MRNA Interactome Capture fra Plant Protoplasts

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her præsenterer vi en interaktiv fangstprotokol anvendt på Arabidopsis thaliana leaf mesophyll protoplaster. Denne metode afhænger kritisk af in vivo UV-tværbinding og muliggør isolering og identifikation af plante-mRNA-bindende proteiner fra et fysiologisk miljø.

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

RNA-bindende proteiner (RBP'er) bestemmer skæbne for RNA'er. De deltager i alle RNA biogeneseveje og bidrager især til post-transkriptionel genregulering (PTGR) af messenger-RNA'er (mRNA'er). I de sidste par år er en række mRNA-bundne proteomer fra gær- og pattedyrcellelinier isoleret isoleret ved anvendelse af en ny metode kaldet "mRNA interactome capture", hvilket muliggør identifikation af mRNA-bindende proteiner (mRBP'er) Direkte fra et fysiologisk miljø. Fremgangsmåden består af in vivo ultraviolet (UV) tværbinding, nedtrængning og oprensning af messenger ribonucleoproteinkomplekser (mRNP'er) ved oligo (dT) perler og den efterfølgende identifikation af de tværbundne proteiner ved massespektrometri (MS). For nylig er der ved hjælp af samme metode blevet rapporteret flere plante mRNA-bundne proteomer samtidigt fra forskellige Arabidopsis vævskilder: ætiolerede frøplanter, bladvæv,Blad mesophyll protoplaster og dyrkede rodceller. Her præsenterer vi den optimerede mRNA interaktionsoptagelsesmetode til Arabidopsis thaliana leaf mesophyll protoplaster, en celletype, der tjener som et alsidigt værktøj til forsøg, der omfatter forskellige cellulære analyser. Betingelserne for optimalt proteinudbytte indbefatter mængden af ​​startvæv og varigheden af ​​UV-bestråling. I det mRNA-bundne proteom opnået ud fra et middelforsøgsforsøg (10 7 celler) viste RBP'er at have RNA-bindingsevne sig at være overrepræsenteret, og mange nye RBP'er blev identificeret. Forsøget kan opskaleres (10 9 celler), og den optimerede metode kan anvendes til andre plantecelletyper og arter til at isolere, katalogisere og sammenligne mRNA-bundne proteomer i planter.

Introduction

Eukaryoter bruger flere RNA biogenese regulatoriske veje til at opretholde cellulære biologiske processer. Blandt de kendte typer af RNA er mRNA meget forskelligartet og bærer kodningskapaciteten af ​​proteiner og deres isoformer 1. PTGR-vejen styrer skæbnen for præ-mRNA'er 2 , 3 . RBP'er fra forskellige genfamilier styrer reguleringen af ​​RNA, og i PTGR styrer bestemte mRBP'er mRNA'er gennem direkte fysiske interaktioner, der danner funktionelle mRNP'er. Derfor er identifikation og karakterisering af mRBP'er og deres mRNP'er afgørende for forståelsen af ​​reguleringen af ​​cellulær mRNA-metabolisme 2. I de sidste tre årtier har forskellige in vitro- metoder - herunder RNA-elektroforetisk mobilitetsforskydning (REMSA) assays, systematisk udvikling af ligander ved eksponentielle berigelsesanalyser (SELEX) baseret på biblioteksafledte konstruktioner, RNA Bind-n-Seq (RBNS), radioaktivt mærket eller kvantitativtFluorescens-RNA-bindingsassays, røntgenkrystallografi og NMR-spektroskopi 4 , 5 , 6 , 7 , 8 , 9 - er blevet anvendt bredt til studier af RBP'er, hovedsageligt fra pattedyrceller. Resultaterne af disse undersøgelser af pattedyrs-RBP'er kan søges via den RNA-bindende Protein DataBase (RBPDB), som samler de offentliggjorte observationer 10 .

Selv om disse in vitro- metoder er kraftige værktøjer, bestemmer de de bundne RNA-motiver fra en given RNA-pool af sekvenser og er derfor begrænsede i deres evne til at opdage nye mål-RNA'er. Det samme gælder for beregningsstrategier for at forudse genomsamlede RBP'er, som er baseret på bevaring af proteinsekvens og struktur 15 . For at overvinde dette har en ny forsøgsmetode haS er etableret, der muliggør identifikation af RNA-motiverne, som en RBP af interesse interagerer med, såvel som til bestemmelse af den præcise placering af bindingen. Denne metode, der kaldes "tværbinding og immunpræcipitation" (CLIP), består af in vivo UV-tværbinding efterfulgt af immunpræcipitation 11 . Tidlige undersøgelser har vist, at fotoaktivering af DNA- og RNA-nukleotider kan forekomme ved excitation UV-bølgelængder større end 245 nm. Reaktionen gennem thymidin synes at være begunstiget (rang i rækkefølge af nedsat fotoreaktivitet: dT> dC> rU> rC, dA, dG) 12 . Ved anvendelse af UV-lys med en bølgelængde på 254 nm (UV-C) blev det observeret, at kovalente bindinger mellem RNA-nukleotider og proteinrester er skabt, når der kun er nogle få Ångstrømninger (Å). Fænomenet kaldes derfor "nullængde" tværbinding af RNA og RBP. Dette kan efterfølges af en streng rensningsprocedure Dyr med lille baggrund 13 , 14 .

En strategi komplementær til CLIP er at kombinere in vivo UV-tværbinding med proteinidentifikation for at beskrive RBPs landskab. Et antal sådanne genomfattede mRNA-bundne proteomer er blevet isoleret fra gærceller, embryonale stamceller (ESC'er) og humane cellelinier ( dvs. HEK293 og HeLa) under anvendelse af denne nye eksperimentelle tilgang, kaldet "mRNA interactome capture" 18 , 19 , 20 , 21 . Fremgangsmåden består af in vivo UV-tværbinding efterfulgt af mRNP-oprensning og MS-baseret proteomik. Ved at anvende denne strategi er mange nye "måneskinnende" RBP'er indeholdende ikke-canoniske RBD'er blevet opdaget, og det er blevet klart, at flere proteiner har RNA-bindende kapacitet end tidligere antaget"> 15 , 16 , 17. Anvendelsen af ​​denne metode giver mulighed for nye applikationer og evnen til at besvare nye biologiske spørgsmål ved undersøgelse af RBP'er. For eksempel har en nylig undersøgelse undersøgt bevarelsen af ​​det mRNA-bundne proteom (kernen RBP Proteom) mellem gær og humane celler 22 .

Plant RBP'er har allerede vist sig at være involveret i vækst og udvikling ( f.eks . I posttranskriptionel regulering af blomstringstid, cirkadianuret og genekspression i mitokondrier og chloroplaster) 24 , 25 , 26 , 27 , 28 , 29 . Desuden antages de at udføre funktioner i de cellulære processer, der reagerer på abiotiske påvirkninger ( f.eks. Kold, tørke, saLinitet og abscisinsyre (ABA)) 31 , 32 , 33 , 34 . Der er mere end 200 forudsagte RBP-gener i Arabidopsis thaliana- genomet, baseret på RNA-genkendelsesmotiv (RRM) og K-homologi (KH) domænesekvensmotiv; I ris er cirka 250 blevet noteret 35 , 36 . Det er bemærkelsesværdigt, at mange forudsagte RBP'er synes at være unikke for planter ( fx ingen metazoan orthologs til ca. 50% af forudsagte Arabidopsis RBP'er indeholdende et RRM-domæne) 35 , hvilket tyder på, at mange kan tjene nye funktioner. Funktionerne af de fleste forudsagte RBP'er forbliver ukarakteriserede 23 .

Isoleringen af ​​mRNA-bundne proteomer fra Arabidopsis- ætiolerede frøplanter, bladvæv, dyrkede rodceller og bladmemofylprotoplaster ved anvendelse afMRNA interaktionsoptagelse er for nylig blevet rapporteret 38 , 39 . Disse undersøgelser viser det stærke potentiale for systematisk katalogisering af funktionelle RBP'er i planter i nær fremtid. Her præsenterer vi en protokol for mRNA interactome capture fra planteprotoplaster ( dvs. celler uden cellevægge). Arabidopsis thaliana leaf mesophyll protoplaster er den vigtigste type af bladcelle. De isolerede protoplaster tillader optimal adgang til UV-lys til cellerne. Denne celletype kan anvendes i assays, som transientt udtrykker proteiner til funktionel karakterisering 40 , 41 . Desuden er protoplaster blevet anvendt til adskillige andre plantecelletyper og arter 42 , 43 , 44 ( fx Petersson et al ., 2009; Bargmann og Birnbaum, 2010; og Hong et al ., 2012).

<P class = "jove_content"> Metoden omfatter i alt 11 trin ( Figur 1A ). Arabidopsis leaf mesophyll protoplaster isoleres først (trin 1) og efterfølgende UV-bestråles til dannelse af tværbundne mRNP'er (trin 2). Når protoplaster lyseres under denatureringsbetingelser (trin 3), frigives de tværbundne mRNP'er i lysis / bindingsbuffer og trækkes ned ved oligo-d (T) 25 perler (trin 4). Efter flere runder af strenge vasker renses mRNP'erne og analyseres yderligere. De denaturerede peptider af mRBP'er fordøjes af proteinase K, før de tværbundne mRNA'er renses, og RNA-kvaliteten verificeres ved hjælp af qRT-PCR (trin 5 og 6). Efter RNase-behandling og proteinkoncentration (trin 7) styres proteinkvaliteten ved SDS-polyacrylamidgelelektroforese (SDS-PAGE) og sølvfarvning (trin 8). Forskellen i proteinbåndsmønstre kan let visualiseres mellem en tværbundet prøve (CL) og en ikke-tværbundet prøve (ikke-CL;Den negative kontrolprøve fra protoplaster, der ikke udsættes for UV-bestråling). Identifikationen af ​​proteiner opnås gennem MS-baseret proteomik. Proteinerne fra CL-prøven adskilles ved endimensionel polyacrylamidgelelektroforese (1D-PAGE) for at fjerne mulig baggrundsforurening, "in-gel fordøjes" til korte peptider under anvendelse af trypsin og renses (trin 9). Nano omvendt fase væskekromatografi koblet til massespektrometri (nano-LC-MS) tillader bestemmelse af mængden af ​​endelige proteiner i det mRNA-bundne proteom (trin 10). Endelig karakteriseres og identificeres de identificerede mRBP'er ved anvendelse af bioinformatisk analyse (trin 11).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Arabidopsis Leaf Mesophyll Protoplast Isolation

BEMÆRK: Arabidopsis leaf mesophyll protoplaster er i det væsentlige isoleret som beskrevet af Yoo et al ., 2007, med flere modifikationer 40 .

  1. Vækst af planter
    1. Sug ca. 200 Arabidopsis thaliana Col-0 økotype frø i steriliseret vand i 2 dage ved 4 ° C i mørke til stratificering.
      BEMÆRK: Dette antal frø er nok til en ikke-CL-prøve og en CL-prøve (se trin 1.3).
    2. Forbered potter med en 50% ( v / v ) blanding af jord og vermikulit og blød potten med destilleret vand i en bakke for at våd jorden.
    3. Så og fordel de stratificerede frø på våd jord. Dæk ikke frøene med ekstra jord, fordi Arabidopsis frø har brug for lys til spiring.
      BEMÆRK: Plantevækstforholdene er en 12 h lys / 12 h mørk cyklus ved 23 ° C,Med en lysintensitet på 100 μmol m -2 s -1 i et vækstrum i 5 uger før blomstringen. 4 uger gamle planter kan også anvendes 40 .
      BEMÆRK: Alle beskrevne materialer og reagenser fra trin 1.2.1 til trin 3.2.3 gælder for to prøver ( dvs. en ikke-CL-prøve (kontrolprøven, der ikke udsættes for UV-C-bestråling) og en CL-prøve (undersøgelsen Prøve, der udsættes for UV-C bestråling)).
  2. Fremstilling af isotonisk enzymopløsning
    1. Der fremstilles 80 ml primær isotonisk enzymopløsning (400 mM mannitol, 20 mM KCI og 20 mM MES-buffer (pH 5,7)) og opvarmer straks opløsningen i en 60 ° C inkubator i 10 minutter.
    2. Tilsæt 1,2 g cellulose R10 ( w / v 1,5%) og 0,32 g Macerozyme R10 ( vægt / vol 0,4%) pulver til den varme primære isotoniske enzymopløsning.
    3. Tag forsigtigt enzympulveret i opløsning ved at anvende forsigtig omrøring. RapOpvarmet opløsningen i en 60 ° C inkubator i 10 minutter, indtil enzymopløsningen er klar lysebrun.
    4. Opløsningen afkøles på is i 3 min og tilsæt 800 pi 1 M CaCl2 og 800 pi 10% (vægt / volumen) BSA til opløsningen.
    5. Homogenisere opløsningen ved pipettering og filtrering gennem et 0,22 μm filter. Aliquot denne endelige isotoniske enzymopløsning i to store petriskåle (150 mm x 20 mm).
  3. Fremstilling af Arabidopsis- rosetbladstrimler
    BEMÆRK: 150 blade til hver petriskål anbefales til en ikke-CL-prøve eller en CL-prøve.
    1. Vælg og skære i alt 300 fuldt udvidede 2 nd - eller 3 rd- ægte ægte blade (gennemsnit: 3 - 4 pr. Rosette) i 0,5 til 1 mm blade strimler ved hjælp af en ny og skarpe razorblade.
    2. Overfør og sænk striperne straks ind i isotonisk enzymopløsning.
      BEMÆRK: For at undgå kontakt med lys skal du altid dække tHan petriskåle med aluminiumsfolie. Må ikke knuse bladene. Bekræft, at alle strimler er nedsænket i opløsningen og ikke flyder på overfladen.
  4. Isolering af Arabidopsis blade mesophyll protoplaster
    1. Placer de aluminiumfolie-dækkede petriskåle i vakuumtørskere og infiltrer bladstrimlerne under vakuum i 30 minutter. Derefter inkuberes petriskålene i mørke uden at rystes ved stuetemperatur i 2,5 timer.
    2. Ryst forsigtigt og kortvarigt opvasken vandret for hånd, forsøger at frigøre protoplasterne helt ind i enzymopløsningen.
  5. Høst og tælling af protoplasterne
    1. Filtrer protoplastopslæmningen gennem et nylonnet på 35 til 75 μm. Aliquot filtratet af hver prøve i to 50 ml rundbundede rør (ca. 20 ml filtrat i hvert rør).
    2. Skyl hver petriskål med 10 ml W5-buffer (154 mM NaCl, 125 mM CaCl
    3. Spin alle fire rør i 5 minutter ved 100 xg for at pille protoplasterne. Kassér supernatanten og forsigtigt resuspender protoplastpelletsene i hvert rør med 10 ml W5-buffer.
      BEMÆRK: Ved resuspension af protoplastpelletsene skal du forsigtigt dreje røret på hovedet og forsigtigt dreje røret med hånden, indtil pellets er forsvundet. Pipetter ikke pelleten direkte for at undgå at beskadige cellerne.
    4. Gentag trin 1.5.3 en gang, og kombiner protoplast suspensionen fra to rør af hver prøve i et 50 ml rundbundet rør. Hold rørene på is.
    5. Tæl protoplasterne ved hjælp af et hæmocytometer.
      BEMÆRK: Hver 20 celler inden for 25 terninger svarer til 2 x 10 5 protoplaster / ml. 150 blade skal give ca. 1 x 107 celler.Moduler at have et lige stort antal protoplaster i non-CL og CL prøverne.
    6. Hold protoplasterne på is i 30 minutter. Derefter drejes rørene i 5 minutter ved 100 x g. Bortkast supernatanten og resuspender protoplasterne i hvert rør med 20 ml MMG opløsning (400 mM Mannitol, 15 mM MgCl2 og 4 mM MES-puffer (pH 5,7)).

2. In vivo mRNA-protein-tværbinding ved UV-bestråling

BEMÆRK: Hold ikke-CL prøveslangen på is. CL-prøven skal straks UV-bestråles.

  1. Overfør protoplast suspensionen indeholdende 1 x 10 7 celler fra CL prøveslangen til en ny storskaleret petriskål (150 mm x 20 mm) og tilsæt 30 ml iskold MMg opløsning for at dække pladeoverfladen. Spred cellerne i hele MMg-bufferen ved forsigtig pipettering. Placer straks petriskålen uden topdækslet i et UV-tværbindingsapparat.
    BEMÆRK: Højden mellem UV-lampenOg petriskålen er 8 cm.
  2. Bestråle prøven med 254 nm bølgelængde UV-lys og 0,00875 W / cm2 UV-intensitet i 1 min, 3 min, eller 5 min. Efter bestråling, hurtigt alikvot protoplast suspensionen i to nye 50 ml runde bund rør. Vask bunden af ​​fadet med en yderligere 5 ml iskold MMg opløsning for at samle resten af ​​protoplasterne og tilsæt denne cellesuspension til disse to rør.
    BEMÆRK: 1 min blev valgt som den optimale tilstand. Forklaringen findes i repræsentative resultater .

3. Protoplast Lysis under denatureringsbetingelser

  1. Fremstilling af protoplastpellets til lysering
    1. Spinde ikke-CL-prøverøret sammen med de to CL-prøverør fra trin 2 ved 100 xg i 5 minutter og kassér supernatanten. Placer røret af protoplastpelletresten uden CL, tilbage på isen.
    2. Tilsæt 10 ml iskold MMg-opløsning til hvert CL-prøverør, genResuspender pelletsene og kombiner dem igen i et 50 ml rundbundet rør. Spin røret ved 100 xg i 5 minutter. Efter fjernelse af supernatanten skal CL protokol-pellet holdes på is.
  2. Protoplastlys og homogeniserende protoplastlysat
    1. Tilsæt 9 ml iskold lysis / bindingsbuffer (500 mM LiCl, 0,5% ( w / v ) lithiumdodecylsulfat (LiDS), 5 mM dithiothreitol (DTT), 20 mM Tris-HCI (pH 7,5) og 1 mM EDTA (pH 8,0)) til cellepelleten af ​​hver prøve. Lyser protoplasterne groft ved at pipettere op og ned ca. 20 gange, indtil suspensionen er homogent lysegrøn.
    2. Pass protoplastlysatet to gange gennem en 50 ml glassprøjte med en smal nål (0,9 x 25 mm 2 ) til homogenisering. Inkuber lysatet på is i 10 minutter. Frys lysaterne i flydende nitrogen og opbevar ved -80 ° C i op til 3 uger.

4. MRNP Trækning og rensningAf Oligo-d (T) 25 perler

BEMÆRK: Alle nedenstående beskrevne materialer og reagenser, fra trin 4.1 til trin 4.4, er kun til en prøve ( dvs. en ikke-CL-prøve eller en CL-prøve). Protoplastlysatet skal tilsættes straks til rørene indeholdende perler, efter at perle supernatant lysis / bindingsbufferen kasseres.

  1. Fremstilling af oligo-d (T) 25 magnetiske perler til oligo (dT) -fangst
    1. Optø det frosne protoplastlysat ved stuetemperatur. Når lysatet er helt optøet, hold lysatørrøret på is.
    2. Aliquot 1,8 ml oligo-d (T) 25 magnetiske perler (5 mg / ml) i 6 nye 2 ml runde mikrocentrifugerør på is. I hvert rør vaskes perlesuspensionen homogent med 600 μl lysis / bindingsbuffer ved kort pipettering op og ned og forsigtigt roterende ved 4 ° C i 2 minutter. Hold perlerne på is.
  2. Binding
    1. PlacereAlle 6 rør indeholdende perlerne i et magnetisk rack ved 4 ° C i 3 minutter, hvilket vil resultere i magnetisk indfangning af perlerne og oprydning af suspensionen.
      BEMÆRK: Når rørene er anbragt i magnetstativet, skal du vente, indtil perlerne er helt optaget, mindst 3 min.
    2. Kassér supernatanten og straks alikvot 9 ml protoplastlysat i disse 6 rør. Bland godt ved pipettering indtil en homogen brun suspension fremkommer og inkubér perlerne i protoplastlysat ved 4 ° C i 1 time ved at anvende forsigtig rotation.
      BEMÆRK: En inkubationstid fra 30 min til 1 h anbefales.
  3. Vask
    1. Placer rørene tilbage i magnetstativet ved 4 ° C i 3 minutter. Når alle perler fanges på siden af ​​rørene, samles protoplastlysatet i 6 nye 2 ml runde mikrocentrifugerør og gemmer dem midlertidigt ved 4 ° C. Kassér ikke protoplastlysatet straks; Hold lysatetVed 4 ° C.
    2. Tilsæt 1,5 ml iskold vaskebuffer 1 (500 mM LiCl, 0,1% ( vægt / volumen ) LiDS, 5 mM DTT, 20 mM Tris-HCI (pH 7,5) og 1 mM EDTA (pH 8,0)) til perlerne I hvert rør. Resuspender perlerne og anbring forsigtig rotation i 1 minut. Placer rørene tilbage i magnetstativet ved 4 ° C i 3 minutter og kassér supernatanten. Gentag dette vaske trin med vaskebuffer en gang.
    3. Gentag samme procedure i dette vaske trin to gange ved anvendelse af 1,5 ml iskold vaskebuffer 2 (500 mM LiCl, 5 mM DTT, 20 mM Tris-HCI (pH 7,5) og 1 mM EDTA (pH 8,0)) og en gang ved anvendelse af 1,5 ml iskold lavsaltbuffer (200 mM LiCl, 20 mM Tris-HCI (pH 7,5) og 1 mM EDTA (pH 8,0)).
      BEMÆRK: Hvis mRNP'erne er isoleret isoleret fra protoplastlysatet, skal der være en "halo" synlig omkring perlepellet i CL-prøven under vaskestrinet med vaskebuffer 2 ( figur 1B ).
  4. Eluering
    1. Tilsæt 500 μLAf elueringsbuffer (20 mM Tris-HCI (pH 7,5) og 1 mM EDTA (pH 8,0)) til perlerne i hvert rør. Resulber forsigtigt perlerne og inkuber ved 50 ° C i 3 minutter for at frigive de poly (A) -talte RNA'er. Forsigtigt resuspender perlerne en gang ved pipettering. Placer rørene tilbage i magnetstativet ved 4 ° C i 5 minutter.
    2. Overfør og kombiner alle elueringsmidler (ca. 3 ml i alt) til et rent, sterilt RNase-frit, 15 ml konisk bundrør på is.
      BEMÆRK: Kvaliteten og mængden af ​​RNA kan straks bestemmes ved hjælp af en spektrofotometerindretning.
      BEMÆRK: RNA-koncentrationen af ​​hver prøve er ca. 10 ng / μl, med et A 260 / A 280- forhold på 1,9. A 260 / A 280 forholdet skal være mellem 1,6 og 2,0, fordi de isolerede poly (A) -talte RNA'er sædvanligvis er mere end 70% rene. Hvis RNA-koncentrationen er for lav, øg antallet af startprotoplaster til maksimalt 10 9 . PrøverKan fryses i flydende nitrogen og opbevares ved 80 ° C til langtidsopbevaring.
    3. Gentag trin 4.2 til trin 4.4 i yderligere to runder og genanvend oligo-d (T) 25 perlerne for at depletere de poly (A) -talte RNA'er fra protoplastlysatet.
      BEMÆRK: Efter tre runder af trækproceduren skal der være i alt 9 ml eluent til hver ikke-CL eller CL-prøve. Udfør alt arbejde ved 4 ° C for at undgå nedbrydning af RNA. Følg trin 4.5 eller trin 4.6 for at genbruge eller regenerere perlerne.
  5. Fremstilling af genanvendte oligo-d (T) 25 perler
    1. Vask perlerne to gange med 1 ml iskold elueringsbuffer og en gang med 1 ml iskold lysis / bindingsbuffer for at justere salt LiCl-koncentrationen tilbage til 500 mM.
    2. Følg trin 4.1, kassér supernatanten, overfør det lagrede protoplastlysat i hvert rør og gentag hele proceduren fra trin 4.2 til trin 4.4 i yderligere to runder.
  6. 25 perler
    BEMÆRK: Perler kan gemmes og bruges til et andet eksperiment (maksimal genbrug er tre gange).
    1. Følg trin 4.4, tilsæt 1 ml 0,1 M NaOH til perlerne og inkuber ved at rotere ved stuetemperatur i 5 minutter. For hvert rør vaskes to gange med 1 ml vaskebuffer 1 og tre gange med 1x PBS (pH 7,4) indeholdende 0,1% Tween-20 til ækvilibrering. Opbevar perlerne fra hvert rør i 300 μL sterilt RNase-frit 1x PBS (pH 7,4) indeholdende 0,1% Tween-20 ved 4 ° C til langtidsopbevaring.
      BEMÆRK: Perler anvendt til Arabidopsis CL prøver i dette eksperiment kan kun bruges til de samme planteprøver næste gang.

5. Proteinase K-behandling og mRNA-oprensning

  1. Proteinase K-behandling
    1. Tilsæt 8 μl Proteinase K-opløsning (2 μg / μl) til 1 ml eluenten fra hver prøve for at fordøje de UV-tværbundne proteiner. brIve vortex.
  2. MRNA oprensning
    1. Inkubér eluenten ved 37 ° C i 1 time. Rens RNA'en ved hjælp af RNA rensningssæt for at fjerne resterende forurenende stoffer.
      BEMÆRK: Efter oprensning er RNA'erne klar til RNA-kvalitetstesten ved hjælp af qRT-PCR-analysen.
      BEMÆRK: Andre kits, såsom RNA mini kit og TRIzol reagens, kan også bruges 14 .

6. qRT-PCR-analyse

  1. Omvendt transkription
    1. Opnå effektiv syntese af første streng cDNA ved anvendelse af revers transkriptionssystemet med 1 μg RNA som template. Fortynd prøven til 5 ng / μl med nukleasefrit vand.
  2. CDNA-kvantificering ved anvendelse af qRT-PCR
    1. Amplificere og kvantificere cDNA'et ved hjælp af qPCR-masterblandingen og real-time PCR-cykleren med 10 ng cDNA som template. Brug følgende PCR-program: 95 ° C i 10 minutter(Trin 1, en cyklus) og 95 ° C i 15 s og 60 ° C i 1 min (trin 2, 40 cyklusser).
      BEMÆRK: Referencegenet anvendt her var et endogent intern kontrolgen, UBQ10 (AT4G05320). QRT-PCR primere til UBQ10 og 18S rRNA blev beskrevet i Li et al ., 2014 og Durut et al ., 2014, henholdsvis 45 , 46 . Primersekvenser er angivet i materialetabellen .

7. RNase behandling og mRBP koncentration

  1. RNase behandling
    1. Tilsæt ca. 100 U RNase-cocktail indeholdende RNase A og RNase T1 i 8 ml eluent. Inkluder en negativ kontrolprøve med RNase-cocktail, hvor eluenten erstattes af nukleasefrit vand. Kortvarigt hvirvel og inkuber ved 37 ° C i 1 time.
  2. MRBP koncentration
    1. Efter RNase fordøjelse koncentrere eluent usinG centrifugale filterenheder. Slutvolumenet er 75 μl, med et totalt proteinudbytte på ca. 2 μg af hver prøve efter koncentration. Placer prøverne ved -80 ° C til langtidsopbevaring.

8. SDS-PAGE og sølvfarvning

  1. SDS-PAGE
    1. Bland 25 μl af den koncentrerede eluent (CL-prøve) eller kontrolprøven (ikke-CL-prøve) med 15 μl 2x påfyldningsfarve. Opvarm prøven ved 95 ° C i 5 minutter og lad den på en SDS-PAGE gel indeholdende 5% stablingsgel og 12% opløsende gel, inklusiv en proteinmarkør.
    2. Kondenserer proteinerne ved 60 V i 40 minutter og adskilles ved 160 V i ca. 1 time, indtil fyldstofet når slutningen af ​​opløsningsgelen.
  2. Sølvfarvningsassay
    1. Vask SDS-PAGE gelen to gange med ultralugt vand i 5 minutter hver gang. Udfør sølvfarvningen af ​​proteinerne ved anvendelse af et kommercielt sølvfarvesæt.
      BEMÆRK: Proteinbåndene skal vises inden for 5 minutter. Hvis båndene er synlige ud over 5 minutter med meget lys farve, foreslås det at øge antallet af startprotoplaster op til maksimalt 10 9 .

9. Trypsinfordeling af proteinbånd og peptidrensning

  1. Trypsin fordøjes
    BEMÆRK: Kør en anden 1D-PAGE gel ved at tage en anden 25 μl koncentreret mRBP opløsning fra hver prøve til mRBP identifikation; Sølvfarvede geler kan ikke anvendes, da de ikke er kompatible med MS-analyse.
    1. Efter at have kørt 1D-PAGE-gelen, fastgør gelen i fikseringsopløsning (50% ( vol / vol ) methanol og 10% ( volumen / volumen eddikesyre) i 1 time. Stain gelen i pletopløsning (0,1% ( vægt / volumen ) Coomassie Brilliant Blue R-250, 50% ( v / v ) methanol og 10% ( v / v eddikesyre) i 20 minutter med forsigtig omrystning. Destillér gelen i destain opløsning (40% ( vol / vol ) methanol og 10% ( v/ V) eddikesyre) i 1 time. Efter destaining skal du holde gelen i 5% ( v / v ) eddikesyre.
      BEMÆRK: Under destaining kan ny destain løsning udskiftes, indtil baggrunden er fuldstændig ødelagt.
    2. Skær båndene af interesse ud af gelen. Skær båndene yderligere i stykker på ca. 1 mm 3 for den efterfølgende optimale trypsinfordøjelse og ekstraktion af peptider. Hydrat gelstykkerne med 50 pi 100 mM ammoniumbicarbonat (NH4 HCO 3) i 10 min. Dæk gelstykkerne fuldstændigt.
      1. Fjern hydratiserende opløsning omhyggeligt og dehydrere gelstykkerne med acetonitril (CH3CN) i 10 minutter. Fjern forsigtigt acetonitrilopløsningen.
      2. Gentag processen fra hydrering til dehydrering to gange. Endelig fjern acetonitrilopløsningen.
        BEMÆRK: Gelens løbetid afhænger af formålet med eksperimentet. En langvarig tid tillader en god adskillelse af proteiner, så det farvede specifikke gelforbudDs kan skæres ud til yderligere analyse. Hvis formålet er at holde proteinerne og fjerne forurenende stoffer, er en kortere tid tilstrækkelig.
    3. Tilsæt 500 μl 6,6 mM DTT-opløsning og inkubér gelstykkerne i 10 minutter. Fjern DTT-opløsningen og vask gelstykkerne to gange med 500 μL 95% ( v / v ) acetonitrilopløsning.
      1. Efter vask fjern acetonitrilopløsningen og inkubér gelstykkerne med 500 μl 55 mM iodeddikesyre (IAA) opløsning i 10 minutter i mørket.
      2. Efter inkubation fjernes opløsningen og vaskes gelstykkerne igen med 500 μl 95% ( v / v ) acetonitrilopløsning. Tør gelstykkerne.
    4. Indlejre gelstykkerne fuldstændigt med 25 pi fordøjelse buffer (50 mM NH4 HCO3, 5 mM CaCl2 og 6 ng / pl trypsin) og holde på is i 45 minutter for at lade trypsin trænge ind i gelen. Inkuber gelstykkerne natten over ved 37 ° C for en Zymatisk fordøjelse.
  2. Peptidrensning
    1. Tilføje 80 pi af 50 mM NH4 HCO 3 til gelstykker i digestionspuffer og vortex gentagne gange for at udtrække de tryptiske peptider. Saml ekstraktet. Gentag dette ekstraktionstrin to gange med 80 pi af 50% (v / v) CH3CN og 5% (vol / vol) myresyre (FA).
      BEMÆRK: Det samlede endelige ekstrakt skal være ca. 240 μl.
    2. Pool og koncentrere ekstrakterne i ca. 10 μl ved vakuumkoncentration eller lyofilisering og tilsæt 25 μl 0,1% ( v / v ) vandig trifluoreddikesyre (TFA) opløsning. Slet prøverne med μ-C18 kolonner, efter producentens protokol.
    3. At eluere peptiderne med 4 - 10 pi af 60% (vægt / volumen) CH3CN og 0,1% (vol / vol) FA. Lyofilize (frysetørre) peptiderne og opbevar dem ved -20 ° C indtil analyse.
Titel "> 10. Nano-LC-MS

  1. Nano omvendt fase væskekromatografi
    BEMÆRK: Udfør LC-MS analysen med et massespektrometer, der er onlinekoblet med et væskekromatografi instrument. Dette instrument skal udstyres med en C18-søjle (2 μm partikel, 100 Å porestørrelse og 50 μm x 15 cm i dimension).
    1. Resuspendere lyofiliserede peptider i 16 pi af opløsning (2% (v / v) CH3CN og 0,1% (v / v) FA). Injicer og lad 5 μL peptidopløsning med en strømningshastighed på 5 μl / min på en C18-prævolumen (3 μm partikelstørrelse, 100 Å porestørrelse, nanoviper og 75 μm x 2 cm i dimension) indsættes.
    2. 10.1.2. Adskil peptiderne ved anvendelse af en 95 min-gradient med en strømningshastighed på 300 nL / min. I løbet af denne separationsgradient øges mobilfasen B fra 4% til 10%, 10% til 25% og 25% til 45% i henholdsvis 5 minutter, 50 minutter og 18 minutter. Endelig øge mobilfasen B kraftigt til 95% i 1 min. EfterHver 95-min separationsgradient anvender et iboende skylningstrin indeholdende en 10-min gradient fra 4% til 95% i 5 minutter.
      BEMÆRK: Mobil fase A er 99,9% H2O og 0,1% (vol / vol) FA, og mobil fase B er 19,92% H2O, 80% (vægt / volumen) CH3CN og 0,08% (volumen / volumen ) FA.
  2. Massespektrometriassay
    1. Betjen massespektrometeret i dataafhængig tilstand med et massespænd fra 400 til 1.600 m / z.
    2. Vælg op til ti af de mest intense ioner i MS1 for at generere fragmenteringsspektrene. Indstil opløsningen til 70.000 fuld bredde ved halv maksimal (FWHM) for MS1 og 17.000 for MS2 med et AGC-mål på 3.000.000 og 1.000.000 ioner og en maksimal ioninjektionstid (IT) på 256 og 64 ms for MS1 Og henholdsvis MS2.
    3. Indstil den dynamiske udelukkelse til 10 sekunder for at undgå gentagen fragmentering af de mest overflødige ioner.
      BEMÆRK: Her er ioner med en eller flere end seks ladninger eXcluded for MS2.
  3. Kvalitative proteomik: peptid og proteinidentifikation
    1. Analyser fragmenteringsspektre ved brug af software som Peaks studio software 47 , 48 , 49 .
      BEMÆRK: Andre softwarepakker er også tilgængelige til peptididentifikation, såsom NovoHMM 30 og PepNovo 37 til de novo- sekventering og SEQUEST 54 og Mascot 55 til databasesøgning.
    2. Kombiner spektra med samme masse (<2 ppm forskel) og retentionstider (<2 min) og behold kun spektre med en kvalitetstærskel højere end 0,65 for at søge i Swiss-Prot-databasen (version: december 2013) Plante Arabidopsis thaliana . Brug følgende søgeparametre: en forstadiemassetolerance på 10 ppm ved brug af monOisotopisk masse; En fragmentmassetolerance på 20 mmu; Trypsin som fordøjelsesenzym, med maksimalt 2 savnede spaltninger; Cysteincarbamidomethylering som den faste modifikation; Methioninoxidation som den variable modifikation; Og maksimalt 3 variable post-translationelle modifikationer pr. Peptid. Efter identifikation indstilles manuelt tærskelværdierne for pålidelig peptid- og proteinidentifikation, således at der opnås en falsk opdagelsesrate (FDR) <5%.
  4. Kvantitative proteomics: Statistisk analyse af massespektrometri data
    1. Brug LC-MS ( fx Progenesis) til etiketfri kvantificering af proteomics data.
      BEMÆRK: MS1-peptidtopområder (eller intensitet) er forbundet med peptiderne identificeret af studiosoftwaren i henhold til deres masse, med den tolererede fejl på maksimalt 10 ppm.
      BEMÆRK: Denne software beregner overfladen af ​​et peptid ved at integrere toppområderne for alle ladestater mellem 2 <Sup> + og 8 + . De kvantitative data er knyttet til PEAKS-peptididentifikationen ved hjælp af et intern script (masse matching med den tolererede fejl ved maksimalt 10 ppm).
    2. Beregn de gennemsnitlige log2-fold ændringer (CL / non-CL) for hvert peptid. Grupper fold-ændringerne af de unikke peptider med protein.
      BEMÆRK: I hver gruppe er den endelige fold-ændring af et protein lig med de gennemsnitlige fold-ændringer af dets peptider.
    3. Beregn p-værdien ved hjælp af Students t- test for hver gruppe for at evaluere den statistiske betydning. Anvend R-softwarepakke (version 3.3.0) for at korrigere p-værdierne for FDR for alle grupper ved hjælp af Benjamini-Hochberg (BH) -metoden.
    4. Tegn vulkanplanen ved hjælp af funktionskalibreringspakken (version 1.7.2), der er kompatibel med R-softwarepakken (version 3.3.0).
      BEMÆRK: Her er de -log10-justerede p-værdier (-log10 (adj. P-værdi)) en funktion af de log2-foldede ændringer af alle identificerede proteiner. Proteiner erBehandlet som positive hits i det mRNA-bundne proteom, hvis deres log2-fold-ændringer er større end 2, med eller uden betydning.

11. Katalog over det identificerede mRNA-bundne Proteome

  1. Klassificere de identificerede proteiner fra trin 10 i tre kategorier baseret på emnerne "molekylære funktioner og biologisk proces" via Gene Ontology (GO) databasen og "familie og domæne" via InterPro databasen.
  2. Som kategori I eller "Ribosomale proteiner" indeholder alle detekterede ribosomale proteiner, definerer proteiner fra kategori II eller "Main RBPs" som indeholder annoterede proteindomæner, der interagerer med RNA'er eller linker til RNA-binding med kendte eller ukendte funktioner i RNA-biologi .
  3. Da proteiner med kendte eller ukendte funktioner i RNA-biologi uden annoterede RNA-bindende domæner er placeret i kategori III eller "Kandidat-RBP'er", defineres enzymer fra kategori III baseret på annoteringer fra INtEnz database.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Vi observerede en karakteristisk halo, der omgiver perlepellet i CL-prøven, i vaske trin 4.3 med vaskebuffer 2 ( Figur 1B ). Selvom det ikke er blevet undersøgt, kan dette fænomen sandsynligvis forklares ved interferensen af ​​tværbundne mRNP-komplekser med perleaggregering under magnetfangst, hvilket forårsager et mere diffust aggregat at danne. Det indikerer, at oligo-d (T) 25- perlefangsten var effektiv 14 .

Det signifikant højere UBQ10 reference mRNA niveauer end 18S rRNA i både ikke-CL kontrol og CL prøver er vist i figur 1C . Dette indikerer, at mRNAer beriges i eluenten på grund af fangsten ved oligo-d (T) 25 perler, som kun kan binde til poly (A) -talte mRNA'er. Effektiviteten af ​​oligo-d (T) 25 perlefangst var yderligere suppOrted ved SDS-PAGE og sølvfarvning (trin 8) som vist i figur 1D efter RNase-behandling og mRBP-koncentration (trin 7). En forskel i proteinbåndsmønster mellem ikke-CL-kontrol og CL-prøvebaner kan tydeligt observeres, og de proteinbånd, der er til stede i ikke-CL-kontrolprøvebanen, kan forklares ved tilstedeværelsen af ​​RNase. Dette illustrerer den stærke berigelse af mRBP'er i CL-prøven.

Effektiviteten af ​​tværbinding kan styres ved at variere tidsvarigheden af ​​UV-bestråling. Tilstrækkelig tværbinding, men undgåelsen af ​​protoplastskader og RNA-nedbrydning er optimal. I figur 1D blev specifikke proteinbåndsmønstre i alle CL-prøver opnået ved sammenligning af forskellige UV-bestrålingstider (1, 3 og 5 minutter). Under samme UV-intensitet (0,00875 W / cm2) blev de mest optimale betingelser fundet at være 1 eller 3 min, på grund af den ikke kan skelnesProteinbåndintensiteter. Svagere båndintensiteter blev observeret med længere krydsbindingstid (5 min). Vi betragtede 1 minut som den optimale betingelse, fordi en kortere varighed af tværbinding har den ekstra fordel, at man lettere overfører og samler protoplaster fra petriskålen. Protoplaster kan hurtigt udfældes til bunden af ​​Petri-skålen under UV-bestråling, fordi de holder sig til skålbunden. Dette gør det sværere at samle og overføre dem til rørene efter længere UV-bestrålingsvarighed.

Baseret på de optimerede betingelser blev identifikationen af ​​proteiner fra tre biologiske replikater efterfølgende opnået ved kvalitative og kvantitative proteomics, som blev beskrevet i trin 9 og 10. I analysen ved kvalitative proteomikker ( Figur 1E , højre) blev i alt 341 proteiner Blev identificeret i CL prøver, hvoraf 36 blev fundet både i ikke-CL-kontrol anD CL prøver, og kun 8 proteiner blev detekteret i non-CL kontrolprøven. Denne enorme forskel i identificerede proteinantal mellem begge prøver er i overensstemmelse med de forskellige proteinbåndsmønstre ( figur 1D ), der understøtter ideen om, at SDS-PAGE og sølvfarvningsassayet er gode værktøjer til at validere effektiviteten af ​​oligo-d (T) 25 perlefangst. I analysen ved kvantitative proteomics ( Figur 1E , venstre) viste i alt 325 proteiner (blå og grønfarvet) en log2-fold ændring større end 2. Blandt disse proteiner havde 100 proteiner (blåfarvet) små p -værdier over signifikansniveauet Derfor blev de også defineret som positive hits. Det er bemærkelsesværdigt, at p-værdierne af en anden 225 proteiner (grønfarvet) var større end 0,05, under signifikansniveauet som følge af dataressethed. Med andre ord var der ringe forekommende peptider til stede for hvert protein, med høj variabilitet af peptidintitiates. Men fordi de alle kun blev kvalitativt registreret i CL-prøver, blev de betragtet som positive.

Baseret på GO og InterPro databaserne 50 (trin 11) blev disse 325 proteiner yderligere klassificeret i kategori I (ribosomale proteiner), kategori II (hoved-RBP'er) og kategori III (kandidat-RBP'er) ( figur 1F ). Der var 123 ribosomale proteiner i kategori I, mens i kategori II blev 70 annoterede klassiske RBP'er observeret. Disse to kategorier, der indeholder de fleste annoterede proteiner, der binder til molekylær RNA-binding og RNA-biologi ( Figur 1F , højre), og som optager ca. 38% og 22% af det hele mRNA-bundne proteom, angiver høj effektivitet af optimeret mRNA-interaktom fange. De sidste 40% (132 kandidat-RBP'er) blev klassificeret i kategori III på grund af manglen på konventionelle RBD'er. Desuden er de fleste af thEir roller i RNA binding og RNA biologiske processer er ikke blevet valideret ( Figur 1F , venstre). Vi antager, at proteiner fra denne kategori kunne afsløre nye funktioner i RNA-regulativer.

figur 1
Figur 1: Flowchart og resultater af den optimerede metode til opdagelse af det mRNA-bundne protein fra Arabidopsis Leaf Mesophyll Protoplasts. ( A ) Store trin i hele metoden er angivet fra 1 til 11. Putative cellulære og molekylære processer er illustreret af billedet og tegneserierne. Detaljer for hvert trin er blevet beskrevet intensivt i protokollen. ( B ) Der observeredes en halo, der omgiver perlerpelleten i CL-prøven, men ikke i ikke-CL-kontrolprøven under vaske trin 4.3. ( C ) Sammenligning af relativ UBQ10 mRNA og 18S rRNA leveLs i ikke-CL-kontrol og CL-prøver ved qRT-PCR (værdier er gennemsnitlige ± SD (n = 3); * og **: signifikante forskelle med p <0,05 og <0,01). (D) Koncentreret protein eluent af ikke-CL kontrolprøve sammenlignet med CL prøver bestrålet med en kontinuerlig-bølge UV-kilde i 1, 3, og 5 min, med en UV-intensitet på 0,00875 W / cm2. ( E ) Identifikation af mRNA-bundet proteom ved proteomics. I de kvantitative proteomikker, der udføres af Progenesis softwarepakken (til venstre), viser vulkanplanen de gennemsnitlige log2-foldsændringer (CL / ikke-CL) og de relaterede justerede p-værdier (-log10 (adj. P-værdier)) af Alle proteiner. I den kvalitative proteomik, der udføres af Peaks softwarepakken (højre), er proteinerne i prøverne illustreret i Venn-diagrammer. Mængden af ​​proteinerne er anført i tal. FDR ved peptid og protein niveauer er under 5%. Antallet af proteiner inde i lysebrune rammer betragtes som positive hits. ( et al ., 2016. Klik venligst her for at se en større version af denne figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Vi har med succes anvendt mRNA interactome capture, udviklet til gær og humane celler, til at plante blad mesophyll protoplaster. Blad mesofylceller er den vigtigste type af jordvæv i plantebladene. Den største fordel ved denne metode er, at den bruger in vivo tværbinding for at opdage proteinerne fra et fysiologisk miljø.

I denne protokol præsenterer vi primært en række optimerede forsøgsbetingelser ( fx antallet af protoplaster, der skal anvendes som udgangsmateriale og varigheden af ​​UV-bestråling) 50 . De indfangede proteiner i CL-prøverne kan kun detekteres ved SDS-PAGE og sølvfarvning, når der anvendes mindst 10 7 protoplaster (mellemstore skalaer) (trin 1.5.5). Lavere koncentrationer giver ikke et observerbart mRBP-mønster på SDS-PAGE og bør sandsynligvis ikke anvendes til yderligere analyse af proteomics. Faktisk bruger mere end 10 7 celler ( fx 10 9 inEt stort eksperiment) er også muligt 20 . Resultater fra sølv-farvning assays tyder på, at UV-bestråling i 1 minut med 0,00875 W / cm2 intensitet frembragt af en kontinuerlig bølge UV-kilde er optimale (figur 1D). Høj effektivitet ved det kritiske trin ( dvs. mRNP-nedtrækning og oprensning ved oligo-d (T) 25 perler, trin 4) understøttes af resultaterne af RT-qPCR, sølvfarvning og MS-assays ( figur 1C ; 1D og 1E , højre). Kombinationen af ​​kvalitative og kvantitative proteomics kan bidrage til at identificere de positive RBP'er i overlapningsområdet mellem ikke-CL-kontrol og CL-prøver ( Figur 1E ). Størstedelen af ​​identificerede proteiner var RBP'er, der ikke tidligere var annoteret i datasæt ( figur 1F ). Vi præsenterede disse tidligere ukendte RNA-bindende proteiner i kategori III som kandidat-RBP'er <Sup class = "xref"> 50 ( figur 1F ). Undersøgelse af bindingsspecificiteterne af disse kandidat-RBP'er skal udføres ved anvendelse af andre metoder, såsom de tidligere nævnte CLIP-metoder 23 . Et eksempel, der undersøger bindingsspecificiteten af ​​en RBP til regulering af dets mål-mRNA-transkript i Arabidopsis ved brug af CLIP 51, findes i Zhang et al ., 2015. Derudover er en alternativ modificeret metode fra PAR-CLIP, kaldet photoactivatable- Ribonukleosidforbedret tværbinding (PAR-CL, 365 nm UV-A) er også blevet tidligere anbefalet til undersøgelse af mRNA-bundet proteomer fra gær og humane celler 14 , 23 . PAR-CL kræver 4Su, som optages af celler og inkorporeres i nascent RNA'er under RNA-metabolisme og kan være yderst reaktive, hvilket danner kovalente bindinger med aminosyrer 52 under UV-A (365 nm) irradition. I øjeblikket er der ingen undersøgelser, der fokuserer på toksiciteten af ​​4sU til plantecellerne og den effektive optagelse af eksogene 4sU i mesophyllprotoplaster 53 . Vi mener dog, at det bliver muligt at anvende både konventionelle CL (254 nm UV-C) og PAR-CL (365 nm UV-A) på planter, hvilket vil bidrage til opdagelsen og valideringen af ​​forskellige RBP'er fra de fysiologiske Miljø i fremtiden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgements

Vi anerkender lab af prof. Joris winderickx, som gav UV-tværbindingsapparatet udstyret med den konventionelle UV-lampe. KG støttes af KU Leuvens forskningsfond og anerkender støtte fra FWO-tilskud G065713N.

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics