Capture interactine d'ARNm à partir de protoplastes végétaux

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ici, nous présentons un protocole de capture interactif appliqué aux protoplastes de mésophylle de la feuille d' Arabidopsis thaliana . Cette méthode repose de manière critique sur la réticulation UV in vivo et permet l'isolement et l'identification des protéines de liaison de l'ARNm de la plante à partir d'un environnement physiologique.

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Les protéines de liaison à l'ARN (RBP) déterminent le sort des ARN. Ils participent à toutes les voies de la biogenèse de l'ARN et contribuent en particulier à la régulation post-transcriptionnelle des gènes (PTGR) des ARN messagers (mRNA). Au cours des dernières années, un certain nombre de protéomes liés à l'ARNm provenant de lignées de levure et de cellules de mammifères ont été isolés avec succès en utilisant une nouvelle méthode appelée "capture d'interconnexion d'ARNm", qui permet l'identification de protéines de liaison d'ARNm (mRBP) Directement à partir d'un environnement physiologique. Le procédé se compose de in vivo perles ultraviolet (UV) réticulation, pull-down et une purification des complexes de ribonucléoprotéine messager (les mRNP) par oligo (dT), et l'identification ultérieure des protéines réticulées par spectrométrie de masse (MS). Très récemment, en appliquant la même méthode, plusieurs protéomes liés à l'ARNm de plantes ont été signalés simultanément à partir de différentes sources de tissus d' Arabidopsis : semis étiolés, tissu de feuilles,Les protoplastes de mésophylle des feuilles et les cellules racines cultivées. Ici, nous présentons la méthode optimisée de capture de l'interaction de l'ARNm pour les protoplastes de la mésophylle de la feuille d' Arabidopsis thaliana , un type de cellule qui sert d'outil polyvalent aux expériences qui incluent divers essais cellulaires. Les conditions pour un rendement optimal en protéines comprennent la quantité de tissu de départ et la durée de l'irradiation UV. Dans le protéome lié à l'ARNm obtenu à partir d'une expérience à moyenne échelle (10 7 cellules), les RBP ont constaté que la capacité de liaison à l'ARN était surreprésentée et de nombreuses RBP nouvelles ont été identifiées. L'expérience peut être mise à l'échelle (10 9 cellules), et la méthode optimisée peut être appliquée à d'autres types et espèces de cellules végétales pour isoler, cataloguer et comparer les protéomes liés aux ARNm dans les plantes.

Introduction

Les eucaryotes utilisent plusieurs voies de régulation de la biogenèse de l'ARN pour maintenir les processus biologiques cellulaires. Parmi les types connus d'ARN, l'ARNm est très diversifié et porte la capacité de codage des protéines et leurs isoformes 1. La voie PTGR dirige le sort des pré-ARNm 2 , 3 . Les RBP de différentes familles de gènes contrôlent la régulation de l'ARN, et dans PTGR, les mRBP spécifiques guident les ARNm par des interactions physiques directes, formant des mRNP fonctionnels. Par conséquent, l'identification et la caractérisation des mRBP et de leurs mRNP sont essentiels pour comprendre la régulation du métabolisme de l'ARNm cellulaire 2. Au cours des trois dernières décennies, diverses méthodes in vitro - y compris les tests de changement de mobilité électrophorétique de l'ARN (REMSA), l'évolution systématique des ligands par des essais d'enrichissement exponentiel (SELEX) basé sur des constructions dérivées de bibliothèque, RNA Bind-n-Seq (RBNS), radiomarquées ou quantitativesLes essais de liaison à l'ARN de fluorescence, la cristallographie aux rayons X et la spectroscopie RMN 4 , 5 , 6 , 7 , 8 , 9 - ont été largement appliqués aux études de RBP, principalement à partir de cellules de mammifères. Les résultats de ces études sur les RBP de mammifères peuvent être recherchés via la base de protéines de liaison à l'ARN (RBPDB), qui collecte les observations publiées 10 .

Bien que ces approches in vitro soient des outils puissants, elles déterminent les motifs d'ARN liés à partir d'un groupe d'ARN donné de séquences et sont donc limitées dans leur capacité à découvrir de nouveaux ARN cible. Il en va de même pour les stratégies informatiques pour prédire les RBP à l'échelle du génome, qui sont basées sur la conservation de la séquence et de la structure des protéines 15 . Pour remédier à cela, une nouvelle méthode expérimentale haA été établi qui permet d'identifier les motifs d'ARN auxquels une RBP d'intérêt interagit, ainsi que pour déterminer l'emplacement précis de la liaison. Cette méthode, appelée «réticulation et immunoprécipitation» (CLIP), est composée d'une réticulation UV in vivo suivie d'une immunoprécipitation 11 . Les premières études ont montré que la photoactivation des nucléotides d'ADN et d'ARN peut se produire à des longueurs d'onde UV d'excitation supérieures à 245 nm. La réaction à travers la thymidine semble être favorisée (classement par ordre de diminution de la photoréactivité: dT ≥ dC> rU> rC, dA, dG) 12 . En utilisant une lumière UV avec une longueur d'onde de 254 nm (UV-C), on a observé que des liaisons covalentes entre des nucléotides d'ARN et des résidus de protéines sont créées dans la gamme de seulement quelques Angstroms (Å). Le phénomène est donc appelé la réticulation "nulle" de l'ARN et du RBP. Ceci peut être suivi d'une procédure de purification rigoureuse Dure peu de fond 13 , 14 .

Une stratégie complémentaire de CLIP consiste à combiner la réticulation UV in vivo avec l'identification des protéines pour décrire le paysage des RBP. Un certain nombre de protéome tels lié ARNm-pangénomiques ont été isolées à partir de cellules de levure, les cellules souches embryonnaires (CSE), et des lignées cellulaires humaines (c. -à- HEK293 et HeLa) en utilisant cette nouvelle approche expérimentale, appelée « ARNm interactome capture » 18, 19 , 20 , 21 . Le procédé est composé d'une réticulation UV in vivo suivie d'une purification de mRNP et d'une protéomique à base de MS. En appliquant cette stratégie, on a découvert de nombreuses RBP romantiques "Moonlighting" contenant des RBD non canoniques, et il est devenu évident que plus de protéines ont des capacités de liaison à l'ARN que précédemment supposées"> 15 , 16 , 17. L'utilisation de cette méthode permet de nouvelles applications et la capacité de répondre à de nouvelles questions biologiques lors de l'étude des RBP. Par exemple, une étude récente a étudié la conservation du protéome lié à l'ARNm (RBP de base Protéome) entre la levure et les cellules humaines 22 .

Les RBP des plantes ont déjà été impliquées dans la croissance et le développement ( p . Ex ., Dans la régulation post-transcriptionnelle du temps de floraison, de l'horloge circadienne et de l'expression des gènes dans les mitochondries et les chloroplastes) 24 , 25 , 26 , 27 , 28 , 29 . En outre, on pense qu'ils exercent des fonctions dans les processus cellulaires répondant aux contraintes abiotiques ( p. Ex., Froid, sécheresse, saLinity et abscisic acid (ABA)) 31 , 32 , 33 , 34 . Il existe plus de 200 gènes de RBP prédits dans le génome d' Arabidopsis thaliana , basés sur des motifs de séquence de domaine de reconnaissance d'ARN (RRM) et de K (HK) d'homologie (KH); Dans le riz, environ 250 ont été notés 35 , 36 . Il est remarquable que de nombreuses RBP prédites semblent être uniques aux plantes ( p. Ex., Aucun orthologue métazoaire à environ 50% des RBP d' Arabidopsis prédites contenant un domaine RRM) 35 , suggérant que beaucoup peuvent servir de nouvelles fonctions. Les fonctions de la plupart des RBP prédites restent non caractérisées 23 .

L'isolement des protéomes liés à l'ARNm provenant des semis étiolés d' Arabidopsis , des tissus foliaires, des cellules racines cultivées et des protoplastes de mésophylle foliaire par l'utilisation deLa capture de l'interaction de l'ARNm a récemment été rapportée 38 , 39 . Ces études démontrent le fort potentiel de catalogage systématique de RBP fonctionnelles dans les plantes dans un proche avenir. Ici, nous présentons un protocole pour la capture de l'interaction de l'ARNm à partir de protoplastes végétaux ( c.-à-d. Cellules sans parois cellulaires). Les protoplastes de mésophylle de la feuille d' Arabidopsis thaliana sont le principal type de cellule foliaire. Les protoplastes isolés permettent un accès optimal de la lumière UV aux cellules. Ce type de cellule peut être utilisé dans des analyses qui expriment de manière transitoire des protéines pour la caractérisation fonctionnelle 40 , 41 . En outre, le protoplage a été appliqué à plusieurs autres types de cellules végétales et aux espèces 42 , 43 , 44 ( p. Ex., Petersson et al ., 2009; Bargmann et Birnbaum, 2010; et Hong et al ., 2012).

<P class = "jove_content"> La méthode englobe un total de 11 étapes ( Figure 1A ). Les protoplastes de mésophylle de la feuille d' Arabidopsis sont d'abord isolés (étape 1) et sont par la suite irradiés par UV pour former des mRNP réticulés (étape 2). Lorsque les protoplastes sont lysés dans des conditions de dénaturation (étape 3), les mRNP réticulés sont libérés dans un tampon de lyse / liaison et abattus par des billes oligo-d (T) 25 (étape 4). Après plusieurs cycles de lavages rigoureux, les mRNP sont purifiés et analysés plus avant. Les peptides dénaturés des mRBP sont digérés par la protéinase K avant que les ARNm réticulés ne soient purifiés et que la qualité de l'ARN soit vérifiée par qRT-PCR (étapes 5 et 6). Après le traitement par RNase et la concentration de protéines (étape 7), la qualité de la protéine est contrôlée par électrophorèse sur gel de polyacrylamide SDS (SDS-PAGE) et coloration à l'argent (étape 8). La différence entre les bandes de protéines peut facilement être visualisée entre un échantillon réticulé (CL) et un échantillon non réticulé (non CL;L'échantillon témoin négatif des protoplastes qui n'est pas soumis à une irradiation UV). L'identification des protéines est obtenue grâce à une protéomique à base de MS. Les protéines provenant de l'échantillon CL sont séparées par une électrophorèse en gel de polyacrylamide unidimensionnel (1D-PAGE) pour éliminer la contamination potentielle du fond, sont "digérées dans un gel" en peptides courts en utilisant de la trypsine et sont purifiées (étape 9). La chromatographie liquide à phase inverse nano couplée à la spectrométrie de masse (nano-LC-MS) permet de déterminer la quantité de protéines définitives dans le protéome lié à l'ARNm (étape 10). Enfin, les mRBP identifiés sont caractérisés et catalogués à l'aide d'une analyse bioinformatique (étape 11).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Isolation du Protoplaste Mésophylle des feuilles d' Arabidopsis

NOTE: Les protoplastes de la mésophylle de la feuille d' Arabidopsis sont essentiellement isolés comme décrit par Yoo et al ., 2007, avec plusieurs modifications 40 .

  1. Croissance des plantes
    1. Faire tremper environ 200 graines Arabydopsis thaliana Col-0 ecotype dans de l'eau stérilisée pendant 2 jours à 4 ° C dans l'obscurité pour la stratification.
      NOTE: Ce nombre de graines est suffisant pour un échantillon non CL et un échantillon CL (voir l'étape 1.3).
    2. Préparer des pots avec un mélange de terre et de vermiculite à 50% ( v / v ) et tremper les pots avec de l'eau distillée dans un bac pour mouiller le sol.
    3. Semer et distribuer les graines stratifiées sur un sol humide. Ne pas couvrir les graines avec du sol supplémentaire parce que les graines d' Arabidopsis ont besoin de lumière pour la germination.
      NOTE: Les conditions de croissance des plantes sont un cycle de 12 h de lumière / 12 h à 23 ° C,Avec une intensité lumineuse de 100 μmol m -2 s -1 , dans une salle de croissance pendant 5 semaines avant la floraison. Les plantes de 4 semaines peuvent également être utilisées 40 .
      REMARQUE: Tous les matériaux décrits et les réactifs de l'étape 1.2.1 à l'étape 3.2.3 sont pour deux échantillons ( c.-à-d., Un échantillon non CL (l'échantillon témoin qui n'est pas soumis à une irradiation UV-C) et un échantillon CL (la recherche Échantillon soumis à une irradiation UV-C)).
  2. Préparation de la solution enzymatique isotonique
    1. Faire 80 ml de solution d'enzyme isotonique primaire (400 mM de mannitol, 20 mM de KCl et 20 mM de tampon MES (pH 5,7)) et chauffer immédiatement la solution dans un incubateur à 60 ° C pendant 10 min.
    2. Ajouter 1,2 g de Cellulase R10 ( p / v 1,5%) et 0,32 g de Macerozyme R10 ( p / v 0,4%) en poudre à la solution d'enzyme isotonique primaire chaude.
    3. Apportez soigneusement la poudre d'enzyme en solution en appliquant une agitation douce. RapChauffer à vide la solution dans un incubateur à 60 ° C pendant 10 minutes jusqu'à ce que la solution enzymatique soit claire et claire.
    4. On refroidit la solution sur de la glace pendant 3 minutes et ajouter 800 pl de 1 M de CaCl2 et 800 uL de 10% (p / v) de BSA à la solution.
    5. Homogénéiser la solution en pipetant et en filtrant à travers un filtre de 0,22 μm. Aliquotez cette solution finale d'enzyme isotonique dans deux boîtes de Petri à grande échelle (150 mm x 20 mm).
  3. Préparation des bandes de feuilles de rosette Arabidopsis
    REMARQUE: 150 feuilles pour chaque plat de Petri sont recommandées pour un échantillon non CL ou un échantillon CL.
    1. Choisir et couper un total de 300 entièrement étendu 2 ème - 3 ème ou -paire vraies feuilles (moyenne: 3 - 4 par rosette) dans 0,5 à 1 mm des bandes de feuilles en utilisant une nouvelle lame de rasoir tranchante.
    2. Transférer et immerger les bandes immédiatement dans la solution d'enzyme isotonique.
      REMARQUE: pour éviter tout contact avec la lumière, couvrez toujours tLes boîtes de pétri avec du papier d'aluminium. Ne pas écraser les feuilles. Confirmez que toutes les bandes sont immergées dans la solution et qu'elles ne flottent pas sur la surface.
  4. Isolation des protoplastes de la mésophylle des feuilles d' Arabidopsis
    1. Placez les boîtes de Petri recouvertes de feuilles d'aluminium dans des déshydrateurs sous vide et infiltrez les bandes de feuilles sous vide pendant 30 min. Par la suite, incuber les boîtes de Petri dans l'obscurité sans tremper à température ambiante pendant 2,5 h.
    2. Agiter doucement et brièvement la vaisselle horizontalement à la main, en essayant de libérer les protoplastes entièrement dans la solution enzymatique.
  5. Récolter et compter les protoplastes
    1. Filtrer la suspension de protoplastes à travers une maille de nylon de 35 à 75 μm. Aliquoter le filtrat de chaque échantillon dans deux tubes à fond rond de 50 ml (environ 20 ml de filtrat dans chaque tube).
    2. Rincer chaque boîte de Pétri avec 10 ml de tampon W5 (NaCl 154 mM, CaCl 125 mM
    3. Faites tourner tous les quatre tubes pendant 5 min à 100 xg pour granuler les protoplastes. Jeter le surnageant et restreindre doucement les pastilles de protoplastes dans chaque tube avec 10 ml de tampon W5.
      REMARQUE: Lors de la remise en suspension des pastilles de protoplastes, renversez doucement le tube à l'envers et tournez doucement le tube à la main jusqu'à ce que les pastilles aient disparu. Ne pas pipeter la pastille directement pour éviter d'endommager les cellules.
    4. Répétez l'étape 1.5.3 une fois et combinez la suspension de protoplaste de deux tubes de chaque échantillon dans un tube à fond rond de 50 ml. Gardez les tubes sur la glace.
    5. Comptez les protoplastes en utilisant un hémocytomètre.
      NOTE: Chaque 20 cellules dans 25 cubes est égale à 2 x 10 5 protoplastes / mL. 150 feuilles devraient produire environ 1 x 10 7 cellules.Moduler pour avoir un nombre total égal de protoplastes dans les échantillons non CL et CL.
    6. Garder les protoplastes sur de la glace pendant 30 min. Ensuite, faites tourner les tubes pendant 5 min à 100 x g. Jeter le surnageant et remettre en suspension les protoplastes dans chaque tube avec 20 ml de solution MMg (400 mM de mannitol, 15 mM de MgCl2 et 4 mM de tampon MES (pH 5,7)).

2. In-Vivo mRNA-protein Crosslinking par rayonnement UV

REMARQUE: conservez le tube échantillon non-CL sur glace. L'échantillon CL doit être immédiatement irradié par UV.

  1. Transférer la suspension de protoplastes contenant 1 x 10 7 cellules du tube d'échantillon CL à une nouvelle boîte à Pétri à grande échelle (150 mm x 20 mm) et ajouter 30 ml de solution de MMg glacée pour recouvrir la surface de la plaque. Faites passer les cellules dans l'ensemble du tampon MMg par un pipetage doux. Placez immédiatement la boîte à pétri sans le couvercle supérieur dans un appareil de réticulation UV.
    REMARQUE: la hauteur entre la lampe UVEt la boîte à pétri est de 8 cm.
  2. Irradier l'échantillon avec une lumière UV de longueur d'onde de 254 nm et 0,00875 W / cm 2 d'intensité UV pendant 1 min, 3 min ou 5 min. Après l'irradiation, aliquote rapidement la suspension de protoplastes dans deux nouveaux tubes à fond rond de 50 ml. Lavez le fond du plat avec un supplément de 5 ml de solution de MMg glacée pour collecter le reste des protoplastes et ajoutez cette suspension de cellules à ces deux tubes.
    REMARQUE: 1 min a été choisi comme condition optimale. L'explication se trouve dans les résultats représentatifs .

3. Lysis de protoplastes dans des conditions de dénaturation

  1. Préparation des pastilles de protoplastes pour la lyse
    1. Faites tourner le tube d'échantillon non CL avec les deux tubes d'échantillon CL de l'étape 2 à 100 xg pendant 5 minutes et jeter le surnageant. Placez le tube de la pastille de protoplaste d'échantillon non CL sur la glace.
    2. Ajouter 10 ml de solution de MMg glacée à chaque tube d'échantillon CL, genRemettez en suspension les granulés et mélangez-les dans un tube à fond rond de 50 ml. Faire tourner le tube à 100 xg pendant 5 min. Après avoir enlevé le surnageant, retirez la pastille de protoplaste du tube d'échantillon CL sur de la glace.
  2. Lysite de protoplastes et lysat de protoplastes homogénéisés
    1. Ajouter 9 ml de tampon de lyse / liaison glacée (500 mM de LiCl, 0,5% ( p / v ) de Dodécyl Sulfate de Lithium (LiDS), 5 mM de Dithiothréitol (DTT), 20 mM de Tris-HCl (pH 7,5) et 1 mM EDTA (pH 8,0)) à la pastille cellulaire de chaque échantillon. Lisser lentement les protoplastes en pipetant vers le haut et vers le bas environ 20 fois jusqu'à ce que la suspension soit uniformément verte.
    2. Passer le lysat de protoplastes deux fois par une seringue en verre de 50 ml avec une aiguille étroite (0,9 x 25 mm 2 ) pour l'homogénéisation. Incuber le lysat sur de la glace pendant 10 min. Geler les lysats dans de l'azote liquide et conserver à -80 ° C pendant 3 semaines.

4. Traitement et purification de mRNPPar Oligo-d (T) 25 perles

REMARQUE: Tous les matériaux et réactifs décrits ci-après, de l'étape 4.1 à l'étape 4.4, sont uniquement pour un échantillon ( c.-à-d., Un échantillon non CL ou un échantillon CL). Le lysat de protoplastes doit être ajouté immédiatement aux tubes contenant des billes après que le tampon de lysite / liant surnageant de talon est mis au rebut.

  1. Préparation de perles magnétiques oligo-d (T) 25 pour la capture d'oligo (dT)
    1. Décongeler le lysat de protoplastes congelés à température ambiante. Lorsque le lysat est complètement décongelé, garder le tube de lysat sur la glace.
    2. Aliquotez 1,8 ml de perles magnétiques oligo-d (T) 25 (5 mg / mL) dans 6 nouveaux tubes de microcentrifugeuse à fond rond de 2 ml sur glace. Dans chaque tube, laver la suspension de talon de manière homogène avec 600 μL de tampon de lyse / liaison en pipetant rapidement vers le haut et vers le bas et en faisant tourner doucement à 4 ° C pendant 2 min. Gardez les perles sur la glace.
  2. Contraignant
    1. EndroitTous les 6 tubes contenant les perles dans une grille magnétique à 4 ° C pendant 3 min, ce qui entraînera la capture magnétique des perles et le déblais de la suspension.
      REMARQUE: Lorsque les tubes sont placés dans le rack magnétique, attendez que les perles soient complètement capturées, au moins 3 min.
    2. Jeter le surnageant et aliquoter immédiatement 9 mL de lysat de protoplastes dans ces 6 tubes. Mélangez bien en pipetant jusqu'à ce qu'une suspension brune homogène apparaisse et incube les perles dans le lysat de protoplastes à 4 ° C pendant 1 h en appliquant une rotation douce.
      NOTE: Un temps d'incubation de 30 min à 1 h est recommandé.
  3. La lessive
    1. Remettre les tubes dans la grille magnétique à 4 ° C pendant 3 min. Lorsque toutes les perles sont capturées sur le côté des tubes, collecter le lysat de protoplastes dans 6 nouveaux tubes de microcentrifugeuse à fond rond de 2 mL et les stocker temporairement à 4 ° C. NE PAS jeter immédiatement le lysat de protoplaste; Garder le lysatÀ 4 ° C.
    2. Ajouter 1,5 ml de tampon de lavage glacé 1 (500 mM de LiCl, 0,1% ( p / v ) de LiDS, 5 mM de DTT, 20 mM de Tris-HCl (pH 7,5) et 1 mM d'EDTA (pH 8,0)) sur les billes Dans chaque tube. Remettre en suspension les perles et appliquer une rotation douce pendant 1 min. Remettre les tubes dans la grille magnétique à 4 ° C pendant 3 min et jeter le surnageant. Répétez cette étape de lavage avec un tampon de lavage une fois.
    3. Répéter le même procédé de cette étape de lavage deux fois en utilisant 1,5 ml de tampon de lavage glacé 2 (LiCl 500 mM, DTT 5 mM, Tris-HCl 20 mM (pH 7,5) et EDTA 1 mM (pH 8,0)) et une fois utilisé 1,5 ml de tampon à faible teneur en sel glacé (LiCl 200 mM, Tris-HCl 20 mM (pH 7,5) et EDTA 1 mM (pH 8,0)).
      REMARQUE: Si les mRNP ont été efficacement isolés à partir du lysat de protoplastes, il devrait y avoir un «halo» visible autour de la pastille de talon dans l'échantillon CL pendant l'étape de lavage avec le tampon de lavage 2 ( Figure 1B ).
  4. Elution
    1. Ajouter 500 μLDe tampon d'élution (Tris-HCl 20 mM (pH 7,5) et EDTA 1 mM (pH 8,0)) sur les billes dans chaque tube. Remplacer doucement les perles et incuber à 50 ° C pendant 3 min pour libérer les ARN à base de poly (A). Remplacer doucement les perles une fois par pipettage. Remettre les tubes dans la grille magnétique à 4 ° C pendant 5 min.
    2. Transférer et combiner tous les éluants (environ 3 ml au total) à un tube de fond conique sans 15 RNase, stérile et propre, sur la glace.
      NOTE: La qualité et la quantité d'ARN peuvent être déterminées immédiatement à l'aide d'un appareil à spectrophotomètre.
      NOTE: La concentration d'ARN de chaque échantillon est d'environ 10 ng / μL, avec un rapport A 260 / A 280 de 1,9. Le rapport A 260 / A 280 doit être compris entre 1,6 et 2,0, car les ARN à l'aide d'un poly (A) isolé sont habituellement supérieurs à 70% purs. Si la concentration d'ARN est trop faible, augmenter le nombre de protoplastes de départ à un maximum de 10 9 . ÉchantillonsPeuvent être congelés dans de l'azote liquide et conservés à 80 ° C pour un stockage à long terme.
    3. Répétez l'étape 4.2 à l'étape 4.4 pour deux autres rondes supplémentaires et réutilisez les billes oligo-d (T) 25 pour épuiser les ARN à base de poly (A) du lysat de protoplaste.
      REMARQUE: Après trois cycles de procédure déroulante, il devrait y avoir 9 ml d'éluant pour chaque échantillon non CL ou CL. Effectuer tous les travaux à 4 ° C pour éviter la dégradation de l'ARN. Suivez l'étape 4.5 ou l'étape 4.6 pour réutiliser ou régénérer les perles.
  5. Préparation des perles oligo-d (T) 25 réutilisées
    1. Laver les billes deux fois avec 1 ml de tampon d'élution glacé et une fois avec 1 ml de lyse glacé / tampon de liaison pour ajuster la concentration de LiCl au départ à 500 mM.
    2. Suivez l'étape 4.1, jeter le surnageant, transférer le lysat de protoplaste stocké dans chaque tube et répéter l'ensemble de la procédure de l'étape 4.2 à l'étape 4.4 pour deux autres rondes.
  6. 25 perles
    REMARQUE: Les perles peuvent être stockées et utilisées pour une autre expérience (la réutilisation maximale est trois fois).
    1. Suivre l'étape 4.4, ajouter 1 ml de NaOH 0,1 M aux perles et incuber en faisant tourner à température ambiante pendant 5 min. Pour chaque tube, laver deux fois avec 1 ml de tampon de lavage 1 et trois fois avec 1x PBS (pH 7,4) contenant 0,1% de Tween-20 pour équilibrer. Garder les billes de chaque tube dans 300 μL de 1x PBS stérile sans RNase (pH 7,4) contenant 0,1% de Tween-20 à 4 ° C pour un stockage à long terme.
      REMARQUE: Les perles utilisées pour les échantillons CL d' Arabidopsis dans cette expérience ne peuvent être utilisées que pour les mêmes échantillons de plantes la prochaine fois.

5. Traitement de protéinase K et purification d'ARNm

  1. Traitement de la protéinase K
    1. Ajouter 8 μl de solution de protéinase K (2 μg / μL) à 1 ml de l'éluant de chaque échantillon pour digérer les protéines réticulées par UV. BrVortex vif.
  2. Purification d'ARNm
    1. Incuber l'éluant à 37 ° C pendant 1 h. Purifier l'ARN en utilisant le kit de purification d'ARN pour éliminer les contaminants résiduels.
      REMARQUE: après purification, les ARN sont prêts pour le test de qualité de l'ARN en utilisant le test qRT-PCR.
      REMARQUE: D'autres kits, tels que le kit miniature RNA et le réactif TRIzol, peuvent également être utilisés 14 .

6. Test qRT-PCR

  1. Transcription inversée
    1. Atteindre une synthèse efficace de l'ADNc de premier brin en utilisant le système de transcription inverse, avec 1 μg d'ARN comme modèle. Diluer l'échantillon à 5 ng / μL avec de l'eau exempte de nuclease.
  2. Quantification d'ADNc utilisant qRT-PCR
    1. Amplifier et quantifier l'ADNc en utilisant le mélange maître qPCR et le cycler PCR en temps réel, avec 10 ng d'ADNc comme modèle. Utilisez le programme de PCR suivant: 95 ° C pendant 10 minutes(Étape 1, un cycle) et 95 ° C pendant 15 s et 60 ° C pendant 1 min (étape 2, 40 cycles).
      NOTE: Le gène de référence utilisé ici était un gène de contrôle interne endogène, UBQ10 (AT4G05320). Les amorces de qRT -PCR pour l'ARNr UBQ10 et 18S ont été décrites dans Li et al ., 2014 et Durut et al ., 2014, respectivement 45 , 46 . Les séquences d'amorces sont répertoriées dans la table des matériaux .

7. Traitement par RNase et concentration de mRBP

  1. RNase de traitement
    1. Ajouter environ 100 U de RNase cocktail contenant RNase A et RNase T1 dans 8 mL d'éluant. Inclure un échantillon de contrôle négatif avec un cocktail RNase dans lequel l'éluant est remplacé par de l'eau exempte de nuclease. En bref, tourbillonner et incuber à 37 ° C pendant 1 h.
  2. Concentration de mRBP
    1. Après la digestion par RNase, concentrez-vous l'éluantG unités de filtration centrifuges. Le volume final est de 75 μL, avec un rendement protéique total d'environ 2 μg de chaque échantillon après concentration. Placez les échantillons à -80 ° C pour un stockage à long terme.

8. SDS-PAGE et coloration argentée

  1. SDS-PAGE
    1. Mélanger 25 μL de l'éluant concentré (échantillon CL) ou l'échantillon témoin (échantillon non CL) avec 15 μL de colorant de chargement 2x. Chauffer l'échantillon à 95 ° C pendant 5 min et le charger sur un gel SDS-PAGE contenant 5% de gel d'empilage et 12% de gel résolvant, y compris un marqueur protéique.
    2. Condenser les protéines à 60 V pendant 40 minutes et séparer à 160 V pendant environ 1 h jusqu'à ce que le colorant de chargement atteigne la fin du gel de résolution.
  2. Test de coloration d'argent
    1. Lavez le gel SDS-PAGE deux fois avec de l'eau ultrapure pendant 5 minutes à chaque fois. Effectuer la coloration argentée des protéines à l'aide d'un kit commercial de taches d'argent.
      REMARQUE: les bandes de protéines doivent être affichées dans les 5 minutes. Si les bandes sont visibles au-delà de 5 min avec une couleur très claire, il est suggéré d'augmenter le nombre de protoplastes de départ jusqu'à 10 9 .

9. Digest de trypsine de bandes de protéines et de purification de peptide

  1. Digest de trypsine
    REMARQUE: exécuter un deuxième gel 1D-PAGE en prenant encore 25 μL de solution concentrée de mRBP de chaque échantillon pour l'identification du mRBP; Les gels colorés à l'argent ne peuvent être utilisés car ils ne sont pas compatibles avec l'analyse MS.
    1. Après avoir couru le gel 1D-PAGE, réparer le gel dans une solution de fixation (50% ( v / v ) de methanol et 10% ( v / v ) d'acide acétique pendant 1 h. Mélanger le gel dans la solution de taches (0,1% ( p / v ) de Coomassie Brilliant Blue R-250, 50% ( v / v ) de methanol et 10% ( v / v ) d'acide acétique) pendant 20 minutes avec un tremblement doux. Découper le gel dans la solution de déstain (40% ( v / v ) de methanol et 10% ( v/ V) acide acétique) pendant 1 h. Après décoloration, conserver le gel dans de l'acide acétique à 5% ( v / v ).
      REMARQUE: lors de la décapage, une nouvelle solution de déstain peut être remplacée jusqu'à ce que l'arrière-plan soit complètement décoloré.
    2. Découpez les bandes d'intérêt du gel. Couper les bandes en morceaux d'environ 1 mm 3 pour la digestion de la trypsine optimale et l'extraction des peptides. Hydrater les morceaux de gel avec 50 μL de bicarbonate d'ammonium 100 mM (NH 4 HCO 3 ) pendant 10 minutes. Couvrez complètement les morceaux de gel.
      1. Retirer la solution d'hydratation avec soin et déshydrater les morceaux de gel avec de l' acétonitrile (CH 3 CN) pendant 10 min. Retirez délicatement la solution d'acétonitrile.
      2. Répétez le processus de l'hydratation à la déshydratation deux fois. Enfin, retirer la solution d'acétonitrile.
        REMARQUE: Le temps de fonctionnement du gel dépend du but de l'expérience. Un temps prolongé permet une bonne séparation des protéines, de sorte que l'interdiction de gel spécifique coloréeDs peut être coupé pour une analyse plus approfondie. Si l'objectif est de conserver les protéines et d'éliminer les contaminants, un court temps de fonctionnement est suffisant.
    3. Ajouter 500 μL de solution de DTT 6,6 mM et incuber les morceaux de gel pendant 10 min. Retirez la solution de DTT et lavez les morceaux de gel deux fois avec 500 μl de solution d'acétonitrile à 95% ( v / v ).
      1. Après le lavage, éliminer la solution d'acétonitrile et incuber les morceaux de gel avec 500 μl de solution d'acide iodoacétique 55 mM (IAA) pendant 10 min dans l'obscurité.
      2. Après incubation, retirer la solution et laver de nouveau les morceaux de gel avec 500 μl de solution d'acétonitrile à 95% ( v / v ). Séchez les morceaux de gel.
    4. Intégrer complètement les morceaux de gel avec 25 μL de tampon de digestion (50 mM NH 4 HCO 3 , 5 mM CaCl 2 et 6 ng / μL de trypsine) et maintenir sur de la glace pendant 45 minutes pour laisser passer la trypsine dans le gel. Incuber les morceaux de gel pendant une nuit à 37 ° C pour en Digestion zymatique.
  2. Purification du peptide
    1. Ajouter 80 pl de 50 mM de NH 4 HCO 3 pour les morceaux de gel dans le tampon de digestion et de vortex à plusieurs reprises pour extraire les peptides tryptiques. Recueillir l'extrait. Répéter cette étape d'extraction deux fois avec 80 ul de 50% (v / v) CH 3 CN et 5% (v / v) d' acide formique (FA).
      NOTE: L'extrait final total doit être d'environ 240 μL.
    2. Pousser et concentrer les extraits dans environ 10 μL par concentration sous vide ou lyophilisation et ajouter 25 μL de solution aqueuse d'acide trifluoroacétique (TFA) 0,1% ( v / v ). Découper les échantillons avec des colonnes μ-C18, suivant le protocole du fabricant.
    3. Éluer les peptides avec 4 - 10 ul de 60% (p / v) CH 3 CN et 0,1% (v / v) FA. Lyophiliser (congéler) les peptides et les conserver à -20 ° C jusqu'à l'analyse.
Titre "> 10. Nano-LC-MS

  1. Chromatographie liquide Nano en phase inverse
    REMARQUE: effectuez l'analyse LC-MS avec un spectromètre de masse couplé en ligne avec un instrument de chromatographie liquide. Cet instrument devrait être équipé d'une colonne C18 (particule de 2 μm, taille de pores de 100 Å et dimension de 50 μm x 15 cm).
    1. Resuspendre les peptides lyophilisés dans 16 pl de solution (2% (v / v) CH 3 CN et 0,1% (v / v) FA). Injecter et charger 5 μL de solution peptidique à un débit de 5 μL / min sur une précolonne C18 (taille de particule de 3 μm, taille de pores de 100 Å, nanoviper et dimension de 75 μm x 2 cm).
    2. 10.1.2. Séparez les peptides en utilisant un gradient de 95 minutes avec un débit de 300 nL / min. Au cours de ce gradient de séparation, augmenter la phase mobile B de 4% à 10%, 10% à 25% et 25% à 45% en 5 min, 50 min et 18 min respectivement. Enfin, augmente fortement la phase mobile B à 95% en 1 min. AprèsChaque gradient de séparation de 95 minutes, appliquer une étape de rinçage inhérente contenant un gradient de 10 minutes de 4% à 95% en 5 minutes.
      NOTE: La phase mobile A est 99,9% H 2 O et 0,1% ( v / v ) FA, et la phase mobile B est 19,92% H 2 O, 80% ( p / v ) CH 3 CN et 0,08% ( v / v ) FA.
  2. Étude de spectrométrie de masse
    1. Utilisez le spectromètre de masse en mode dépendant de la donnée avec une plage de masse de 400 à 1 600 m / z.
    2. Sélectionnez jusqu'à dix des ions les plus intenses dans MS1 pour générer les spectres de fragmentation. Réglez la résolution à 70 000 de largeur totale à mi-maximum (FWHM) pour MS1 et 17 000 pour MS2, avec une cible de contrôle automatique de gain (AGC) de 3 000 000 et 1 000 000 d'ions et un temps d'injection d'ion (IT) maximum de 256 et 64 ms pour MS1 Et MS2, respectivement.
    3. Réglez l'exclusion dynamique sur 10 s pour éviter la fragmentation répétée des ions les plus abondants.
      REMARQUE: Ici, les ions d'une ou plus de six charges sont eXclus pour MS2.
  3. La protéomique qualitative: identification des peptides et des protéines
    1. Analyser les spectres de fragmentation en utilisant un logiciel tel que Peaks studio software 47 , 48 , 49 .
      REMARQUE: D'autres logiciels sont également disponibles pour l'identification des peptides, tels que NovoHMM 30 et PepNovo 37 pour le séquençage de novo et SEQUEST 54 et Mascot 55 pour la recherche de bases de données.
    2. Combinez les spectres avec la même masse (<différence de 2 ppm) et les temps de rétention (<2 min) et ne conservez que les spectres avec un seuil de qualité supérieur à 0,65 pour rechercher la base de données Swiss-Prot (version: décembre 2013) pour la modélisation de la taxonomie Plante Arabidopsis thaliana . Utilisez les paramètres de recherche suivants: une tolérance de masse précurseur de 10 ppm par l'utilisation du monMasse oisotopique; Une tolérance de masse de fragments de 20 mmu; La trypsine comme enzyme de digestion, avec un maximum de 2 clivages oubliés; La carbamidométhylation de cysteine ​​comme modification définitive; L'oxydation de la méthionine en tant que modification variable; Et un maximum de 3 modifications post-traductionnelles variables par peptide. Après l'identification, définissez manuellement les seuils de score pour une identification sûre des peptides et des protéines, de sorte qu'un taux de découverte fausse (FDR) <5% soit acquis.
  4. Protéomique quantitative: analyse statistique des données de spectrométrie de masse
    1. Utilisez LC-MS ( p. Ex . Progenesis) pour la quantification sans étiquette des données protéomiques.
      REMARQUE: les zones de pointe du peptide MS1 (ou l'intensité) sont liées aux peptides identifiés par le logiciel de studio en fonction de leur masse, avec l'erreur tolérée à un maximum de 10 ppm.
      NOTE: Ce logiciel calcule l'abondance d'un peptide en intégrant les zones de pointe de tous les états de charge entre 2 <Sup> + et 8 + . Les données quantitatives sont liées à l'identification du peptide PEAKS par un script interne (correspondance de masse avec l'erreur tolérée au maximum de 10 ppm).
    2. Calculez les modifications moyennes de log2-fold (CL / non-CL) pour chaque peptide. Organiser les changements de pli des peptides uniques par des protéines.
      NOTE: Dans chaque groupe, le changement de pli final d'une protéine est égal à la moyenne des changements de pli de ses peptides.
    3. Calculez la valeur p en utilisant le test t de Student pour chaque groupe afin d'évaluer la signification statistique. Appliquer le logiciel R (version 3.3.0) pour corriger les valeurs p pour le FDR de tous les groupes en utilisant la méthode Benjamini-Hochberg (BH).
    4. Dessinez le tracé du volcan en utilisant le paquet de fonctions "étalonner" (version 1.7.2) compatible avec le logiciel R (version 3.3.0).
      REMARQUE: Ici, les valeurs p ajustées en log10 (-log10 (valeur adj. P) sont fonction des changements log2-fold de toutes les protéines identifiées. Les protéines sontTraités comme des effets positifs dans le protéome lié à l'ARNm si leurs changements de log2-fold sont supérieurs à 2, avec ou sans importance.

11. Catalogue du Proteome identifié par l'ARNm

  1. Classifiez les protéines identifiées à partir de l'étape 10 en trois catégories en fonction des éléments de «fonctions moléculaires et processus biologiques» via la base de données Gene Ontology (GO) et «famille et domaine» via la base de données InterPro.
  2. Comme la catégorie I, ou «protéines ribosomales», contiennent toutes les protéines ribosomales détectées, définissent des protéines de la catégorie II ou des «RBP principaux», qui contiennent des domaines de protéines annotés qui interagissent avec des ARN ou qui lient la liaison à l'ARN avec des fonctions connues ou inconnues en biologie de l'ARN .
  3. Comme les protéines ayant des fonctions connues ou inconnues dans la biologie de l'ARN sans domaines de liaison RNA annotés sont placées dans la catégorie III, ou "RBP candidats", définissent les enzymes de la catégorie III basées sur les annotations du IBase de données ntEnz.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Nous avons observé un halo caractéristique, qui entoure la pastille de perles dans l'échantillon CL, dans l'étape de lavage 4.3 avec le tampon de lavage 2 ( Figure 1B ). Bien qu'il n'ait pas été étudié, ce phénomène s'explique probablement par l'interférence des complexes de mRNP réticulés avec l'agrégation des talons pendant la capture magnétique, ce qui provoque l'apparition d'un agrégat plus diffus. Il indique que la capture de perles oligo-d (T) 25 était effective 14 .

Les niveaux d'ARNm de référence UBQ10 significativement plus élevés que l'ARNr 18S dans les témoins non CL et les échantillons CL sont présentés à la Figure 1C . Cela indique que les ARNm sont enrichis dans l'éluant en raison de la capture par oligo-d (T) 25 perles, qui ne peuvent se lier qu'aux ARNm en poly (A). L'efficacité de la capture de perles oligo-d (T) 25 a été additionnelleOrted par SDS-PAGE et coloration à l'argent (étape 8), comme le montre la figure 1D après le traitement par RNase et la concentration de mRBP (étape 7). Une différence dans le diagramme de bande de protéines entre le contrôle non CL et les voies d'échantillons CL peut être clairement observée, et les bandes de protéines présentes dans la voie de l'échantillon de contrôle non CL peuvent s'expliquer par la présence de RNase. Ceci illustre le fort enrichissement des mRBP dans l'échantillon CL.

L'efficacité de la réticulation peut être contrôlée en modifiant la durée de l'irradiation UV. Une réticulation suffisante, mais l'évitement des dégats de protoplastes et la dégradation de l'ARN est optimale. Dans la figure 1D , des diagrammes de bande de protéines spécifiques dans tous les échantillons CL ont été obtenus lors de la comparaison de différents temps d'irradiation UV (1, 3 et 5 min). Sous la même intensité UV (0,00875 W / cm 2 ), les conditions les plus optimales se sont révélées être de 1 ou 3 minutes, en raison de l'indistinguableIntensité de bande de protéines. Des intensités de bande plus faibles ont été observées avec le temps de réticulation plus long (5 min). Nous considérons 1 minute comme l'état optimal, car une durée de réticulation plus courte a l'avantage supplémentaire d'un transfert et d'une collecte plus faciles des protoplastes de la boîte de Petri. Les protoplastes peuvent être précipités rapidement au fond de la boîte de Petri pendant l'irradiation UV car ils adhèrent au fond du plat. Il est plus difficile de les collecter et de les transférer dans les tubes après une plus longue durée d'irradiation UV.

Sur la base des conditions optimisées, l'identification des protéines à partir de trois répliques biologiques a ensuite été réalisée par une protéomique qualitative et quantitative, qui a été décrite aux étapes 9 et 10. Dans l'analyse par la protéomique qualitative ( Figure 1E , à droite), un total de 341 protéines Ont été identifiés dans des échantillons CL, dont 36 ont été trouvés à la fois en contrôle non-CL etD échantillons de CL, et seulement 8 protéines ont été détectées dans l'échantillon témoin non CL. Cette énorme différence dans les nombres de protéines identifiés entre les deux échantillons est compatible avec les différents modèles de bande de protéines ( Figure 1D ), soutenant l'idée que les tests SDS-PAGE et colorants à l'argent sont de bons outils pour valider l'efficacité de l'oligo-d (T) 25 capture de perles. Dans l'analyse par la protéomique quantitative ( Figure 1E , à gauche), un total de 325 protéines (de couleur bleu et vert) ont montré un changement de log2-fold supérieur à 2. Parmi ces protéines, 100 protéines (couleur bleue) avaient une petite taille -valles supérieures au niveau de signification. Par conséquent, ils ont également été définis comme des succès. Il est remarquable que les valeurs de p d'une autre 225 protéines (couleur verte) soient supérieures à 0,05, en dessous du niveau de signification en raison de l'écart de données. En d'autres termes, il y avait des peptides peu abondants présents pour chaque protéine, avec une forte variabilité de l'intensité du peptideEs. Cependant, parce que tous ont été détectés qualitativement uniquement dans des échantillons CL, ils ont été considérés comme positifs.

Sur la base des bases de données GO et InterPro 50 (étape 11), ces 325 protéines ont été classées dans la catégorie I (protéines ribosomales), catégorie II (principales RBP) et catégorie III (RBP candidates) ( figure 1F ). Il y avait 123 protéines ribosomales dans la catégorie I, tandis que dans la catégorie II, 70 RBP classiques annotées ont été observées. Ces deux catégories, qui contiennent la plupart des protéines annotées, se liant à la liaison moléculaire d'ARN et à la biologie de l'ARN ( Figure 1F , à droite) et qui occupent environ 38% et 22% du protéome entier lié à l'ARNm, respectivement, indiquent l'efficacité élevée de l'interaction de l'ARNm optimisé Capturer. Les derniers 40% (132 RBP candidats) ont été classés dans la catégorie III en raison du manque de RBD classiques. En outre, la plupart desSes rôles dans la liaison de l'ARN et les processus biologiques de l'ARN n'ont pas été validés ( Figure 1F , à gauche). Nous supposons que les protéines de cette catégorie pourraient révéler de nouvelles fonctions dans les règlements de l'ARN.

Figure 1
Figure 1: diagramme et résultats de la méthode optimisée pour découvrir le protéome lié à l'ARNm à partir des protoplastes de la mésophylle de la feuille d' Arabidopsis . ( A ) Les étapes principales de la méthode entière sont listées de 1 à 11. Les processus cellulaires et moléculaires putatifs sont illustrés par la photo et les dessins animés. Les détails de chaque étape ont été décrits de façon intensive dans le protocole. ( B ) On a observé un halo entourant la pastille de grains dans l'échantillon de CL, mais pas dans l'échantillon témoin non CL, pendant l'étape de lavage 4.3. ( C ) Comparaison de l'ARNm UBQ10 relatif et de l'ARNr 18SIl s'agit d'un contrôle non CL et d'échantillons CL par qRT-PCR (les valeurs sont moyennes ± SD (n = 3); * et **: différences significatives avec p <0,05 et <0,01). ( D ) Élément de protéine concentré d'un échantillon de contrôle non CL comparé aux échantillons de CL irradiés par une source UV à ondes continues pendant 1, 3 et 5 min, avec une intensité UV de 0,00875 W / cm 2 . ( E ) Identification du protéome lié à l'ARNm par la protéomique. Dans la protéomique quantitative réalisée par le progiciel Progenesis (à gauche), le graphique du volcan affiche les variations moyennes de log2-fold (CL / non-CL) et les valeurs p ajustées connexes (-log10 (valeurs adj. P)) de Toutes les protéines. Dans la protéomique qualitative réalisée par le logiciel Peaks (à droite), les protéines des échantillons sont illustrées dans les diagrammes de Venn. La quantité de protéines est indiquée en nombres. Le FDR au niveau des peptides et des protéines est inférieur à 5%. Le nombre de protéines à l'intérieur des cadres brun clair est considéré comme un résultat positif. ( et al ., 2016. Cliquez ici pour voir une version plus grande de ce chiffre.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Nous avons réussi à appliquer une capture d'interraction d'ARNm, développée pour la levure et les cellules humaines, pour planter des protoplastes de mésophylle foliaire. Les cellules de la mésophylle des feuilles sont le type principal de tissu moulu dans les feuilles des plantes. L'avantage majeur de cette méthode est qu'il utilise une réticulation in vivo pour découvrir les protéines à partir d'un environnement physiologique.

Dans ce protocole, nous présentons principalement un certain nombre de conditions expérimentales optimisées ( par exemple, le nombre de protoplastes à utiliser comme matériau de départ et la durée de l'irradiation UV) 50 . Les protéines capturées dans les échantillons CL ne peuvent être détectées que par SDS-PAGE et coloration à l'argent lorsqu'un minimum de 10 7 protoplastes (moyenne échelle) est utilisé (étape 1.5.5). Des concentrations plus faibles ne donnent pas un modèle de mRBP observable sur SDS-PAGE et ne devraient probablement pas être utilisées pour une analyse ultérieure par la protéomique. En effet, en utilisant plus de 10 7 cellules (par exemple, 10 9 àUne expérience à grande échelle) est également possible 20 . Les résultats des essais de coloration à l' argent suggèrent que l' irradiation UV pendant 1 min à 0,00875 W / cm 2 d'intensité générée par une source d'UV à onde continue est optimale (figure 1D). Un rendement élevé à l'étape critique ( c. -à-d., La réduction et la purification du mRNP par des puces oligo-d (T) 25 , étape 4) est supportée par les résultats des essais RT-qPCR, colorants à l'argent et MS ( Figure 1C ; 1D et 1E , à droite). La combinaison de la protéomique qualitative et quantitative peut aider à identifier les RBP positifs dans la région de chevauchement entre les témoins non-CL et les échantillons CL ( Figure 1E ). La majorité des protéines identifiées étaient des RBP non annotées précédemment dans les ensembles de données ( Figure 1F ). Nous avons présenté ces protéines anti-ARN précédemment inconnues dans la catégorie III comme RBP candidates <Sup class = "xref"> 50 ( Figure 1F ). L'exploration des spécificités de liaison de ces RBP candidats doit être effectuée en utilisant d'autres méthodes, telles que les méthodes CLIP 23 mentionnées précédemment. Un exemple qui étudie la spécificité de liaison d'une RBP pour réguler son transcription d'ARNm cible dans Arabidopsis à l'aide de CLIP 51 peut être trouvé dans Zhang et al ., 2015. En outre, une méthode alternative modifiée de PAR-CLIP, appelée photoactivable- La réticulation améliorée par ribonucléoside (PAR-CL, 365-nm UV-A) a également été préalablement recommandée pour l'étude des protéomes liés à l'ARNm de la levure et des cellules humaines 14 , 23 . PAR-CL requiert 4Su, qui est repris par des cellules et incorporé dans des ARN naissants pendant le métabolisme de l'ARN et peut être hautement réactif, formant des liaisons covalentes avec des acides aminés 52 sous irradiation UV-A (365 nm)Ation. À l'heure actuelle, il n'y a pas d'études axées sur la toxicité de 4sU sur les cellules végétales et l'absorption efficace de 4sU exogènes en protoplastes mésophiles 53 . Cependant, nous croyons qu'il sera possible d'utiliser à la fois CL (254-nm UV-C) et PAR-CL (365 nm UV-A) sur les plantes, ce qui contribuera à la découverte et à la validation de divers RBP à partir de la physiologie Environnement dans le futur.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à dévoiler.

Acknowledgements

Nous reconnaissons le laboratoire du Prof. Joris Winderickx, qui a fourni l'appareil de réticulation UV équipé de la lampe UV conventionnelle. KG est soutenu par le fonds de recherche KU Leuven et reconnaît le soutien de la subvention FWO G065713N.

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics