın bozulmasını önlemek için tüm çalışmaları 4 ° C'de gerçekleştirin. Boncukları tekrar kullanmak veya yeniden oluşturmak için adım 4.5 veya adım 4.6'yı izleyin.
  5. Yeniden kullanılmış oligo-d (T) 25 boncukların hazırlanması
    1. Boncukları 1 mL buz soğukluğunda elüsyon tamponuyla ve bir kez 500 mL'ye kadar tuz LiCl konsantrasyonunu ayarlamak için 1 mL buz soğukluğunda liziz / bağlama tamponu ile yıkayın.
    2. Adım 4.1'i izleyin, süpernatıttan atın, depolanmış protoplast lizatını her tüpe aktarın ve tüm prosedürü adım 4,2'den adım 4'e ilave bir iki tur daha tekrarlayın.
  6. 25 boncukların yenilenmesi
    NOT: Boncuklar depolanabilir ve başka bir deney için kullanılabilir (maksimum tekrar kullanım üç kere).
    1. Adım 4.4'ü uygulayın, boncuklara 1 mL 0.1 M NaOH ilave edin ve 5 dakika oda sıcaklığında döndürerek inkübe edin. Her bir tüp için, dengeleme için% 0.1 Tween-20 içeren 1x PBS (pH 7.4) ile yıkama tamponu 1 ve yıkama tamponu 1 mL ile iki kez yıkayın. Her tüpteki boncukları, 4 ° C'de% 0.1 Tween-20 içeren steril RNaz içermeyen 1x PBS (pH 7.4) 300 μL'de uzun süre saklama için tutun.
      NOT: Bu deneyde Arabidopsis CL örnekleri için kullanılan boncuklar, bir dahaki sefere aynı bitki örnekleri için kullanılabilir.

5. Proteinaz K Tedavisi ve mRNA Saflaştırması

  1. Proteinaz K tedavisi
    1. UV ile çapraz bağlanmış proteinleri sindirmek için her bir numunenin 1 mL'lik yıkayıcıya 8 uL Proteinaz K çözeltisi (2 μg / μL) ekleyin. brSanki vorteks.
  2. MRNA saflaştırması
    1. Eluenti 37 ° C'de 1 saat inkübe edin. Kalıntı kirleticileri çıkarmak için RNA arıtma kitini kullanarak RNA'yı arındırın.
      NOT: Saflaştırmadan sonra RNA'lar, qRT-PCR testini kullanarak RNA kalite testi için hazırdır.
      NOT: RNA mini kiti ve TRIzol reaktifi gibi diğer kitler de kullanılabilir 14 .

6. qRT-PCR Testi

  1. Ters transkripsiyon
    1. Birinci iplikcik cDNA'sının, ters transkripsiyon sistemi kullanılarak, 1 μg RNA'yı şablon olarak verimli bir şekilde sentezlemesine ulaşın. Numuneyi nükleaz içermeyen su ile 5 ng / μL'ye seyreltin.
  2. QRT-PCR kullanılarak cDNA kantifikasyonu
    1. Şablon olarak 10 ng cDNA ile qPCR master karışımı ve gerçek zamanlı PCR cycler kullanarak cDNA'yı genişletin ve ölçün. Aşağıdaki PCR programını kullanın: 95 ° C'de 10 dakika(Evre 1, bir döngü) ve 15 saniye boyunca 95 ° C ve 1 dakika süreyle 60 ° C'de (evre 2, 40 döngü) gerçekleştirildi.
      NOT: Burada kullanılan referans geni, endojen bir iç kontrol geni olan UBQ10 (AT4G05320) idi. UBQ10 ve 18S rRNA için qRT -PCR primerleri Li ve diğerleri , 2014 ve Durut ve diğ ., 2014, sırasıyla 45 , 46'da tarif edilmiştir. Primer sekanslar Malzeme Tablosunda listelenmiştir.

7. RNase Tedavisi ve mRBP Konsantrasyonu

  1. RNase tedavisi
    1. RNaz A ve RNase T1 içeren yaklaşık 100 U RNaz kokteylini 8 mL'lik eluent içine ilave edin. Eluent'ın yerini nükleaz içermeyen su ile değiştiren RNase kokteyli ile bir negatif kontrol örneği ekleyin. Kısaca vorteksleyin ve 1 saat boyunca 37 ° C'de inkübe edin.
  2. MRBP konsantrasyonu
    1. RNaz sindiriminden sonra eluent'u konsantre ediniz.G santrifüj filtre üniteleri. Son hacim, 75 μL'dir ve konsantrasyondan sonra her bir örnekteki toplam protein verimi yaklaşık 2 ug'dir. Numuneleri, uzun süreli saklama için -80 ° C'ye yerleştirin.

8. SDS-PAGE ve Gümüş Boyama

  1. SDS-PAGE
    1. 15 μL 2x yükleme boya ile 25 μL konsantre eluent (CL örneği) veya kontrol örneği (CL olmayan örnek) karıştırın. Numuneyi 5 ° C'de 95 ° C'de ısıtın ve bir protein markörü de dahil olmak üzere% 5 yığın jeli ve% 12 çözünen jel içeren bir SDS-PAGE jeline yükleyin.
    2. Proteinleri 40 dakika boyunca 60 V'da yoğunlaştırın ve yükleme boyası çözülmekte olan jelin sonuna ulaşana kadar yaklaşık 1 saat 160 V'de ayrın.
  2. Gümüş boyama denemesi
    1. SDS-PAGE jelini her seferinde 5 dakika süreyle ultra saf su ile yıkayın. Ticari bir gümüş leke kiti kullanarak proteinlerin gümüş boyasını gerçekleştirin.
      NOT: Protein bantları 5 dakika içinde gösterilmelidir. Şeritler çok hafif renkte 5 dakikanın ötesinde görülebiliyorsa, başlangıç ​​protoplastlarının sayısını en çok 10 9'a kadar arttırması önerilir.

9. Protein Bantlarının Trypsin Digest ve Peptid Saflaştırılması

  1. Tripsin sindirimi
    NOT: mRBP tanımlaması için her numuneden konsantre mRBP solüsyonundan 25 μL daha alınarak ikinci bir 1D-PAGE jeli çalıştırın; Gümüş boyalı jeller MS analizi ile uyumlu olmadığından kullanılamazlar.
    1. 1D-PAGE jelini çalıştırdıktan sonra, jel sabitleme solüsyonunda (% 50 ( h / h ) metanol ve% 10 ( h / h ) asetik asit) 1 saat süreyle sabitlenir. Jel yumuşak sallama ile 20 dakika boyunca leke çözeltisi (% 0.1 ( w / v ) Coomassie Brilliant Blue R-250,% 50 ( v / v ) metanol ve% 10 ( v / v ) asetik asit) ile leke uygulayın. Destain çözeltisinde jel koyun (% 40 ( h / h ) metanol ve% 10 ( v/ V) asetik asit) ile 1 saat süreyle reaksiyona sokulmuştur. Destinasyondan sonra, jelin% ​​5'lik ( v / v ) asetik asitte muhafaza edilmesini sağlayın.
      NOT: Destination işlemi sırasında arka plan tamamen silinene kadar yeni destain çözümü değiştirilebilir.
    2. Jelden ilgi bantlarını kesin. Daha sonra uygun bir şekilde tripsin emdirme ve peptidlerin ekstraksiyonu için yaklaşık 1 ila 3 mm parçalar halinde daha da bantlar kesilir. 10 dakika boyunca 100 mM amonyum bikarbonat, 50 uL (NH4 HCO3) ile jel parçalarının bütünüyle hidre. Jel parçalarını tamamen örtün.
      1. Dikkatle nemlendirici çözeltisini çıkarın ve 10 dakika boyunca asetonitril (CH3CN) ile jel parçalarının kurutmak. Asetonitril solüsyonunu dikkatlice çıkarın.
      2. İşlemi hidrasyondan dehidrasyona iki kere tekrarlayın. Son olarak, asetonitril solüsyonunu çıkarın.
        NOT: Jel çalışma süresi deneyin amacına bağlıdır. Uzun süreler proteinlerin iyi ayrılmasına izin verir, bu nedenle lekeli jel yasağıDs daha fazla analiz için kesilebilir. Amaç proteinleri tutmak ve kirleticileri uzaklaştırmak ise, kısa bir çalışma süresi yeterlidir.
    3. 6.6 mM DTT solüsyonu 500 mcL ekleyin ve jel parçaları 10 dakika inkübe edin. DTT solüsyonunu çıkarın ve jel parçaları iki kez% 95 ( v / v ) asetonitril çözeltisi ile 500 mcL ile yıkayın.
      1. Yıkadıktan sonra, asetonitril solüsyonunu çıkarın ve jel parçalarını, karanlıkta 10 dakika boyunca 500 mcL 55 mM iyodoasetik asit (IAA) çözeltisi ile inkübe edin.
      2. İnkübasyondan sonra çözeltiyi çıkarın ve jel parçalarını tekrar% 500 ( v / v ) asetonitril çözeltisi 500 mcL ile yıkayın. Jel parçalarını kurutun.
    4. Jel parçalarını 25 uL sindirim tamponu (50 mM NH 4 HCO 3 , 5 mM CaCl 2 ve 6 ng / μL tripsin) ile tamamen gömün ve tripsin jel içine nüfuz etmek için 45 dakika boyunca buz üzerinde tutun. Jel parçaları gece boyunca 37 ° C'de inkübe edin. Zimatik sindirim.
  2. Peptit arıtımı
    1. Sindirim tamponundaki jel parçalarına 80 mcL 50 mM NH 4 HCO 3 ilave edin ve triptik peptitleri çıkarmak için art arda girdaplayın. Ekstraktı toplayın. % 50 80 uL (h / h) CH3CN ve% 5 (h / h) formik asit (FA) ile iki kez ekstraksiyon adımı tekrar edin.
      NOT: Toplam nihai ekstrakt yaklaşık 240 μL olmalıdır.
    2. Özü vakum konsantrasyon veya liyofilizasyon ile ekstraktları yaklaşık 10 uL'ye konsantre edin ve% 25'lik ( v / v ) sulu trifluoroasetik asit (TFA) çözeltisi ilave edin. Üreticinin protokolünü izleyerek numuneleri μ-C18 kolonlarla desalze edin.
    3. 4 peptidleri Zehir -% 60, 10 uL CH3CN ve% 0.1 (h / h) FA (ağırlık / hacim). Peptidleri liyofilize edin (dondurarak kurutun) ve analiz edilinceye kadar -20 ° C'de saklayın.
Başlık "> 10. Nano-LC-MS

  1. Nano ters fazlı sıvı kromatografisi
    NOT: LC-MS analizini, bir sıvı kromatografi cihazı ile çevrimiçi olarak birleştirilen bir kütle spektrometresi ile gerçekleştirin. Bu alet bir C18 sütunu (2 um parçacık, 100 Â gözenek boyutu ve 50 μm x 15 cm boyutunda) ile donatılmalıdır.
    1. Solüsyon 16 uL liyofilize peptidleri yeniden süspanse edin (% 2 (v / v) CH3CN ve% 0.1 (h / h) FA). C18 precolumn (3 μm parçacık boyutu, 100 Â gözenek boyutu, nanoviper ve 75 μm x 2 cm boyutta) üzerinde 5 μL / dak'lık bir akış hızında 5 μL peptit çözeltisi enjekte edin ve yükleyin.
    2. 10.1.2. Peptidleri, 300 nL / dak'lık bir akış hızı ile 95 dakikalık bir degrade kullanarak ayırın. Bu ayırma gradyanında sırasıyla 5 dakika, 50 dakika ve 18 dakika içinde mobil faz B'yi% 4'den% 10'a,% 10'dan% 25'e ve% 25'den% 45'e arttırın. Son olarak, mobil faz B'yi 1 dakika içinde hızla% 95'e yükseltin. SonraHer 95 dakikalık ayırma derecesi, 5 dakika içinde% 4 ila% 95'lik bir 10 dakikalık gradyan içeren özlü bir durulama adımını uygular.
      Not: Mobil faz A 19.92% H2O,% 80% 99.9 H2O ve% 0.1 (h / h) FA ve mobil faz B olduğu CH3CN ve% 0.08 (h / h (ağırlık / hacim) ) FA.
  2. Kütle spektrometri deneyi
    1. Kütle spektrometresini 400 ila 1,600 m / z'lik bir kütle aralığına sahip veri bağımlı modda çalıştırın.
    2. Parçalanma spektrumu oluşturmak için MS1'deki en yoğun iyonlardan on tanesini seçin. Çözünürlüğü, MS1 için 3.000.000 ve 1.000.000 iyon otomatik kazanım kontrolü (AGC) hedefi ve MS1 için 256 ve 64 ms'lik maksimum iyon enjeksiyon süresi (IT) ile MS1 için özdeşliği 70.000 tamsayfa (FWHM) ve MS2 için 17.000 olarak ayarlayın Ve MS2, sırasıyla.
    3. En bol iyonların tekrar tekrar parçalanmasını önlemek için dinamik dışlamayı 10 saniyeye ayarlayın.
      NOT: Burada bir veya daha fazla yük içeren iyonlar eMS2 için xcluded.
  3. Kalitatif proteomik: peptid ve protein tanımlaması
    1. Peaks studio yazılımı 47 , 48 , 49 gibi yazılımları kullanarak parçalanma spektrumlarını analiz edin.
      Not: diğer yazılım paketleri NovoHMM 30 de novo dizileme için PepNovo 37 ve SEQUEST 54 ve veritabanı arama için Mascot 55 gibi, peptid tanımlanması için kullanılabilir.
    2. Spektrumları, aynı kitleyle (<2 ppm fark) ve tutma sürelerini (<2 dak) birleştirin ve model haline getirilen taksonomi için Swiss-Prot veritabanını (sürüm: Aralık 2013) aramak için yalnızca 0.65'den yüksek bir kalite eşiğindeki spektrumları saklayın Bitki Arabidopsis thaliana . Aşağıdaki arama parametrelerini kullanın: Monitör kullanılarak 10 ppm'lik bir öncül toplu toleransOizotopik kütle; Bir parça kütle toleransı 20 mmu; Sindirim enzimi olarak tripsin, en fazla 2 cevapsız bölünme; Sabit modifikasyon olarak sistein karbamidometilasyon; Değişken modifikasyon olarak metiyonin oksidasyonu; Ve peptit başına azami 3 değişken post-translasyonel modifikasyon. Tanımlamanın ardından, yanlış bir keşif oranının (FDR) <% 5 olması için güvenilir peptid ve protein tanımlaması için skor eşiklerini manuel olarak ayarlayın.
  4. Kantitatif proteomik: kütle spektrometresi verilerinin istatistiksel analizi
    1. Proteomik verilerin etiketsiz olarak nicelendirilmesi için LC-MS ( örneğin Progenezis) kullanın.
      NOT: MS1 peptid zirve alanları (veya yoğunluğu), maksimum 10 ppm'de tolere edilen hata ile, kendi kütlelerine göre stüdyo yazılımında tanımlanan peptidlerle bağlantılıdır.
      NOT: Bu yazılım, tüm şarj durumlarının zirve alanlarını 2 <Sup> + ve 8 + . Kantitatif veriler, kurum içi bir senaryo ile PEAKS peptid tanımlamasına bağlıdır (maksimum 10 ppm'lik tolere edilebilen hata ile kütle uyumu).
    2. Her bir peptid için ortalama log2 katlı değişiklikleri (CL / non-CL) hesaplayın. Benzersiz peptidlerin katlanma değişikliklerini protein ile gruplandırın.
      NOT: Her grupta, bir proteinin son kat-değişimi, peptidlerinin ortalama kıvrım değişikliklerine eşittir.
    3. İstatistiksel önemi değerlendirmek için her bir grup için Student's t testi ile p-değerini hesaplayın. Benjamini-Hochberg (BH) yöntemini kullanarak tüm grupların FDR'sinin p değerlerini düzeltmek için R yazılım paketi (sürüm 3.3.0) uygulayın.
    4. Volkan planını, R yazılım paketi (sürüm 3.3.0) ile uyumlu "kalibrasyon" fonksiyon paketini (sürüm 1.7.2) kullanarak çizin.
      NOT: Burada, -log10 tarafından ayarlanan p değerleri (-log10 (adj. P-değeri)), belirlenen tüm proteinlerin log2 katlı değişimlerinin bir fonksiyonudur. ProteinlerLog2 katlı değişiklikleri 2'den büyük ise, mRNA'ya bağlı proteomda pozitif vuruş olarak önemlidir veya önemsiz olarak işlem görürler.

Tanımlanmış mRNA'ya bağlı Proteomun Katalogu

  1. 10. adımdaki tanımlanan proteinleri, Gene Ontology (GO) veritabanı ve InterPro veritabanı üzerinden "aile ve alan" aracılığıyla "moleküler işlevler ve biyolojik süreç" öğelerine dayalı olarak üç kategoriye ayırın.
  2. Kategori I veya "Ribozomal proteinler", tespit edilen tüm ribozomal proteinleri içerdiğinden, RNA'larla etkileşime giren veya RNA biyolojisinde bilinen veya bilinmeyen fonksiyonlarla RNA bağlanmasına eklenen açıklanan protein alanlarını içeren kategori II'den veya "Ana RBP'ler" den tanımlanan proteinleri tanımlar .
  3. RNA biyolojisinde bilinen veya bilinmeyen fonksiyonlara sahip proteinler, açıklamalı RNA bağlayıcı alanlar olmadan kategori III veya "Aday RBP'ler" içine yerleştirildiğinde, I kategorisindeki ek açıklamalara dayanılarak kategori III'ten enzimler tanımlanırNtEnz veritabanı.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

CL örneğinde boncuk taneciklerini çevreleyen, yıkama basamağı 4.3'de yıkama tamponu 2 ile ( Şekil 1B ) karakteristik bir halo gözlemledik. Araştırılmamış olmasına rağmen, bu fenomen manyetik yakalama esnasında boncuk agregasyonu ile çapraz bağlanmış mRNP komplekslerinin etkileşimi ile muhtemelen açıklanabilir ve daha yaygın bir agreganın oluşmasına neden olur. Oligo-d (T) 25 boncuk yakalama etkisinin 14 olduğunu gösterir .

Olmayan CL kontrol ve CL örnekleri hem de 18S rRNA önemli ölçüde daha yüksek UBQ10 referans mRNA seviyeleri Şekil 1C 'de gösterilmiştir. Bu mRNA'ların sadece poli (A) -tailli mRNA'lara bağlanabilen oligo-d (T) 25 boncukların yakalanması nedeniyle eluent içinde zengin olduğunu gösterir. Oligo-d (T) 25 boncuk yakalama verimliliği,RNaz muamelesinden ve mRBP konsantrasyonundan (adım 7) sonra Şekil 1D'de gösterildiği gibi SDS-PAGE ve gümüş boyama (adım 8) ile ortonize edildi. CL olmayan kontrol ve CL örnek şeritleri arasındaki protein bandı modelinde bir fark gözlemlenebilir ve CL kontrol edilmeyen örnek şeritte bulunan protein bantları RNaz'ın varlığı ile açıklanabilir. Bu, CL örneklemindeki mRBP'lerin zenginleşmesini göstermektedir.

Çapraz bağlama verimliliği, UV ışınlama süresinin değiştirilmesiyle kontrol edilebilir. Yeterli çapraz bağlanma, ancak protoplast hasarından ve RNA bozunumundan kaçınılması en iyisidir. Şekil 1D'de farklı UV ışınlama süreleri (1, 3 ve 5 dakika) karşılaştırıldığında tüm CL örneklerinde spesifik protein bandı desenleri elde edilmiştir. Aynı UV yeğinliğinde (0,00875 W / cm2) altında, en uygun şartlar nedeniyle ayırt, özellikle 1 veya 3 dakika olduğu bulunmuşturProtein band yoğunlukları. Daha uzun çapraz bağlanma süresi (5 dakika) ile zayıf bant yoğunlukları gözlenmiştir. Çabuk çapraz bağlanma süresinin daha kısa olması, Petri kabından protoplastların daha kolay transferi ve toplanması gibi ek bir avantaja sahip olduğu için 1 dakika optimum koşul olarak düşünülmüştür. Protoplastlar, UV ışınlaması sırasında, tabağın tabanına yapıştığı için Petri kabının tabanına hızla çökebilir. Bu, daha uzun UV ışınlama süresinden sonra tüpleri toplamak ve onları tüplere aktarmak daha zor hale getirir.

Optimize edilmiş şartlara dayanarak, üç biyolojik replikasyondan proteinlerin tanımlanması, daha sonra 9. ve 10. basamaklarda anlatılan nitel ve kantitatif proteomikler ile gerçekleştirildi. Nitel proteomik analizde ( Şekil 1E , sağda) toplam 341 protein CL örneklerinde tanımlandı; bunlardan 36'sı hem CL kontrolü olmayan hem deD CL örnekleri ve sadece 8 protein CL kontrol edilmeyen örnekte tespit edildi. Her iki numune arasındaki tanımlanan protein sayılarındaki bu muazzam fark, SDS-PAGE ve gümüş boyama testinin, oligo-d (T) randımanının etkinliğini doğrulamak için iyi araçlar olduğu fikrini destekleyen farklı protein bandı modelleriyle tutarlıdır ( Şekil 1D ) 25 boncuk yakalama. Kantitatif proteomik analizde ( Şekil 1E , solda) toplam 325 protein (mavi ve yeşil renkli) log2 katlı bir değişim gösterdi. Bu proteinlerin arasında, 100 protein (mavi renkli) küçük p'ye sahipti Değerler anlamlılık düzeyinin üstünde. Bu nedenle, onlar da pozitif isabet olarak tanımlandı. Dikkat çeken bir başka 225 protein (yeşil renkli) p-değerlerinin, veri seyir sayısına bağlı olarak anlamlılık seviyesinin 0,05'in altında olduğunu göstermektedir. Başka bir deyişle, her protein için düşük miktarda peptit mevcuttu ve peptid intensitenin değişkenliği yüksekties. Bununla birlikte, hepsi nitel olarak sadece CL örneklerinde tespit edildiğinden, bunlar pozitif olarak kabul edildi.

GO ve InterPro veritabanları 50'ye (adım 11) dayanan bu 325 proteinler, kategori I (ribozomal proteinler), kategori II (ana RBP'ler) ve kategori III (aday RBP'ler) olarak sınıflandırılmıştır ( Şekil 1F ). Kategori I'de 123 ribozomal protein vardı, kategori II'de ise 70 asimetrik klasik RBP gözlemlendi. Sırasıyla moleküler RNA bağlanması ve RNA biyolojisi ( Şekil 1F , sağ) ile bağlantılı olan ve tüm mRNA'ya bağlı proteomun yaklaşık% 38'ini ve% 22'sini işgal eden en dikkat çekici proteinleri içeren bu iki kategori, optimize edilmiş mRNA etkileşiminin yüksek verimliliğini göstermektedir ele geçirmek. Son 40% (132 aday RBP), klasik RBD'lerin bulunmaması nedeniyle kategori III'de sınıflandırılmıştır. Dahası, çoğuRNA bağlama ve RNA biyolojik süreçlerinde eir rolleri geçerli değildir ( Şekil 1F , solda). Bu kategorideki proteinlerin RNA düzenlemelerinde yeni fonksiyonları açığa çıkardığını varsayıyoruz.

Şekil 1
Şekil 1: Arabidopsis Yaprak Mezofil Protoplastlarından mRNA'ya bağlı Proteomun Bulunması için Akış Şeması ve Optimize Edilmiş Yöntemin Sonuçları. ( A ) Bütün yöntemin başlıca basamakları 1 ila 11 arasında listelenmiştir. Putative hücresel ve moleküler süreçler fotoğraf ve çizgi filmlerle gösterilmiştir. Her adım için detaylar Protokol'de yoğun olarak tanımlanmıştır. ( B ) yıkama adımı 4.3 sırasında, CL örneğinde boncuk taneciklerini çevreleyen ancak CL kontrollü olmayan numunede olmayan bir halo gözlemlendi. ( C ) göreceli UBQ10 mRNA ve 18S rRNA leve karşılaştırılmasıQRT-PCR ile CL olmayan kontrollerde ve CL örneklerinde ls'dir (değerler ortalama ± SD (n = 3); * ve **: p <0.05 ve <0.01 ile anlamlı farklar). 0,00875 W / cm2 UV yoğunluğu ile 1, 3 ve 5 dakika için bir sürekli-dalga UV kaynağı tarafından aydınlatılan CL örnekleri ile karşılaştırıldığında olmayan CL kontrol numunesi (D) Konsantre proteini yıkama sıvısı. ( E ) Proteomiklere göre mRNA'ya bağlı proteomun tanımlanması. Progenesis yazılım paketi (solda) tarafından gerçekleştirilen kantitatif proteomiklerde, yanardağ grafiği ortalama log2 katlı değişiklikleri (CL / non-CL) ve ilgili ayarlanmış p-değerlerini (-log10 (adj. P-değerleri) gösterir Tüm proteinler. Peaks yazılım paketi (sağda) tarafından gerçekleştirilen kalitatif proteomiklerde, örneklerdeki proteinler Venn şemalarında gösterilmektedir. Proteinlerin miktarı sayılar halinde listelenmiştir. Peptid ve protein seviyelerinde FDR,% 5'in altındadır. Açık kahverengi çerçevelerin içindeki proteinlerin sayısı pozitif isabet sayılır. ( ve diğerleri , 2016'dan değiştirildi. Bu rakamın daha büyük bir sürümünü görmek için lütfen tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Mayalar ve insan hücreleri için geliştirilmiş mRNA etkileşim yakalamasını yaprak mezofil protoplastlarına başarılı bir şekilde uyguladık. Yaprak yapraklarındaki başlıca zımpara türü mezofil hücreleridir. Bu yöntemin en büyük avantajı, fizyolojik bir ortamdan proteinleri keşfetmek için in vivo çapraz bağlamayı kullanmasıdır.

Bu protokolde, esas olarak birtakım optimize edilmiş deneysel koşulları ( örn., Başlangıç ​​materyali olarak kullanılacak protoplastların sayısı ve UV ışınlarının süresi) 50 olarak sunuyoruz. 10 7 protoplast (orta ölçekli) minimum (adım 1.5.5) kullanıldığında CL örnekleri yakalanan proteinler, sadece SDS-PAGE ve gümüş boyama ile saptanabilir. Düşük konsantrasyonlar, SDS-PAGE üzerinde gözlemlenebilir bir mRBP paterni oluşturmaz ve muhtemelen proteomiklerin daha ileri analizleri için kullanılmamalıdır. Gerçekten de, 10'dan fazla 7 hücrenin kullanılması ( örneğin, 10 9 inBüyük ölçekli bir deney) mümkündür 20 . Gümüş boyama tahlillerinden elde edilen sonuçlar 0,00875 W / bir sürekli-dalga UV kaynağı tarafından oluşturulan yoğunluğu cm2 ile 1 dakika boyunca UV-ışını uygun (Şekil 1D) olduğunu göstermektedir. Kritik basamaktaki yüksek verimlilik ( yani, oligo-d (T) 25 boncuklar, adım 4) ile mRNP'nin açılması ve saflaştırılması, RT-qPCR, gümüş boyama ve MS deneylerinin sonuçları tarafından desteklenmektedir ( Şekil 1C ; 1D ve 1E , sağ). Niteliksel ve kantitatif proteomik kombinasyonu, CL olmayan kontrol ve CL örnekleri arasındaki örtüşme bölgesindeki pozitif RBP'lerin tanımlanmasına yardımcı olabilir ( Şekil 1E ). Tanımlanmış proteinlerin çoğu, daha önce veri kümelerinde belirtilmeyen RBP'lerdir ( Şekil 1F ). Daha önce bilinmeyen bu RNA bağlayıcı proteinleri, kategori III'te, aday RBP'ler olarak sunduk <Sup class = "xref"> 50 ( Şekil 1F ). Bu aday RBPS bağlanma spesifitelerini keşfetmek, daha önce sözü edilen CLIP yöntemleri 23 gibi diğer yöntemler kullanılarak yapılmalıdır. Bir RBP'nin, Arabidopsis'teki hedef mRNA transkriptini CLIP 51'in kullanımı yoluyla düzenlemek için bağlanma spesifıkliğini araştıran bir örnek, Zhang ve diğerleri , 2015'de bulunabilir. Ayrıca, PAR-CLIP'den, fotoaktivasyon yapılabilir- Maya ve insan hücrelerinden 14 , 23 mRNA'ya bağlı proteomların araştırılması için ribonükleosit ile güçlendirilmiş çapraz bağlanma (PAR-CL, 365-nm UV-A) önerilmiştir. PAR-CL, RNA metabolizması sırasında hücreler tarafından alınır ve gelişmekte olan RNA'lara dahil edilmiş 4Su'ya ihtiyaç duyar ve UV-A (365 nm) ışınım altında amino asitler 52 ile kovalent bağlar oluşturan oldukça reaktif olabilirtirme. Halen, 4sU'nun bitki hücrelerine toksisitesi ve ekzojen 4SÜ'nin mezofil protoplastlara etkili bir şekilde alınması üzerine odaklanan hiçbir çalışma yoktur 53 . Bununla birlikte, çeşitli RBP'lerin fizyolojik açıdan keşfedilmesine ve onaylanmasına katkıda bulunacak bitkiler üzerinde hem klasik CL (254-nm UV-C) hem de PAR-CL (365 nm UV-A) kullanılmasının mümkün olacağına inanıyoruz Gelecekte bir çevre.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların açıklayacak bir şeyi yok.

Acknowledgements

Geleneksel UV lamba ile donatılmış UV çapraz bağlama cihazını sağlayan Prof. Joris Winderickx'in laboratuvarını kabul ediyoruz. KG, KU Leuven araştırma fonu tarafından desteklenmekte ve FWO hibe G065713N'den destek aldığını onaylamaktadır.

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics