Capacidade de interactomo do mRNA a partir de protoplastos de plantas

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aqui, apresentamos um protocolo de captura interativo aplicado aos protoplastos de mesofila da folha de Arabidopsis thaliana . Este método baseia-se criticamente na reticulação UV in vivo e permite o isolamento e identificação de proteínas de ligação a mRNA de plantas a partir de um ambiente fisiológico.

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

As proteínas de ligação ao ARN (RBPs) determinam o destino dos ARNs. Eles participam de todas as vias de biogênese de RNA e contribuem especialmente para a regulação de genes pós-transcrição (PTGR) de ARNs mensageiros (mRNAs). Nos últimos anos, uma série de proteomas ligados a mRNA de leveduras e linhas de células de mamíferos foram isoladas com sucesso através do uso de um novo método chamado "captura de intercepto de ARNm", que permite a identificação de proteínas de ligação de mRNA (mRBPs) Diretamente de um ambiente fisiológico. O método é composto de reticulação ultravioleta (UV) in vivo , pull-down e purificação de complexos de ribonucleoproteína messenger (mRNPs) por esferas de oligo (dT) e a posterior identificação das proteínas reticuladas por espectrometria de massa (MS). Muito recentemente, ao aplicar o mesmo método, vários proteomas ligados a mRNA de plantas foram relatados simultaneamente em diferentes fontes de tecido de Arabidopsis : mudas etioladas, tecido foliar,Protoplastos de mesofila foliar e células de raízes cultivadas. Aqui, apresentamos o método otimizado de captura de interome de mRNA para protoplastos de mesofila de folha de Arabidopsis thaliana , um tipo de célula que serve como uma ferramenta versátil para experiências que incluem vários ensaios celulares. As condições para o rendimento proteico ideal incluem a quantidade de tecido inicial e a duração da irradiação UV. No proteoma ligado a mRNA obtido a partir de uma experiência de média escala (10 células 7 ), as RBPs observaram que a capacidade de ligação de RNA foi representada de forma exagerada e foram identificadas várias novas RBPs. O experimento pode ser ampliado (10 9 células), e o método otimizado pode ser aplicado a outros tipos e espécies de células vegetais para isolar, catalogar e comparar geneticamente proteinas de mRNA nas plantas.

Introduction

Os eucariotas usam múltiplos caminhos regulatórios da biogênese do ARN para manter os processos biológicos celulares. Entre os tipos conhecidos de ARN, o ARNm é muito diverso e traz a capacidade de codificação das proteínas e suas isoformas 1. A via PTGR direciona o destino dos pré-mRNAs 2 , 3 . RBPs de diferentes famílias de genes controlam a regulação do RNA, e em PTGR, mRBPs específicos orientam os mRNAs através de interações físicas diretas, formando mRNPs funcionais. Portanto, identificar e caracterizar mRBPs e seus mRNPs é fundamental para a compreensão da regulação do metabolismo do mRNA celular 2. Nas últimas três décadas, vários métodos in vitro - incluindo ensaios de mudança de mobilidade eletroforética de RNA (REMSA), evolução sistemática de ligandos por ensaios exponenciais de enriquecimento (SELEX) com base em construções derivadas da biblioteca, RNA Bind-n-Seq (RBNS), radiomarcados ou quantitativosEnsaios de ligação de ARN de fluorescência, cristalografia de raios X e espectroscopia de RMN 4 , 5 , 6 , 7 , 8 , 9 - foram amplamente aplicados a estudos de RBPs, principalmente de células de mamífero. Os resultados desses estudos de RBPs de mamíferos podem ser pesquisados ​​através da Base de Proteínas de Proteção de RNA (RBPDB), que coleta as observações publicadas 10 .

Embora essas abordagens in vitro sejam ferramentas poderosas, elas determinam os motivos de RNA vinculados a partir de um conjunto de sequências de RNA dado e, portanto, são limitadas na capacidade de descobrir novos RNAs alvo. O mesmo é verdade para estratégias computacionais para prever RBPs em todo o genoma, que se baseiam na conservação da seqüência e estrutura da proteína 15 . Para superar isso, um novo método experimental haFoi estabelecido que permite a identificação dos motivos RNA de que um RBP de interesse interage, bem como para a determinação da localização precisa da ligação. Este método, denominado "reticulação e imunoprecipitação" (CLIP), é composto de reticulação UV in vivo seguida de imunoprecipitação 11 . Estudos iniciais mostraram que a fotoativação de nucleotídeos de DNA e RNA pode ocorrer em comprimentos de onda ultravioleta de excitação superiores a 245 nm. A reacção através da timidina parece ser favorecida (classificação por ordem de redução da fotoreactividade: dT ≥ dC> rU> rC, dA, dG) 12 . Usando luz UV com um comprimento de onda de 254 nm (UV-C), observou-se que as ligações covalentes entre os nucleotídeos de ARN e os resíduos de proteínas são criados quando na faixa de apenas alguns Angstroms (Å). O fenômeno é, portanto, chamado de reticulação "zero-length" de RNA e RBP. Isto pode ser seguido por um rigoroso processo de purificação Com poucos antecedentes 13 , 14 .

Uma estratégia complementar ao CLIP é combinar reticulação UV in vivo com identificação de proteína para descrever a paisagem de RBPs. Vários desses proteomas ligados a ARNm do genoma foram isolados a partir de células de levedura, células-tronco embrionárias (ESC) e linhas celulares humanas ( ou seja, HEK293 e HeLa) utilizando esta nova abordagem experimental, chamada "captura de intercepto de mRNA" 18 , 19 , 20 , 21 . O método é composto de reticulação ultravioleta in vivo seguido por purificação de mRNP e proteômica baseada em MS. Ao aplicar esta estratégia, descobriram-se muitas RBPs "nítidas" que contêm RBDs não-canônicas, e tornou-se claro que mais proteínas possuem capacidades de ligação ao ARN do que se supunha anteriormente"> 15 , 16 , 17. O uso deste método permite novas aplicações e a capacidade de responder a novas questões biológicas ao investigar RBPs. Por exemplo, um estudo recente investigou a conservação do proteoma vinculado ao mRNA (RBP do núcleo) Proteoma) entre leveduras e células humanas 22 .

Os RBPs da planta já foram encontrados envolvidos no crescimento e no desenvolvimento ( por exemplo , na regulação pós-transcrição do tempo de floração, no relógio circadiano e na expressão gênica nas mitocôndrias e cloroplastos) 24 , 25 , 26 , 27 , 28 , 29 . Além disso, eles são pensados ​​para desempenhar funções nos processos celulares que respondem a estresses abióticos ( por exemplo, frio, seca, saLinidade e ácido abscísico (ABA)) 31 , 32 , 33 , 34 . Existem mais de 200 genes de RBP previstos no genoma de Arabidopsis thaliana , com base em motivos de reconhecimento de RNA (RRM) e homologia de K (KH); Em arroz, aproximadamente 250 foram observados 35 , 36 . É notável que muitas RBPs preditas parecem ser únicas para as plantas ( por exemplo, nenhum orthologs metazoários para aproximadamente 50% das RBPs Arabidopsis previstas contendo um domínio RRM) 35 , sugerindo que muitos podem servir novas funções. As funções das RBPs mais preditas permanecem não caracterizadas 23 .

O isolamento de proteomas ligados a mRNA de mudas etioladas de Arabidopsis , tecido foliar, células radiculares cultivadas e protoplastos de mesofila foliar através do uso deA captura de intercepto de mRNA foi recentemente relatada 38 , 39 . Esses estudos demonstram o forte potencial de catalogação sistemática de RBPs funcionais em plantas em um futuro próximo. Aqui, apresentamos um protocolo para captura de intereleto de mRNA a partir de protoplastos de plantas ( isto é, células sem paredes celulares). Os protoplastos de mesofila da folha de Arabidopsis thaliana são o principal tipo de célula foliar. Os protoplastos isolados permitem o acesso ideal da luz UV às células. Este tipo de célula pode ser usado em ensaios que expressam transitoriamente proteínas para caracterização funcional 40 , 41 . Além disso, o protoplasting foi aplicado a vários outros tipos de células vegetais e espécies 42 , 43 , 44 ( eg, Petersson et al ., 2009; Bargmann e Birnbaum, 2010; e Hong et al ., 2012).

<P class = "jove_content"> O método abrange um total de 11 passos ( Figura 1A ). Os protoplastos de mesofila da folha de Arabidopsis são primeiro isolados (passo 1) e subsequentemente são irradiados com UV para formar mRNPs reticulados (passo 2). Quando os protoplastos são lisados ​​em condições de desnaturação (passo 3), as mRNP reticuladas são liberadas em tampão de lise / ligação e puxadas pelas pérolas oligo-d (T) 25 (passo 4). Após várias rodadas de lavagens rigorosas, os mRNPs são purificados e analisados ​​posteriormente. Os péptidos desnaturados de mRBPs são digeridos pela proteinase K antes dos mRNAs reticulados serem purificados e a qualidade do RNA é verificada por qRT-PCR (passos 5 e 6). Após o tratamento com RNase e a concentração de proteína (passo 7), a qualidade da proteína é controlada por electroforese em gel de poliacrilamida SDS (SDS-PAGE) e coloração com prata (passo 8). A diferença nos padrões de banda proteica pode ser facilmente visualizada entre uma amostra reticulada (CL) e uma amostra não reticulada (não CL;A amostra de controle negativo de protoplastos que não está sujeita a irradiação UV). A identificação de proteínas é conseguida através de proteômica baseada em MS. As proteínas da amostra de CL são separadas por electroforese em gel de poliacrilamida unidimensional (1D-PAGE) para remover a possível contaminação de fundo, são "digeridas em gel" em péptidos curtos usando tripsina e são purificadas (passo 9). A cromatografia líquida nano de fase inversa acoplada à espectrometria de massa (nano-LC-MS) permite a determinação da quantidade de proteínas definitivas no proteoma ligado ao mRNA (passo 10). Finalmente, os mRBP identificados são caracterizados e catalogados usando a análise bioinformática (etapa 11).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Aislamento de Protoplastos de mesofila da folha de Arabidopsis

NOTA: Os protoplastos de mesofila da folha de Arabidopsis são essencialmente isolados como descrito por Yoo et al ., 2007, com várias modificações 40 .

  1. Crescimento de plantas
    1. Mergulhe cerca de 200 sementes de etiópia Col-0 de Arabidopsis thaliana em água esterilizada durante 2 dias a 4 ° C na escuridão para estratificação.
      NOTA: Este número de sementes é suficiente para uma amostra não CL e uma amostra de CL (ver passo 1.3).
    2. Prepare potes com uma mistura de solo e vermiculite de 50% ( v / v ) e remova os potes com água destilada em uma bandeja para molhar o solo.
    3. Semeie e distribua as sementes estratificadas em solo molhado. Não cubra as sementes com solo adicional porque as sementes de Arabidopsis precisam de luz para germinação.
      NOTA: As condições de crescimento da planta são um ciclo de 12 h de luz / 12 horas a 23 ° C,Com uma intensidade de luz de 100 μmol m -2 s -1 , numa sala de crescimento durante 5 semanas antes da floração. As plantas de 4 semanas de idade também podem ser usadas 40 .
      NOTA: Todos os materiais e reagentes descritos a partir do passo 1.2.1 para o passo 3.2.3 são para duas amostras ( ou seja, uma amostra não CL (a amostra de controle que não está sujeita a irradiação UV-C) e uma amostra CL (a pesquisa Amostra que é submetida a irradiação UV-C)).
  2. Preparação da solução enzimática isotônica
    1. Faça 80 mL de solução de enzima isotônica primária (manitol 400 mM, KCl 20 mM e tampão MES 20 mM (pH 5,7)) e aquecer imediatamente a solução em uma incubadora a 60 ° C durante 10 min.
    2. Adicionar 1,2 g de Celulase R10 ( p / v 1,5%) e 0,32 g de pó de Macerozyme R10 ( p / v 0,4%) à solução de enzima isotónica primária morna.
    3. Coloque cuidadosamente a enzima pó na solução, aplicando uma agitação suave. RapAqueça a solução em uma incubadora a 60 ° C durante 10 minutos até que a solução da enzima seja clara e clara.
    4. Arrefece-se a solução em gelo durante 3 min e adicionar 800 mL de 1 M de CaCl2 e 800 mL de 10% (w / v) de BSA à solução.
    5. Homogeneize a solução por pipetagem e filtragem através de um filtro de 0,22 μm. Alíquota esta solução de enzima isotônica final em duas placas de Petri em grande escala (150 mm x 20 mm).
  3. Preparação de tiras de folhas de roseta Arabidopsis
    NOTA: Recomenda-se 150 folhas para cada placa de Petri para uma amostra não CL ou uma amostra de CL.
    1. Escolha e cortar um total de 300 totalmente expandido 2 nd - ou 3 rd -pair folhas verdadeiras (média: 3 - 4 por roseta) em 0,5 a 1 mm de tiras de folha usando um novo e afiada lâmina de barbear.
    2. Transfira e submerga as tiras imediatamente na solução enzimática isotônica.
      NOTA: Para evitar qualquer contato com a luz, cubra sempre tEle pratos de Petri com papel alumínio. Não esmague as folhas. Confirme se todas as tiras estão submersas na solução e não flutuam na superfície.
  4. Isolamento de protoplastos de mesofila da folha de Arabidopsis
    1. Coloque as placas de Petri cobertas de alumínio em vácuo e dessecar as tiras folheadas ao vácuo durante 30 min. Posteriormente, incubar as placas de Petri na escuridão sem agitação à temperatura ambiente durante 2,5 h.
    2. Agite suavemente e brevemente os pratos horizontalmente à mão, tentando liberar os protoplastos inteiramente na solução enzimática.
  5. Colhendo e contando os protoplastos
    1. Filtre a suspensão de protoplastos através de uma malha de nylon de 35 a 75 μm. Alíquota do filtrado de cada amostra em dois tubos de fundo redondo de 50 mL (aproximadamente 20 mL de filtrado em cada tubo).
    2. Enxaguar cada placa de Petri com 10 mL de tampão W5 (154 mM de NaCl, 125 mM de CaCl
    3. Gire todos os quatro tubos durante 5 min a 100 xg para sedimentar os protoplastos. Descarte o sobrenadante e ressuspenda gentilmente os grânulos de protoplastos em cada tubo com 10 mL de tampão W5.
      NOTA: Ao ressuspender os grânulos de protoplastos, reverta suavemente o tubo de cabeça para baixo e gire suavemente o tubo manualmente até que os pellets tenham desaparecido. Não pipeteie o sedimento diretamente para evitar danificar as células.
    4. Repita o passo 1.5.3 uma vez e combine a suspensão de protoplastos de dois tubos de cada amostra em um tubo de fundo redondo de 50 ml. Mantenha os tubos no gelo.
    5. Conte os protoplastos usando um hemocitómetro.
      NOTA: Cada 20 células dentro de 25 cubos é igual a 2 x 10 5 protoplastos / mL. 150 folhas devem produzir aproximadamente 1 x 10 7 células.Modular para ter um número total igual de protoplastos nas amostras não CL e CL.
    6. Mantenha os protoplastos no gelo durante 30 min. Depois, gire os tubos por 5 min a 100 x g. Descartar o sobrenadante e ressuspender os protoplastos em cada tubo com 20 ml de solução MMG (manitol 400 mM, MgCl 2 15, e 4 mM de tampão MES (pH 5,7)).

2. In-Vivo mRNA-proteína de reticulação por radiação UV

NOTA: Mantenha o tubo de amostra não CL no gelo. A amostra CL deve ser imediatamente irradiada por UV.

  1. Transfira a suspensão de protoplastos contendo 1 x 10 7 células do tubo de amostra CL para uma nova placa de Petri em grande escala (150 mm x 20 mm) e adicione 30 ml de solução gelada de MMg para cobrir a superfície da placa. Espalhe as células em todo o buffer de MMg por pipetagem suave. Coloque imediatamente a placa de Petri sem a cobertura superior em um aparelho de reticulação UV.
    NOTA: A altura entre a lâmpada UVE a placa de Petri é de 8 cm.
  2. Irradiate a amostra com luz UV de comprimento de onda de 254 nm e 0,00875 W / cm 2 de intensidade UV durante 1 min, 3 min ou 5 min. Após a irradiação, alíquote rapidamente a suspensão de protoplastos em dois novos tubos de fundo redondo de 50 mL. Lave o fundo do prato com mais 5 mL de solução gelada de MMg para coletar o restante dos protoplastos e adicione esta suspensão celular a estes dois tubos.
    NOTA: 1 min foi escolhido como a condição ideal. A explicação pode ser encontrada nos resultados representativos .

3. Lise de protoplastos sob condições de desnaturação

  1. Preparação de pellets de protoplastos para lise
    1. Gire o tubo de amostra não CL juntamente com os dois tubos de amostra CL do passo 2 a 100 xg durante 5 min e descarte o sobrenadante. Coloque o tubo da pastilha de protoplasto de amostra não-CL de volta no gelo.
    2. Adicione 10 mL de solução gelada de MMg a cada tubo de amostra CL, genTente ressuspender os grânulos e combiná-los novamente em um tubo redondo de fundo de 50 mL. Gire o tubo a 100 xg durante 5 min. Depois de remover o sobrenadante, mantenha o sedimento de protoplasto do tubo de amostra CL no gelo.
  2. Lise de protoplastos e lisina de protoplastos homogeneizantes
    1. Adicionar 9 mL de lise gelada / tampão de ligação (500 mM de LiCl, 0,5% ( p / v ) de Dodecyl Sulphate de Litio (LiDS), 5 mM de Dithiothreitol (DTT), 20 mM de Tris-HCl (pH 7,5) e 1 mM EDTA (pH 8,0)) ao sedimento celular de cada amostra. Lerse lentamente os protoplastos, pipetando para cima e para baixo aproximadamente 20 vezes até a suspensão ser homogêneamente verde-clara.
    2. Passe o lisado de protoplastos duas vezes através de uma seringa de vidro de 50 mL com uma agulha estreita (0,9 x 25 mm 2 ) para homogeneização. Incube o lisado sobre gelo durante 10 min. Congele os lisados ​​em nitrogênio líquido e armazene a -80 ° C por até 3 semanas.

4. mRNP Pull-down e PurificationPor Oligo-d (T) 25 Beads

NOTA: Todos os materiais e reagentes descritos a seguir, do passo 4.1 ao passo 4.4, são apenas para uma amostra ( ou seja, uma amostra não CL ou uma amostra de CL). O lisado de protoplastos deve ser adicionado imediatamente aos tubos que contêm esferas após o lubrificante do sobrenadante do grânulo / tampão de ligação ser descartado.

  1. Preparação de esferas magnéticas oligo-d (T) 25 para captura de oligo (dT)
    1. Destilar o lisado de protoplastos congelados à temperatura ambiente. Quando o lisado estiver totalmente descongelado, mantenha o tubo de lisado no gelo.
    2. Alíquota 1,8 mL de pérolas magnéticas oligo-d (T) 25 (5 mg / mL) em 6 novos tubos de microcentrífuga de fundo redondo de 2 mL em gelo. Em cada tubo, lave a suspensão do talão homogeneamente com 600 μL de lise / tampão de ligação, pipetando brevemente para cima e para baixo e girando suavemente a 4 ° C durante 2 min. Mantenha as contas no gelo.
  2. Obrigatório
    1. Lugar, colocarTodos os 6 tubos que contêm as contas em uma prateleira magnética a 4 ° C durante 3 min, o que resultará na captura magnética das esferas e na limpeza da suspensão.
      NOTA: Quando os tubos são colocados no suporte magnético, aguarde até que as contas sejam completamente capturadas, pelo menos 3 min.
    2. Descarte o sobrenadante e alíquote imediatamente 9 mL de lisado de protoplastos nestes 6 tubos. Misture bem por pipetagem até aparecer uma suspensão marrom homogênea e incubar as pérolas em lisado de protoplastos a 4 ° C durante 1 h aplicando rotação suave.
      NOTA: Recomenda-se um tempo de incubação de 30 min a 1 h.
  3. Lavando
    1. Coloque os tubos de volta no suporte magnético a 4 ° C durante 3 min. Quando todas as contas são capturadas no lado dos tubos, colete o lisado de protoplastos em 6 novos tubos de microcentrífuga de fundo redondo de 2 mL e armazene-os temporariamente a 4 ° C. NÃO descarte imediatamente o lisado de protoplastos; Mantenha o lisadoA 4 ° C.
    2. Adicionar 1,5 mL de tampão de lavagem gelado 1 (LiCl 500 mM, LiDS a 0,1% ( p / v ), DTT 5 mM, Tris-HCl 20 mM (pH 7,5) e EDTA 1 mM (pH 8,0)) às esferas Em cada tubo. Ressuspenda as contas e aplique uma rotação suave durante 1 min. Coloque os tubos de volta no suporte magnético a 4 ° C durante 3 min e descarte o sobrenadante. Repita este passo de lavagem com o tampão de lavagem uma vez.
    3. Repita o mesmo procedimento deste passo de lavagem duas vezes utilizando 1,5 mL de tampão de lavagem gelado 2 (LiCl 500 mM, DTT 5 mM, Tris-HCl 20 mM (pH 7,5) e EDTA 1 mM (pH 8,0)) e uma vez que utiliza 1,5 mL de tampão de baixo teor de sal gelado (LiCl 200 mM, Tris-HCl 20 mM (pH 7,5) e EDTA 1 mM (pH 8,0)).
      NOTA: Se os mRNPs foram isolados eficientemente do lisado de protoplastos, deve haver um "halo" visível ao redor da pastilha de grânulos na amostra CL durante o passo de lavagem com o tampão de lavagem 2 ( Figura 1B ).
  4. Elução
    1. Adicionar 500 μLDe tampão de eluição (Tris-HCl 20 mM (pH 7,5) e EDTA 1 mM (pH 8,0)) nas esferas em cada tubo. Ressuspender gentilmente as esferas e incubar a 50 ° C durante 3 minutos para libertar os ARNs de poli (A). Ressuspenda gentilmente as contas uma vez por pipetagem. Coloque os tubos de volta no suporte magnético a 4 ° C durante 5 min.
    2. Transfira e combine todos os eluentes (aproximadamente 3 mL no total) para um tubo de fundo cônico, limpo e estéril, com 15 ml de cônica no gelo.
      NOTA: A qualidade e a quantidade de RNA podem ser imediatamente determinadas usando um dispositivo de espectrofotômetro.
      NOTA: A concentração de ARN de cada amostra é de aproximadamente 10 ng / μL, com uma razão A 260 / A 280 de 1,9. O índice A 260 / A 280 deve estar entre 1,6 e 2,0 porque os ARNs de poli (A) isolados geralmente são maiores que 70% puros. Se a concentração de ARN for muito baixa, aumente o número de protoplastos iniciais para um máximo de 10 9 . AmostrasPode ser congelado em nitrogênio líquido e mantido a 80 ° C para armazenamento a longo prazo.
    3. Repita o passo 4.2 para o passo 4.4 para duas rodadas adicionais e reutilize as esferas de oligo-d (T) 25 para esgotar os ARNs de poli (A) do lisado de protoplastos.
      NOTA: Após três rodadas de procedimento suspenso, deve haver um total de 9 mL de eluente para cada amostra não CL ou CL. Execute todos os trabalhos a 4 ° C para evitar a degradação do RNA. Siga o passo 4.5 ou o passo 4.6 para reutilizar ou regenerar os grânulos.
  5. Preparação de esferas de oligo-d (T) 25 reutilizadas
    1. Lave as contas duas vezes com 1 mL de tampão de eluição gelada e uma vez com 1 mL de lise gelada / tampão de ligação para ajustar a concentração de sal de LiCl de volta a 500 mM.
    2. Siga o passo 4.1, descarte o sobrenadante, transfira o lisado de protoplastos armazenado em cada tubo e repita todo o procedimento do passo 4.2 para o passo 4.4 para mais duas rodadas.
  6. 25 esferas
    NOTA: As contas podem ser armazenadas e usadas para outra experiência (a reutilização máxima é de três vezes).
    1. Siga o passo 4.4, adicione 1 mL de NaOH 0,1 M às esferas e incube por rotação à temperatura ambiente durante 5 min. Para cada tubo, lave duas vezes com 1 mL de tampão de lavagem 1 e três vezes com 1x PBS (pH 7,4) contendo 0,1% de Tween-20 para equilíbrio. Mantenha as pérolas de cada tubo em 300 μL de 1x PBS esterilizado sem RNase (pH 7,4) contendo 0,1% de Tween-20 a 4 ° C para armazenamento a longo prazo.
      NOTA: Os grânulos usados ​​para amostras de Arabidopsis CL nesta experiência só podem ser usados ​​para as mesmas amostras de plantas na próxima vez.

5. Tratamento com Proteinase K e Purificação de ARNm

  1. Tratamento com Proteinase K
    1. Adicione 8 μL de solução de Proteinase K (2 μg / μL) a 1 mL do eluente de cada amostra para digerir as proteínas reticuladas com UV. BrVortex iefly.
  2. Purificação de ARNm
    1. Incubar o eluente a 37 ° C durante 1 h. Purifique o RNA usando o kit de purificação de RNA para remover contaminantes residuais.
      NOTA: Após a purificação, os ARNs estão prontos para o teste de qualidade de ARN usando o ensaio qRT-PCR.
      NOTA: Outros kits, como kit mini RNA e reagente TRIzol, também podem ser usados 14 .

6. Ensaio qRT-PCR

  1. Transcrição reversa
    1. Obtenha síntese eficiente do cDNA de primeira linha usando o sistema de transcrição reversa, com 1 μg de RNA como modelo. Diluir a amostra a 5 ng / μL com água livre de nuclease.
  2. Quantificação de cDNA usando qRT-PCR
    1. Amplifique e quantifique o cDNA usando a mistura mestre qPCR e o ciclador de PCR em tempo real, com 10 ng de cDNA como modelo. Use o seguinte programa de PCR: 95 ° C durante 10 minutos(Estágio 1, um ciclo) e 95 ° C durante 15 s e 60 ° C durante 1 min (estágio 2, 40 ciclos).
      NOTA: O gene de referência usado aqui foi um gene de controle interno endógeno, UBQ10 (AT4G05320). Os iniciadores de qRT-PCR para ARNr UBQ10 e 18S foram descritos em Li et al ., 2014 e Durut et al ., 2014, respectivamente , 45 , 46 . As sequências iniciais estão listadas na Tabela de materiais .

7. RNase Treatment e mRBP Concentration

  1. Tratamento com RNase
    1. Adicione aproximadamente 100 U de coquetel RNase contendo RNase A e RNase T1 em 8 mL de eluente. Inclua uma amostra de controle negativo com um cocktail RNase em que o eluente seja substituído por água livre de nuclease. Em breve vortex e incubar a 37 ° C durante 1 h.
  2. Concentração de mRBP
    1. Após a digestão com RNase, concentre o eluente usinG unidades de filtro centrífugo. O volume final é de 75 μL, com um rendimento proteico total de aproximadamente 2 μg de cada amostra após a concentração. Coloque as amostras a -80 ° C para armazenamento a longo prazo.

8. SDS-PAGE e coloração de prata

  1. SDS-PAGE
    1. Misture 25 μL do eluente concentrado (amostra CL) ou a amostra de controle (amostra não CL) com 15 μL de 2 x tintura de carga. Aquecer a amostra a 95 ° C durante 5 min e carregá-la em um gel SDS-PAGE contendo 5% de gel de empilhamento e 12% de gel de resolução, incluindo um marcador de proteína.
    2. Condensar as proteínas a 60 V por 40 min e separar a 160 V por aproximadamente 1 h até o corante de carga atingir a extremidade do gel de resolução.
  2. Ensaio de coloração de prata
    1. Lave o gel SDS-PAGE duas vezes com água ultrapura por 5 min cada vez. Execute a coloração de prata das proteínas usando um kit comercial de manchas de prata.
      NOTA: As bandas de proteínas devem ser mostradas dentro de 5 min. Se as faixas forem visíveis além de 5 min com cores muito claras, sugere-se aumentar o número de protoplastos iniciais até o máximo de 10 9 .

9. Trypsin Digest of Protein Bands and Peptide Purification

  1. Sumário de tripsina
    NOTA: Execute um segundo gel 1D-PAGE tomando mais 25 μL de solução concentrada de mRBP de cada amostra para identificação de mRBP; Os géis corados com prata não podem ser usados ​​porque não são compatíveis com a análise de MS.
    1. Depois de executar o gel 1D-PAGE, repare o gel na solução de fixação (metanol a 50% ( v / v ) e ácido acético a 10% ( v / v ) durante 1 h. Manchar o gel na solução de mancha (0,1% ( p / v ) de Coomassie Brilliant Blue R-250, 50% ( v / v ) de metanol e 10% ( v / v ) de ácido acético) durante 20 minutos com agitação suave. Destilar o gel na solução de descontinuação (40% ( v / v ) de metanol e 10% ( v/ V) ácido acético) durante 1 h. Após a coloração, mantenha o gel em 5% ( v / v ) de ácido acético.
      NOTA: Durante a descodificação, a nova solução de descontinuação pode ser substituída até que o fundo esteja totalmente descodificado.
    2. Corte as bandas de interesse do gel. Corte as bandas ainda mais em pedaços de aproximadamente 1 mm 3 para a posterior digestão óptima da tripsina e extração de péptidos. Hidratar os pedaços do gel com 50 mL de bicarbonato de amónio 100 mM (NH 4 HCO 3) durante 10 min. Cubra as peças de gel completamente.
      1. Remover a solução de hidratação cuidadosamente e desidratar os pedaços do gel com acetonitrilo (CH3CN), durante 10 min. Remova cuidadosamente a solução de acetonitrilo.
      2. Repita o processo de hidratação para desidratação duas vezes. Finalmente, remova a solução de acetonitrilo.
        NOTA: O tempo de execução do gel depende do propósito da experiência. Um longo período de tempo permite uma boa separação de proteínas, de modo que a proibição de gel especificada manchadaDs podem ser cortados para análise posterior. Se o objetivo é manter as proteínas e remover contaminantes, é suficiente um tempo de execução curto.
    3. Adicionar 500 μL de solução de DTT 6,6 mM e incubar os pedaços de gel por 10 min. Remova a solução de DTT e lave as peças de gel duas vezes com 500 μL de solução de acetonitrilo a 95% ( v / v ).
      1. Após a lavagem, remova a solução de acetonitrilo e incuba os pedaços de gel com 500 μL de solução de ácido iodoacético 55 mM (IAA) durante 10 min na escuridão.
      2. Após a incubação, retire a solução e lave os pedaços de gel novamente com 500 μL de solução de acetonitrilo a 95% ( v / v ). Secar os pedaços de gel.
    4. Incorporar os pedaços de gel completamente com 25 uL de tampão de digestão (50 mM NH 4 HCO 3, CaCl 2 5 mM, e 6 ng / mL de tripsina) e manter em gelo durante 45 min para permitir que a tripsina permear no gel. Incubar os pedaços de gel durante a noite a 37 ° C para en Digestão zymatic.
  2. Purificação de péptidos
    1. Adicionar 80 uL de 50 mM NH 4 HCO 3 para os pedaços de gel no tampão de digestão e vortex repetidamente para extrair os peptídeos trípticos. Coletar o extrato. Repita este passo de extração duas vezes com 80 μL de 50% ( v / v ) de CH3CN e 5% ( v / v ) de ácido fórmico (FA).
      NOTA: O extracto final total deve ser de aproximadamente 240 μL.
    2. Coloque e concentre os extratos em aproximadamente 10 μL por concentração de vácuo ou liofilização e adicione 25 μL de solução aquosa de ácido trifluoroacético (TFA) 0,1% ( v / v ). Desalme as amostras com colunas μ-C18, seguindo o protocolo do fabricante.
    3. Elui-se os péptidos com 4 - 10? L de 60% (w / v) CH 3 CN e 0,1% (v / v) de FA. Liofilizar (congelar-se) os péptidos e armazená-los a -20 ° C até a análise.
Título "> 10. Nano-LC-MS

  1. Cromatografia líquida nano de fase reversa
    NOTA: Execute a análise LC-MS com um espectrômetro de massa que é acoplado em linha com um instrumento de cromatografia líquida. Este instrumento deve estar equipado com uma coluna C18 (partícula de 2 μm, tamanho de poro de 100 Å e dimensão de 50 μm x 15 cm).
    1. Ressuspender os péptidos liofilizados em 16 μL de solução (2% ( v / v ) de CH3CN e 0,1% ( v / v ) FA). Injetar e carregar 5 μL de solução de péptido a uma taxa de fluxo de 5 μL / min em uma précoluna C18 (tamanho de partícula de 3 μm, tamanho de poro de 100 Å, nanoviper e dimensão de 75 μm x 2 cm).
    2. 10.1.2. Separe os péptidos usando um gradiente de 95 minutos com um caudal de 300 nL / min. Durante este gradiente de separação, aumente a fase móvel B de 4% a 10%, 10% a 25% e 25% a 45% em 5 min, 50 min e 18 min, respectivamente. Finalmente, aumentam abruptamente a fase móvel B para 95% em 1 min. Depois deCada gradiente de separação de 95 minutos, aplique um passo de enxaguamento inerente contendo um gradiente de 10 minutos de 4% a 95% em 5 min.
      NOTA: A fase móvel A é 99,9% H 2 O e 0,1% ( v / v ) FA, e a fase móvel B é 19,92% H 2 O, 80% ( p / v ) CH 3 CN e 0,08% ( v / v ) FA.
  2. Ensaio de espectrometria de massa
    1. Operar o espectrômetro de massa em modo dependente de dados com uma faixa de massa de 400 a 1.600 m / z.
    2. Selecione até dez dos iões mais intensos no MS1 para gerar os espectros de fragmentação. Defina a resolução para 70,000 de largura total a meio máximo (FWHM) para MS1 e 17,000 para MS2, com um alvo de controle de ganho automático (AGC) de 3.000.000 e 1.000.000 de íons e um tempo máximo de injeção de iões (256) e 64 ms para MS1 E MS2, respectivamente.
    3. Defina a exclusão dinâmica em 10 s para evitar a fragmentação repetida dos íons mais abundantes.
      NOTA: Aqui, íons com uma ou mais de seis cargas são eXcluído para MS2.
  3. Proteômica qualitativa: identificação de péptidos e proteínas
    1. Analise os espectros de fragmentação usando um software como o software de estúdio Peaks 47 , 48 , 49 .
      NOTA: Outros pacotes de software também estão disponíveis para identificação de peptídeos, como NovoHMM 30 e PepNovo 37 para seqüenciamento de novo e SEQUEST 54 e Mascot 55 para pesquisa de banco de dados.
    2. Combine os espectros com a mesma massa (<diferença de 2 ppm) e os tempos de retenção (<2 min) e apenas retenham espectros com um limite de qualidade superior a 0,65 para pesquisar o banco de dados Swiss-Prot (versão: dezembro de 2013) para a taxonomia definida como modelo Planta Arabidopsis thaliana . Use os seguintes parâmetros de busca: uma tolerância de massa precursora de 10 ppm através do uso do monMassa oisotópica; Uma tolerância de massa de fragmento de 20 mmu; Tripsina como enzima de digestão, com um máximo de 2 clivagens perdidas; Carbamidometilação de cisteína como modificação fixa; Oxidação da metionina como modificação variável; E um máximo de 3 modificações pós-translacionais variáveis ​​por péptido. Após a identificação, ajuste manualmente os limiares de pontuação para a identificação confiável de péptidos e proteínas, de modo que uma taxa de descoberta falsa (FDR) <5% seja adquirida.
  4. Proteômica quantitativa: análise estatística de dados de espectrometria de massa
    1. Use LC-MS ( por exemplo, Progenesis) para a quantificação sem etiqueta de dados proteômicos.
      NOTA: As áreas de pico do péptido MS1 (ou intensidade) estão ligadas aos péptidos identificados pelo software de estúdio de acordo com a massa, com o erro tolerado no máximo de 10 ppm.
      NOTA: Este software calcula a abundância de um péptido integrando as áreas de pico de todos os estados de carga entre 2 <Sup> + e 8 + . Os dados quantitativos estão ligados à identificação do peptídeo PEAKS por um script interno (correspondência de massa com o erro tolerado no máximo de 10 ppm).
    2. Calcule as mudanças médias de log2-fold (CL / non-CL) para cada péptido. Agrupe as mudanças de dobra dos péptidos exclusivos por proteína.
      NOTA: Em cada grupo, a mudança de dobra final de uma proteína é igual à média das mudanças de dobra de seus péptidos.
    3. Calcule o valor p usando o teste t de Student para cada grupo para avaliar a significância estatística. Aplique o pacote de software R (versão 3.3.0) para corrigir os valores de p para o FDR de todos os grupos usando o método Benjamini-Hochberg (BH).
    4. Desenhe o traçado do vulcão usando o pacote de função "calibrar" (versão 1.7.2) compatível com o pacote de software R (versão 3.3.0).
      NOTA: Aqui, os valores de p ajustados em log10 (-log10 (valor adj. P)) são uma função das mudanças log2-fold de todas as proteínas identificadas. As proteínas sãoTratados como acessos positivos no proteoma vinculado ao mRNA se suas alterações de log2-fold forem maiores que 2, com ou sem significância.

11. Catálogo do Proteome identificado com mRNA identificado

  1. Classifique as proteínas identificadas do passo 10 em três categorias com base nos itens de "funções moleculares e processo biológico" através da base de dados Gene Ontology (GO) e "família e domínio" através do banco de dados InterPro.
  2. Como a categoria I, ou "proteínas ribossómicas", contém todas as proteínas ribossómicas detectadas, definem proteínas da categoria II ou "RBP principais", como contendo os domínios de proteínas anotadas que interagem com RNAs ou ligação à ligação de ARN com funções conhecidas ou desconhecidas em biologia de RNA .
  3. Como as proteínas com funções conhecidas ou desconhecidas na biologia do ARN sem domínios de ligação de ARN anotados são colocadas na categoria III, ou "RBPs Candidatos", definem enzimas da categoria III com base em anotações do IBanco de dados ntEnz.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Observamos um halo característico, que envolve o grânulo do talão na amostra CL, no passo de lavagem 4.3 com o tampão de lavagem 2 ( Figura 1B ). Embora não tenha sido investigado, esse fenômeno provavelmente pode ser explicado pela interferência de complexos de mRNP reticulados com agregação de grânulos durante a captura magnética, fazendo com que um agregado mais difuso se forme. Isso indica que a captura de pérolas oligo-d (T) 25 foi efetiva 14 .

Os níveis de ARNm de referência de UBQ10 significativamente maiores do que o rRNA de 18S em ambas as amostras de controle CL e CL são mostrados na Figura 1C . Isso indica que os mRNAs são enriquecidos no eluente devido à captura por pérolas oligo-d (T) 25 , que só podem se ligar a mRNAs de poli (A). A eficiência da captura de grânulos oligo-d (T) 25 foi adicionalOrted por SDS-PAGE e coloração com prata (passo 8), como mostrado na Figura 1D após o tratamento com RNase e a concentração de mRBP (passo 7). Uma diferença no padrão de banda protéica entre o controle não CL e as faixas da amostra CL pode ser claramente observada, e as bandas de proteínas presentes na faixa de controle de controle não-CL podem ser explicadas pela presença de RNase. Isso ilustra o forte enriquecimento de mRBPs na amostra CL.

A eficiência da reticulação pode ser controlada variando a duração do tempo da irradiação UV. A reticulação suficiente, mas a evitação do dano do protoplastos e a degradação do ARN são ótimas. Na Figura 1D , foram obtidos padrões de bandas proteicas específicas em todas as amostras de CL ao comparar diferentes tempos de irradiação UV (1, 3 e 5 min). Sob a mesma intensidade UV (0,00875 W / cm 2 ), as condições mais ótimas foram encontradas em 1 ou 3 min, devido à indistinguívelIntensidade da banda de proteína. As intensidades de banda mais fracas foram observadas com o tempo de reticulação mais longo (5 min). Consideramos 1 min como a condição ideal porque uma menor duração da reticulação tem a vantagem adicional de facilitar a transferência e coleta de protoplastos da placa de Petri. Os protoplastos podem ser rapidamente precipitados para o fundo da placa de Petri durante a irradiação UV, porque eles se apegam ao fundo do prato. Isso torna mais difícil a coleta e transferência para os tubos após uma maior duração da irradiação UV.

Com base nas condições otimizadas, a identificação de proteínas a partir de três repetições biológicas foi subsequentemente alcançada por proteômica qualitativa e quantitativa, descrita nas etapas 9 e 10. Na análise por proteômica qualitativa ( Figura 1E , direita), um total de 341 proteínas Foram identificados em amostras de CL, dos quais 36 foram encontrados tanto no controle de CL quantoD amostras de CL, e apenas 8 proteínas foram detectadas na amostra de controle não CL. Esta enorme diferença nos números de proteína identificados entre ambas as amostras é consistente com os diferentes padrões de banda de proteína ( Figura 1D ), apoiando a idéia de que o SDS-PAGE e o teste de coloração de prata são boas ferramentas para validar a eficiência de oligo-d (T) 25 captura de grânulos. Na análise por proteômica quantitativa ( Figura 1E , esquerda), um total de 325 proteínas (azul e verde) mostraram uma mudança de log2-fold superior a 2. Entre essas proteínas, 100 proteínas (de cor azul) apresentaram pequena p - valores acima do nível de significância. Portanto, eles também foram definidos como sucessos positivos. É notável que os valores de p de outras 225 proteínas (de cor verde) foram superiores a 0,05, abaixo do nível de significância devido à dispersão de dados. Em outras palavras, havia péptidos abundantemente abundantes presentes para cada proteína, com alta variabilidade de intensidade de péptidoEs. No entanto, como todos eles foram apenas detectados qualitativamente em amostras de CL, foram considerados positivos.

Com base nos bancos de dados GO e InterPro 50 (passo 11), essas 325 proteínas foram ainda classificadas na categoria I (proteínas ribossômicas), categoria II (principais RBPs) e categoria III (RBPs candidatas) ( Figura 1F ). Havia 123 proteínas ribossómicas na categoria I, enquanto na categoria II, observaram-se 70 RBP classificadas anotadas. Essas duas categorias - que contêm a maioria das proteínas anotadas que se ligam à ligação de ARN molecular e à biologia de ARN ( Figura 1F , à direita) e que ocupam aproximadamente 38% e 22% do proteoma inteiro com mRNA, respectivamente - indicam a alta eficiência do interome de mRNA otimizado capturar. Os últimos 40% (132 RBPs candidatos) foram classificados na categoria III devido à falta de RBD convencionais. Além disso, a maioria dosOs seus papéis na ligação de RNA e os processos biológicos de ARN não foram validados ( Figura 1F , esquerda). Suponhamos que as proteínas desta categoria possam revelar novas funções nos regulamentos de ARN.

figura 1
Figura 1: Diagrama de Fluxograma e Resultados do Método Otimizado para Descoberta do Proteoma Ligado com ARNm dos Protoplastos de Mesofila da Folha de Arabidopsis . ( A ) As etapas principais do método completo estão listadas de 1 a 11. Os processos celulares e moleculares poderosos são ilustrados pela foto e pelos desenhos animados. Os detalhes de cada etapa foram descritos intensamente no protocolo. ( B ) Observou-se um halo em torno da pastilha de grânulos na amostra de CL, mas não na amostra de controlo não CL, durante o passo de lavagem 4.3. ( C ) Comparação do ARNm UBQ10 relativo e nível de rRNA 18SÉ em amostras de controle CL e CL por qRT-PCR (os valores são médios ± SD (n = 3); * e **: diferenças significativas com p <0,05 e <0,01). (D) proteína eluente concentrado de amostra de controlo não-CL em comparação com amostras de CL irradiadas por uma fonte de UV de onda contínua para 1, 3, e 5 minutos, com a intensidade da radiação UV no 0,00875 W / cm2. ( E ) Identificação de proteoma ligado a mRNA por proteômica. Na proteômica quantitativa realizada pelo pacote de software Progenesis (à esquerda), o gráfico de vulcão exibe as mudanças médias de log2-fold (CL / non-CL) e os valores de p ajustados relacionados (-log10 (valores adjuntos) de Todas as proteínas. Na proteômica qualitativa realizada pelo pacote de software Peaks (direita), as proteínas nas amostras são ilustradas nos diagramas de Venn. A quantidade de proteínas está listada em números. O FDR nos níveis de péptido e proteína é inferior a 5%. O número de proteínas dentro dos quadros marrom claro são considerados acessos positivos. ( et al ., 2016. Por favor, clique aqui para ver uma versão maior dessa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Nós aplicamos com sucesso a captura de interome de mRNA, desenvolvida para leveduras e células humanas, para plantar protoplastos de mesofila foliar. As células do mesofílio da folha são o principal tipo de tecido moído nas folhas das plantas. A principal vantagem deste método é que ele usa reticulação in vivo para descobrir as proteínas de um ambiente fisiológico.

Neste protocolo, apresentamos principalmente uma série de condições experimentais otimizadas ( por exemplo, o número de protoplastos a serem utilizados como material de partida e a duração da irradiação UV) 50 . As proteínas capturadas nas amostras de CL só podem ser detectadas por SDS-PAGE e coloração de prata quando um mínimo de 10 7 protoplastos (escala média) é usado (passo 1.5.5). Concentrações mais baixas não produzem um padrão de mRBP observável em SDS-PAGE e provavelmente não devem ser usadas para análise posterior por proteômica. Na verdade, usando mais de 10 7 células ( por exemplo, 10 9 emUma experiência em larga escala) também é possível 20 . Os resultados dos ensaios de coloração de prata sugerem que a irradiação UV durante 1 minuto com 0,00875 W / cm 2 de intensidade gerada por uma fonte UV de onda contínua é otimizada ( Figura 1D ). A alta eficiência no passo crítico ( ou seja, a remoção de mRNP e a purificação por pérolas oligo-d (T) 25 , etapa 4) é suportada pelos resultados dos ensaios RT-qPCR, coloração com prata e MS ( Figura 1C ; 1D e 1E , à direita). A combinação de proteômica qualitativa e quantitativa pode ajudar a identificar as RBPs positivas na região de sobreposição entre controle não CL e amostras de CL ( Figura 1E ). A maioria das proteínas identificadas foram RBPs não previamente anotadas em conjuntos de dados ( Figura 1F ). Apresentamos estas proteínas de ligação ao RNA anteriormente desconhecidas na categoria III como RBPs candidatas <Sup class = "xref"> 50 ( Figura 1F ). Explorar as especificidades de ligação dessas RBP candidatas deve ser feito usando outros métodos, como os métodos CLIP anteriormente mencionados 23 . Um exemplo que investiga a especificidade de ligação de uma RBP para regular o seu transcrito de mRNA alvo em Arabidopsis através do uso de CLIP 51 pode ser encontrado em Zhang et al ., 2015. Além disso, um método alternativo modificado de PAR-CLIP, chamado fotoativável- A reticulação reforçada com ribonucleósido (PAR-CL, 365-nm UV-A) também foi previamente recomendada para a investigação de proteomas ligados a ARNm de células de fermento e células humanas 14 , 23 . O PAR-CL requer 4Su, que é absorvido por células e incorporado em RNAs nasantes durante o metabolismo do RNA e pode ser altamente reativo, formando ligações covalentes com os aminoácidos 52 sob irradiação UV-A (365 nm)Ation. Atualmente, não há estudos focados na toxicidade de 4sU nas células da planta e na absorção eficiente de 4sU exógenos em protoplastos de mesofila 53 . No entanto, acreditamos que será possível usar tanto o CL convencional (254-nm UV-C) como o PAR-CL (365 nm UV-A) nas plantas, o que contribuirá para a descoberta e validação de diversas RBPs do fisiológico Ambiente no futuro.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgements

Reconhecemos o laboratório do Prof. Joris Winderickx, que forneceu o aparelho de reticulação UV equipado com a lâmpada UV convencional. A KG é apoiada pelo fundo de pesquisa KU Leuven e reconhece o apoio da subvenção FWO G065713N.

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics