MRNA Interactome Capture van Plant Protoplasts

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier presenteren wij een interactief capture protocol toegepast op Arabidopsis thaliana leaf mesophyll protoplasten. Deze methode berust op in vivo UV-verknoping en staat voor isolatie en identificatie van plantaardige mRNA-bindende eiwitten uit een fysiologische omgeving.

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

RNA-bindende eiwitten (RBP's) bepalen de fates van RNA's. Zij nemen deel aan alle RNA biogenese pathways en dragen bij tot post-transcriptie gene regulatie (PTGR) van messenger RNAs (mRNAs). In de afgelopen jaren zijn een aantal mRNA gebonden proteomen uit gist- en zoogdiercellijnen succesvol geïsoleerd door gebruik te maken van een nieuwe methode genaamd "mRNA interactome capture", die het mogelijk maakt om mRNA-bindende eiwitten (mRBP's) te identificeren. Direct vanuit een fysiologische omgeving. De werkwijze bestaat uit in vivo ultraviolette (UV) verknoping, aftrek en zuivering van messenger ribonucleoproteïne complexen (mRNPs) door oligo (dT) kralen, en de daaropvolgende identificatie van de verknoopte eiwitten door middel van massaspectrometrie (MS). Heel recent, door dezelfde methode toe te passen, zijn verschillende planten mRNA gebonden proteomen gelijktijdig gerapporteerd uit verschillende Arabidopsis weefsel bronnen: geëtolideerde zaailingen, bladweefsel,Blad mesofyl protoplasten, en gekweekte wortelcellen. Hier presenteren wij de geoptimaliseerde mRNA interactome capture methode voor Arabidopsis thaliana leaf mesophyll protoplasten, een celtype dat dient als een veelzijdig hulpmiddel voor experimenten die diverse cellulaire assays omvatten. De voorwaarden voor optimale eiwitopbrengst omvatten de hoeveelheid startweefsel en de duur van UV-bestraling. In het mRNA gebonden proteoom verkregen uit een middelgrote experiment (10 7 cellen) bleek dat RBP's die op RNA-bindende capaciteit beschikten, te oververtegenwoordigd waren en veel nieuwe RBP's werden geïdentificeerd. Het experiment kan opgeschaald worden (10 9 cellen), en de geoptimaliseerde methode kan toegepast worden op andere plantencel typen en soorten om in grote mate te isoleren, te catalogeren en mRNA-gebonden proteomen te vergelijken.

Introduction

Eukaryoten gebruiken meerdere RNA biogenese regulerende pathways om cellulaire biologische processen te behouden. Onder de bekende typen RNA is mRNA zeer divers en draagt ​​de coderingscapaciteit van eiwitten en hun isoformes 1. De PTGR-weg leidt de fatsussen van pre-mRNAs 2 , 3 . RBP's uit verschillende genfamilies regelen de regulering van RNA, en in PTGR leiden specifieke mRBPs mRNAs door directe fysieke interacties, die functionele mRNP's vormen. Daarom is het identificeren en karakteriseren van mRBP's en hun mRNP's van cruciaal belang om de regulering van cellulaire mRNA-metabolisme 2 te begrijpen. In de afgelopen drie decennia zijn diverse in vitro methoden - waaronder RNA-elektroforetische mobiliteitsverschuiving (REMSA) -assays, systematische evolutie van liganden door exponentiële verrijkingstests (SELEX) gebaseerd op bibliotheek-afgeleide constructen, RNA Bind-n-Seq (RBNS), radioactief gemerk of kwantitatiefFluorescentie-RNA-bindingsbepalingen, röntgenkristallografie en NMR-spectroscopie 4 , 5 , 6 , 7 , 8 , 9 - zijn op grote schaal toegepast op studies van RBP's, voornamelijk uit zoogdiercellen. De resultaten van deze studies van zoogdieren RBP's kunnen worden gezocht via de RNA-bindende Protein DataBase (RBPDB), die de gepubliceerde waarnemingen 10 verzamelt .

Hoewel deze in vitro benaderingen krachtige tools zijn, bepalen ze de gebonden RNA-motieven uit een bepaald RNA-pool van sequenties en zijn daarom beperkt in hun vermogen om nieuwe doel RNA's te ontdekken. Hetzelfde geldt voor berekeningsstrategieën om genoom-brede RBP's te voorspellen, die zijn gebaseerd op het behoud van eiwitsequentie en structuur 15 . Om dit te overwinnen is een nieuwe experimentele methode haS is vastgesteld die het mogelijk maakt om de RNA-motieven te identificeren die een RBP van belang heeft, alsmede voor de bepaling van de precieze plaats van binding. Deze methode, genaamd "verknoping en immunoprecipitatie" (CLIP), bestaat uit in vivo UV-verknoping gevolgd door immunoprecipitatie 11 . Vroege studies hebben aangetoond dat fotoactivering van DNA- en RNA-nucleotiden kan optreden bij excitatie UV-golflengten groter dan 245 nm. De reactie door thymidine lijkt gunstig te zijn (rang in volgorde van verminderde fotoreactiviteit: dT> dC> rU> rC, dA, dG) 12 . Door gebruik te maken van UV-licht met een golflengte van 254 nm (UV-C) werd geconstateerd dat covalente bindingen tussen RNA-nucleotiden en eiwitresiduen worden gecreëerd bij slechts enkele Astromen (Å). Het fenomeen wordt dus de "nul-lengte" verknoping van RNA en RBP genoemd. Dit kan gevolgd worden door een strikte zuivering procedure Duur met weinig achtergrond 13 , 14 .

Een complementaire strategie voor CLIP is het combineren van in vivo UV-verknoping met eiwitidentificatie om het landschap van RBP's te beschrijven. Een aantal van dergelijke genoomwijdte mRNA gebonden proteomen zijn geïsoleerd uit gistcellen, embryonale stamcellen (ESC's) en menselijke cellijnen ( dwz HEK293 en HeLa) met behulp van deze nieuwe experimentele aanpak, genaamd "mRNA interactome capture" 18 , 19 , 20 , 21 . De methode bestaat uit in vivo UV-verknoping gevolgd door mRNP zuivering en MS-gebaseerde proteomics. Door deze strategie toe te passen, zijn veel nieuwe "maanlichtende" RBP's die niet-kanonieke RBD's bevatten, ontdekt en is het duidelijk geworden dat meer eiwitten RNA-bindende capaciteiten hebben dan eerder werd verondersteld"> 15 , 16 , 17. Het gebruik van deze methode zorgt voor nieuwe toepassingen en voor de mogelijkheid om nieuwe biologische vragen te beantwoorden bij het onderzoeken van RBP's. Bijvoorbeeld, heeft een recente studie het behoud van het mRNA gebonden proteome onderzocht (de kern RBP Proteome) tussen gist en menselijke cellen 22 .

Plant RBP's zijn al gebleken betrokken te zijn bij groei en ontwikkeling ( bijv . In de posttranscriptie regulatie van bloeitijd, de circadiaanse klok en genuitdrukking in mitochondriën en chloroplasten) 24 , 25 , 26 , 27 , 28 , 29 . Bovendien worden ze gedacht aan functies in de cellulaire processen die reageren op abiotische stressen ( bijvoorbeeld koud, droogte, saLinheid en absciszuur (ABA)) 31 , 32 , 33 , 34 . Er zijn meer dan 200 voorspelde RBP genen in het Arabidopsis thaliana genoom, gebaseerd op RNA herkenningsmotief (RRM) en K homologie (KH) domein sequentie motieven; In rijst zijn ongeveer 250 genoteerd 35 , 36 . Het is opmerkelijk dat veel voorspelde RBP's uniek zijn voor planten ( bijv. Geen metazoan-orthologen tot ongeveer 50% van de voorspelde Arabidopsis- RBP's die een RRM-domein bevatten) 35 , wat suggereert dat veel nieuwe functies kunnen dienen. De functies van de meeste voorspelde RBP's blijven uncharacterized 23 .

De isolatie van mRNA gebonden proteomen uit Arabidopsis geëtolideerde zaailingen, bladweefsel, gekweekte wortelcellen en bladmemofyl protoplasten door het gebruik vanMRNA interactome capture is recentelijk gerapporteerd 38 , 39 . Deze studies tonen het sterke potentieel om in de nabije toekomst systematisch de functionele RBP's in planten te catalogeren. Hier presenteren we een protocol voor mRNA interactome capture van plant protoplasten (dat wil zeggen cellen zonder celwanden). Arabidopsis thaliana blad mesofyl protoplasten zijn het belangrijkste type bladcel. De geïsoleerde protoplasten zorgen voor optimale toegang van UV licht aan de cellen. Dit celtype kan gebruikt worden in analyses die transient eiwitten voor functionele karakterisering 40 , 41 uitdrukken. Bovendien is protoplasting toegepast op verscheidene andere plantencelsoorten en soorten 42 , 43 , 44 ( bijv. Petersson et al ., 2009; Bargmann en Birnbaum, 2010; en Hong et al ., 2012).

<P class = "jove_content"> De methode omvat in totaal 11 stappen ( figuur 1A ). Arabidopsis blad mesofyl protoplasten worden eerst geïsoleerd (stap 1) en worden vervolgens UV bestraald om verknoopte mRNPs (stap 2) te vormen. Wanneer protoplasten worden gelicht onder denatureringsomstandigheden (stap 3), worden de verknoopte mRNP's in lysis / bindingsbuffer vrijgegeven en door oligo-d (T) 25 kralen (stap 4) getrokken. Na verscheidene ronden strengende wassen worden de mRNP's gezuiverd en verder geanalyseerd. De gedenatureerde peptiden van mRBPs worden verteerd door eiwitase K voordat de verknoopte mRNA's worden gezuiverd en de RNA-kwaliteit wordt geverifieerd door qRT-PCR (stappen 5 en 6). Na behandeling met RNase en eiwitconcentratie (stap 7) wordt de proteïnekwaliteit geregeld door SDS polyacrylamide gelelektroforese (SDS-PAGE) en zilverkleuring (stap 8). Het verschil in eiwitbandpatronen kan gemakkelijk worden geïllustreerd tussen een verknoopt monster (CL) en een niet-verknoopt monster (niet-CL;Het negatieve controle monster van protoplasten die niet aan UV-bestraling worden blootgesteld). De identificatie van eiwitten wordt bereikt door middel van MS-gebaseerde proteomics. De eiwitten uit het CL-monster worden gescheiden door eendimensionale polyacrylamidegelelektroforese (1D-PAGE) om mogelijke achtergrondverontreiniging te verwijderen, "in-gel gedigereerd" in korte peptiden met behulp van trypsine, en worden gezuiverd (stap 9). Nano reverse-phase vloeistofchromatografie gekoppeld aan massaspectrometrie (nano-LC-MS) maakt het mogelijk de hoeveelheid definitieve eiwitten in het mRNA gebonden proteome te bepalen (stap 10). Tenslotte worden de geïdentificeerde mRBP's gekenmerkt en gecatalogiseerd met behulp van bioinformatische analyse (stap 11).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Arabidopsis Blad Mesophyll Protoplast Isolatie

OPMERKING: Arabidopsis blad mesofyl protoplasten zijn in hoofdzaak geïsoleerd, zoals beschreven door Yoo et al ., 2007, met verscheidene wijzigingen 40 .

  1. Groei van planten
    1. Week ongeveer 200 Arabidopsis thaliana Col-0 ecotype zaden in gesteriliseerd water gedurende 2 dagen bij 4 ° C in het donker voor stratificatie.
      OPMERKING: Dit aantal zaden is voldoende voor een non-CL monster en een CL monster (zie stap 1.3).
    2. Bereid potten op met een 50% ( v / v ) mengsel van grond en vermiculiet en week de potjes met gedestilleerd water in een dienblad om de grond te nat.
    3. Zaai en verdeel de gestratificeerde zaden op natte grond. Bedek de zaden niet met extra grond omdat Arabidopsis zaden licht nodig hebben voor ontkieming.
      OPMERKING: De plantengroeiomstandigheden zijn een 12 uur lange / 12-uurse durende cyclus bij 23 ° C,Met een lichtintensiteit van 100 μmol m -2 s -1 , in een groeikamer voor 5 weken voor bloei. 4 weken oude planten kunnen ook gebruikt worden 40 .
      OPMERKING: Alle beschreven materialen en reagentia van stap 1.2.1 tot en met 3.2.3 zijn voor twee monsters ( dwz één non-CL monster (het controlemonster dat niet onderworpen is aan UV-C bestraling) en een CL-monster (het onderzoek Monster dat onderworpen is aan UV-C bestraling)).
  2. Bereiding van isotonische enzymoplossing
    1. Maak 80 ml primaire isotonische enzymoplossing (400 mM mannitol, 20 mM KCl en 20 mM MES-buffer (pH 5,7)) en verwarm de oplossing onmiddellijk in een incubator van 60 ° C gedurende 10 minuten.
    2. Voeg 1,2 g Cellulase R10 ( w / v 1,5%) en 0,32 g Macerozyme R10 ( w / v 0,4%) poeder toe aan de warme primaire isotone enzymoplossing.
    3. Breng het enzympoeier zorgvuldig in oplossing door zacht roeren toe te passen. TikVerwarm de oplossing in een 60 ° C incubator gedurende 10 minuten totdat de enzymoplossing helder lichtbruin is.
    4. Koel de oplossing op ijs gedurende 3 minuten en voeg 800 ul van 1 M CaCl2 en 800 ui 10% (w / v) BSA aan de oplossing.
    5. Homogeniseer de oplossing door pipettering en filtering via een 0,22 μm filter. Aliquot deze laatste isotone enzymoplossing in twee grote Petrischalen (150 mm x 20 mm).
  3. Voorbereiding van Arabidopsis rozet bladstrips
    OPMERKING: 150 bladeren voor elke Petri schotel worden aanbevolen voor een non-CL monster of een CL monster.
    1. Kies en snijd totaal 300 volledig uitgezette 2e - of 3e -paar echte bladeren (gemiddeld 3-4 per rozet) in 0,5- tot 1-mm leaf strips met een nieuwe en scherp scheermesje.
    2. Plaats de strips onmiddellijk in de isotone enzymoplossing.
      OPMERKING: Om het contact met licht te vermijden, moet u altijd t afdekkenHij Petri Schotels Met Aluminiumfolie. Vermijd de bladeren niet. Bevestig dat alle strips in de oplossing ondergedompeld zijn en niet op het oppervlak drijven.
  4. Isolatie van Arabidopsis blad mesofyl protoplasten
    1. Leg de aluminiumfolie bedekte Petri-schotels in vacuümdrogers en infiltreer de bladstrips onder 30 minuten onder vacuüm. Vervolgens incubateer de Petri-schotels in duisternis zonder gedurende 2.5 uur bij kamertemperatuur te schudden.
    2. Schud de schotels horizontaal voorzichtig en kort, met de poging om de protoplasten volledig in de enzymoplossing te laten vallen.
  5. Oogsten en tellen van de protoplasten
    1. Filter de protoplast suspensie door een nylon gaas van 35 tot 75 μm. Aliquot het filtraat van elk monster in twee 50 ml ronde bodembuizen (ongeveer 20 ml filtraat in elke buis).
    2. Spoel elke Petri schotel met 10 ml W5 buffer (154 mM NaCl, 125 mM CaCl
    3. Spin alle vier buizen gedurende 5 minuten bij 100 xg om de protoplasten te pelletiseren. Gooi de supernatant weg en verwijder de protoplastpellets in elke buis voorzichtig met 10 ml W5-buffer.
      OPMERKING: Bij het resuspenderen van de protoplastpellets, draai de buis voorzichtig omlaag en draai de buis voorzichtig met de hand tot de pellets verdwenen zijn. Pipet de pellet niet direct om te vermijden dat de cellen worden beschadigd.
    4. Herhaal stap 1.5.3 eenmaal en combineer de protoplast suspensie van twee buizen van elk monster in een 50 ml ronde onderbuis. Houd de buizen op ijs.
    5. Tel de protoplasten met behulp van een hemocytometer.
      OPMERKING: Elke 20 cellen binnen 25 kubussen zijn gelijk aan 2 x 10 5 protoplasten / ml. 150 bladeren moeten ongeveer 1 x 107 cellen opleveren.Moduleren om een ​​gelijke totale aantal protoplasten in de niet-CL en CL-monsters te hebben.
    6. Houd de protoplasten op ijs gedurende 30 minuten. Vervolgens draai de buizen gedurende 5 minuten bij 100 x g. Verwijder het supernatant en resuspendeer de protoplasten per buis met 20 ml MMG-oplossing (400 mM mannitol, 15 mM MgCl2 en 4 mM MES buffer (pH 5,7)).

2. In vivo mRNA-eiwit verknoping door UV-bestraling

OPMERKING: Houd de non-CL monsterbuis op ijs. Het CL monster moet direct UV bestraald worden.

  1. Breng de protoplast suspensie met 1 x 107 cellen uit de CL-monsterbuis over op een nieuwe grote Petri-schotel (150 mm x 20 mm) en voeg 30 ml ijskoude MMg-oplossing toe om het plaatoppervlak te bedekken. Spreid de cellen in de hele MMg-buffer door zacht pipetteren. Plaats de Petri-schotel onmiddellijk zonder de bovenklep in een UV-verknopingsapparaat.
    OPMERKING: De hoogte tussen de UV-lampEn de petri schotel is 8 cm.
  2. Bestral het monster met 254 nm golflengte UV licht en 0,00875 W / cm 2 UV intensiteit gedurende 1 min, 3 min of 5 min. Na bestraling, snijd de protoplast-suspensie snel in twee nieuwe 50 ml ronde bodembuizen. Was de bodem van de schotel met een extra 5 ml ijskoude MMg oplossing om de rest van de protoplasten te verzamelen en deze cel suspensie aan deze twee buizen toe te voegen.
    OPMERKING: 1 min werd gekozen als optimale conditie. De uitleg staat in de representatieve resultaten .

3. Protoplast Lysis onder Denaturerende Voorwaarden

  1. Bereiding van protoplastpellets voor lysis
    1. Spin de niet-CL monsterbuis samen met de twee CL monsterbuizen van stap 2 bij 100 xg gedurende 5 minuten en wrijf de supernatant af. Plaats de buis van de protoplastpelletjes van het niet-CL-monster op ijs.
    2. Voeg 10 ml ijskoude MMg oplossing toe aan elke CL monsterbuis, genDe pellets opnieuw resuspenderen en combineren ze terug in een 50 ml ronde bodembuis. Spin de buis bij 100 xg gedurende 5 minuten. Na het verwijderen van de supernatant, houd de CL-proefbuis protoplast pellet op ijs.
  2. Protoplastlysis en homogeniserende protoplastlysaat
    1. Voeg 9 ml ijskoude lysis / bindingsbuffer (500 mM LiCl, 0,5% ( w / v ) lithiumdodecylsulfaat (LiDS), 5 mM dithiothreitol (DTT), 20 mM Tris-HCl (pH 7,5) en 1 mM EDTA (pH 8,0)) aan de celpellet van elk monster. Licht de protoplasten ongeveer 20 minuten omhoog en omlaag om ongeveer 20 keer te pipetteren totdat de suspensie homogeen lichtgroen is.
    2. Pas het protoplastlysaat twee keer door een 50 ml glazen spuit met een smalle naald (0,9 x 25 mm 2 ) voor homogenisatie. Incubeer het lysaat op ijs gedurende 10 minuten. Vries de lysaten in vloeibare stikstof en houd deze bij maximaal 3 weken bij -80 ° C.

4. MRNP aftrek en zuiveringDoor Oligo-d (T) 25 Kralen

OPMERKING: Alle onderstaande materialen en reagentia, van stap 4.1 tot stap 4.4, zijn alleen voor één monster ( dwz één non-CL monster of een CL monster). Het protoplastlysaat moet onmiddellijk worden toegevoegd aan de buizen die kralen bevatten, nadat de kralen supernatant lysis / bindingsbuffer is weggegooid.

  1. Bereiding van oligo-d (T) 25 magnetische kralen voor oligo (dT) capture
    1. Ontdooi het bevroren protoplastlysaat bij kamertemperatuur. Wanneer het lysaat volledig ontdooid is, houd de buis lysaat op ijs.
    2. Aliquot 1,8 ml oligo-d (T) 25 magnetische kralen (5 mg / ml) in 6 nieuwe 2 ml ronde bodem microcentrifuge buizen op ijs. In elke buis was de suspensie suspensie homogeen met 600 μl lysis / bindingsbuffer met korte pipettering omhoog en omlaag en voorzichtig te roteren bij 4 ° C gedurende 2 minuten. Houd de kralen op ijs.
  2. Verbindend
    1. PlaatsAlle 6 buizen bevatten de kralen in een magnetisch rek bij 4 ° C gedurende 3 minuten, wat resulteert in de magnetische opname van de kralen en het opruimen van de suspensie.
      OPMERKING: Wanneer de buizen in het magnetische rek zijn geplaatst, wacht tot de kralen volledig zijn gevangen, ten minste 3 minuten.
    2. Gooi de supernatant weg en ga meteen 9 ml protoplastlisaat in deze 6 buizen. Meng goed door pipetteren tot een homogene bruine suspensie verschijnt en incubeer de kralen in protoplastlysaat bij 4 ° C gedurende 1 uur door zachte rotatie aan te brengen.
      OPMERKING: een incubatietijd van 30 minuten tot 1 uur wordt aanbevolen.
  3. het wassen
    1. Plaats de buizen opnieuw in het magnetische rek bij 4 ° C gedurende 3 minuten. Wanneer alle kralen aan de zijkant van de buizen worden vastgelegd, haal het protoplastlysaat in 6 nieuwe 2 ml ronde bodemmicrocentrifugebuizen op en houd ze tijdelijk op 4 ° C. Verwerp het protoplastlysaat niet onmiddellijk; Houd het lysaat vastBij 4 ° C.
    2. Voeg 1,5 ml ijskoude wasbuffer 1 (500 mM LiCl, 0,1% ( w / v ) LiDS, 5 mM DTT, 20 mM Tris-HCl (pH 7,5) en 1 mM EDTA (pH 8,0) toe aan de parels In elke buis. Resuspendeer de kralen en draai de lichte rotatie gedurende 1 minuut aan. Plaats de buizen opnieuw in het magnetische rek bij 4 ° C gedurende 3 minuten en gooi de supernatant weg. Herhaal deze wasstap met een wasbuffer.
    3. Herhaal dezelfde procedure van deze wasstap twee keer met 1,5 ml ijskoude wasbuffer 2 (500 mM LiCl, 5 mM DTT, 20 mM Tris-HCl (pH 7,5) en 1 mM EDTA (pH 8,0)) en eenmaal gebruikmakend van 1,5 ml ijskoude laagzoutbuffer (200 mM LiCl, 20 mM Tris-HCl (pH 7,5) en 1 mM EDTA (pH 8,0)).
      OPMERKING: Als de mRNP's efficiënt geïsoleerd zijn uit het protoplastlysaat, zou er een "halo" zichtbaar moeten zijn rond de kraalpelletje in het CL-monster tijdens de wasstap met wasbuffer 2 ( Figuur 1B ).
  4. elutie
    1. Voeg 500 μL toeVan elueringsbuffer (20 mM Tris-HCl (pH 7,5) en 1 mM EDTA (pH 8,0)) aan de kralen in elke buis. Resulteer de kralen voorzichtig en incubeer gedurende 3 minuten bij 50 ° C om de poly (A) -taafde RNA's te ontlaten. Resulteer de kralen eenmaal door pipettering. Plaats de buizen 5 minuten in de magnetische rek bij 4 ° C.
    2. Breng alle eluenten (ongeveer 3 ml in totaal) over en combineer deze met een schoon, steriel RNase-vrij, 15 ml kegelbuis op ijs.
      OPMERKING: De kwaliteit en hoeveelheid RNA kunnen meteen worden bepaald met behulp van een spectrofotometer.
      OPMERKING: De RNA-concentratie van elk monster is ongeveer 10 ng / μl, met een A 260 / A 280- verhouding van 1,9. De A 260 / A 280 verhouding zou tussen 1,6 en 2,0 moeten zijn omdat de geïsoleerde poly (A) -taafde RNA's gewoonlijk meer dan 70% zuiver zijn. Als de RNA-concentratie te laag is, verhoog het aantal startprotoplasten tot maximaal 10 9 . samplesKan in vloeibare stikstof worden bevroren en bij langdurige opslag bij 80 ° C gehouden worden.
    3. Herhaal stap 4.2 tot stap 4.4 voor nog eens twee rondes en gebruik de oligo-d (T) 25 kralen opnieuw om de poly (A) getekende RNA's uit de protoplastlisaat af te dekken.
      OPMERKING: Na drie ronden van de aftrekprocedure moeten er in totaal 9 ml eluens voor elk non-CL- of CL-monster zijn. Doe al het werk bij 4 ° C om de afbraak van RNA te vermijden. Volg stap 4.5 of stap 4.6 om de kralen opnieuw te gebruiken of te regenereren.
  5. Bereiding van opnieuw gebruikte oligo-d (T) 25 kralen
    1. Was de kralen tweemaal met 1 ml ijskoude elutiebuffer en één keer met 1 ml ijskoude lysis / bindingsbuffer om de zout LiCl-concentratie terug te zetten naar 500 mM.
    2. Volg stap 4.1, verwijder de supernatant, verplaats het opgeslagen protoplastlysaat in elke buis en herhaal de hele procedure van stap 4.2 tot stap 4.4 voor nog twee ronden.
  6. 25 kralen
    OPMERKING: Kralen kunnen worden opgeslagen en gebruikt voor een ander experiment (maximaal hergebruik is drie keer).
    1. Volg stap 4.4, voeg 1 ml 0,1 M NaOH toe aan de kralen en incubeer door gedurende 5 minuten bij kamertemperatuur te roteren. Voor elke buis twee keer wassen met 1 ml wasbuffer 1 en 3 keer met 1x PBS (pH 7,4) die 0,1% Tween-20 bevat voor evenwicht. Houd de kralen uit elke buis in 300 μL steriele RNase-vrije 1x PBS (pH 7,4) die 0,1% Tween-20 bij 4 ° C bevat voor langdurige opslag.
      OPMERKING: Kralen gebruikt voor Arabidopsis CL monsters in dit experiment kunnen de volgende keer alleen voor dezelfde plantmonsters worden gebruikt.

5. Proteïnase K Behandeling en mRNA zuivering

  1. Proteinase K behandeling
    1. Voeg 8 μL Proteinase K oplossing (2 μg / μL) toe aan 1 ml van het eluens van elk monster om de UV-verknoopte eiwitten te verteren. BrIefly vortex.
  2. MRNA zuivering
    1. Incubeer het eluent bij 37 ° C gedurende 1 uur. Zuiver het RNA met behulp van de RNA zuiveringsset om resterende verontreinigingen te verwijderen.
      OPMERKING: Na zuivering zijn de RNA's klaar voor de RNA-kwaliteitstest met behulp van de qRT-PCR-analyse.
      OPMERKING: Andere kits, zoals RNA mini kit en TRIzol reagens, kunnen ook gebruikt worden 14 .

6. qRT-PCR-analyse

  1. Reverse transcriptie
    1. Bereik efficiënte synthese van eerste-strand cDNA met behulp van het omgekeerde transcriptiesysteem, met 1 μg RNA als de sjabloon. Verdun het monster tot 5 ng / μL met nuclease-vrij water.
  2. CDNA kwantificering met behulp van qRT-PCR
    1. Vergroot en kwantificeer het cDNA met behulp van de qPCR master mix en de real-time PCR cycler, met 10 ng cDNA als de sjabloon. Gebruik het volgende PCR-programma: 95 ° C gedurende 10 minuten(Stadium 1, één cyclus) en 95 ° C gedurende 15 s en 60 ° C gedurende 1 minuut (stadium 2, 40 cycli).
      OPMERKING: Het hier gebruikte referentiegen was een endogeen interne controle gen, UBQ10 (AT4G05320). QRT-PCR primers voor UBQ10 en 18S rRNA werden beschreven in Li et al ., 2014 en Durut et al ., 2014 respectievelijk 45 , 46 . Primer sequenties staan ​​vermeld in de Materiaal Tabel .

7. RNase Behandeling en mRBP Concentratie

  1. RNase behandeling
    1. Voeg ongeveer 100 U RNase-cocktail met RNase A en RNase T1 in 8 ml eluent toe. Inclusief een negatief-controle monster met RNase cocktail waarin het eluent wordt vervangen door nuclease-vrij water. Kortom draaikolk en incubeer bij 37 ° C gedurende 1 uur.
  2. MRBP concentratie
    1. Na RNase-spijsvertering, concentreer het eluent-usinG centrifugale filtereenheden. Het eindvolume is 75 μl, met een totale eiwitopbrengst van ongeveer 2 μg van elk monster na concentratie. Plaats de monsters bij -80 ° C voor langdurige opslag.

8. SDS-PAGE en Silver Staining

  1. SDS-PAGE
    1. Meng 25 μL van het geconcentreerde eluens (CL monster) of het controle monster (niet-CL monster) met 15 μl 2x laadkleuring. Verhit het monster bij 95 ° C gedurende 5 minuten en laad het op een SDS-PAGE gel die 5% stapelgel bevat en 12% oplosbare gel, inclusief een eiwitmarkering.
    2. Kondenseer de eiwitten bij 60 V gedurende 40 minuten en scheid bij 160 V gedurende ongeveer 1 uur totdat de laadkleuring het einde van de oplossende gel bereikt.
  2. Silver-staining assay
    1. Was de SDS-PAGE gel tweemaal per keer met ultrauw water gedurende 5 minuten. Voer het zilververf van de eiwitten uit door gebruik te maken van een commercieel zilvervlekstuk.
      OPMERKING: De eiwitbanden moeten binnen 5 minuten getoond worden. Als de banden langer dan 5 minuten zichtbaar zijn met een zeer lichte kleur, wordt het voorgesteld om het aantal startprotoplasten te verhogen tot maximaal 10 9 .

9. Trypsine Digest of Protein Bands en Peptide Purification

  1. Trypsine verteren
    OPMERKING: Voer een tweede 1D-PAGE gel uit door nog eens 25 μL geconcentreerde mRBP oplossing van elk monster voor mRBP identificatie te nemen; Zilvergekleurde gels kunnen niet gebruikt worden omdat ze niet compatibel zijn met MS-analyse.
    1. Na het uitvoeren van de 1D-PAGE gel, fixeer de gel in fixatieoplossing (50% ( v / v ) methanol en 10% ( v / v azijnzuur) gedurende 1 uur. Vlek de gel in vlekoplossing (0,1% ( w / v ) Coomassie Brilliant Blue R-250, 50% ( v / v ) methanol en 10% ( v / v ) azijnzuur gedurende 20 minuten met zacht schudden. Verlos de gel in de weg oplossing (40% ( v / v ) methanol en 10% ( v/ V) azijnzuur) gedurende 1 uur. Na de afbraak, houd de gel in 5% ( v / v ) azijnzuur.
      OPMERKING: Tijdens het vernietigen kan de nieuwe destain oplossing worden vervangen totdat de achtergrond volledig is vernietigd.
    2. Knip de banden van belang uit de gel. Knip de banden verder in stukken van ongeveer 1 mm 3 voor de daaropvolgende optimale trypsine vertering en extractie van peptiden. Hydrateren gelstukken met 50 pl 100 mM ammoniumbicarbonaat (NH4 HCO 3) gedurende 10 minuten. Bedek de gelstukken helemaal af.
      1. Verwijder de hydraterende oplossing voorzichtig en dehydrateren de gelstukken met acetonitril (CH3CN) gedurende 10 min. Verwijder de acetonitriloplossing voorzichtig.
      2. Herhaal het proces van hydratatie tot uitdroging tweemaal. Tenslotte verwijder de acetonitriloplossing.
        OPMERKING: De gel looptijd hangt af van het doel van het experiment. Een langere tijd laat een goede scheiding van eiwitten toe, zodat het gekleurde specifieke gelverbodDS kan worden uitgesneden voor verdere analyse. Als het doel is om de eiwitten te bewaren en verontreinigingen te verwijderen, is een korte termijn voldoende.
    3. Voeg 500 μl 6,6 mM DTT-oplossing toe en incubeer de gelstukken gedurende 10 minuten. Verwijder de DTT-oplossing en doe de gelstukken tweemaal met 500 μl 95% ( v / v ) acetonitriloplossing.
      1. Na het wassen, verwijder de acetonitriloplossing en incubeer de gelstukken met 500 μL 55 mM iodazijnzuur (IAA) oplossing gedurende 10 minuten in de duisternis.
      2. Na incubatie, verwijder de oplossing en was de gelstukken opnieuw met 500 μL 95% ( v / v ) acetonitriloplossing. Droog de gelstukken.
    4. Integreer de gelstukken geheel met 25 pl digestie buffer (50 mM NH4 HCO 3, 5 mM CaCl2, en 6 ng / ul trypsine) en houden op ijs gedurende 45 minuten te laten de trypsine doordringen in de gel. Incubeer de gelstukken gedurende de nacht bij 37 ° C voor en Zymatische spijsvertering.
  2. Peptide zuivering
    1. Voeg 80 ul van 50 mM NH4 HCO 3 de gelstukken in digestiebuffer en vortex herhaaldelijk om de tryptische peptiden te extraheren. Verzamel het extract. Herhaal deze extractietijd tweemaal met 80 μL 50% ( v / v ) CH 3 CN en 5% ( v / v ) mierenzuur (FA).
      OPMERKING: Het totale uiteindelijke extract moet ongeveer 240 μL zijn.
    2. Pool en concentreer de extracten in ongeveer 10 μl door vacuümconcentratie of lyofilisatie en voeg 25 μl 0,1% ( v / v ) waterige trifluorazijnzuur (TFA) oplossing toe. Verwijder de monsters met μ-C18 kolommen, volgens het protocol van de fabrikant.
    3. Elueer de peptiden met 4-10 pl 60% (w / v) CH3CN en 0,1% (v / v) FA. Lyophiliseer (vriesdroog) de peptiden en sla ze op -20 ° C tot analyse.
Titel "> 10. Nano-LC-MS

  1. Nano reverse-phase vloeistofchromatografie
    OPMERKING: Doe de LC-MS analyse met een massaspectrometer die online gekoppeld is met een vloeistofchromatografie instrument. Dit instrument moet uitgerust zijn met een C18 kolom (2 μm deeltje, 100 Å poriegrootte en 50 μm x 15 cm in afmeting).
    1. Resuspendeer de gevriesdroogde peptiden in 16 ul oplossing (2% (v / v) CH3CN en 0,1% (v / v) FA). Spuit 5 μL peptideoplossing in met een stromingssnelheid van 5 μl / min op een C18-voorloper (3 μm deeltjesgrootte, 100 Å poriegrootte, nanoviper en 75 μm x 2 cm in afmeting).
    2. 10.1.2. De peptiden scheiden met een 95 min-gradiënt met een stromingssnelheid van 300 nL / min. Tijdens dit scheidingsgradiënt, verhoog de mobiele fase B van 4 tot 10%, 10% tot 25% en 25% tot 45% in respectievelijk 5 minuten, 50 minuten en 18 minuten. Ten slotte verhoog de mobiele fase B steil naar 95% in 1 minuut. NaElk 95 min scheidingsgradiënt past een inherente spoeltrap toe die een 10 min-gradiënt van 4% tot 95% in 5 minuten bevat.
      OPMERKING: Mobiele fase A 99,9% H2O en 0,1% (v / v) FA en mobiele fase B is 19,92% H2O, 80% (w / v) CH3CN en 0,08% (v / v ) FA.
  2. Massaspectrometrie analyse
    1. Bedien de massaspectrometer in dataafhankelijke modus met een massabereik van 400 tot 1.600 m / z.
    2. Selecteer tot tien van de meest intense ionen in MS1 ​​om de fragmentatie spectra te genereren. Stel de resolutie in op maximaal 70.000 full width bij half maximum (FWHM) voor MS1 en 17.000 voor MS2, met een doelwit van automatische versterking (AGC) van 3.000.000 en 1.000.000 ionen en een maximale ioninjectietijd (IT) van 256 en 64 ms voor MS1 En respectievelijk MS2.
    3. Stel de dynamische uitsluiting in op 10 s om herhaalde fragmentatie van de meest overvloedige ionen te vermijden.
      OPMERKING: hier zijn ionen met één of meer dan zes ladingen eXcluded voor MS2.
  3. Kwalitatieve proteomics: peptide- en eiwitidentificatie
    1. Analyseer fragmentatie spectra met behulp van software zoals Peaks studio software 47 , 48 , 49 .
      OPMERKING: Andere softwarepakketten zijn ook beschikbaar voor peptide-identificatie, zoals NovoHMM 30 en PepNovo 37 voor de novo sequencing en SEQUEST 54 en Mascot 55 voor database zoeken.
    2. Combineer spectra met dezelfde massa (<2 ppm verschil) en retentietijden (<2 min) en behoud alleen spectra met een kwaliteitsdrempel hoger dan 0,65 om de Swiss-Prot-database (versie: december 2013) te zoeken voor de taxonomie die is ingesteld op model Plant Arabidopsis Thaliana . Gebruik de volgende zoekparameters: een voorlopermassetolerantie van 10 ppm door het gebruik van de monOisotopische massa; Een fragment massa tolerantie van 20 mmu; Trypsine als het spijsverteringsenzym, met maximaal 2 gemiste spleten; Cysteïne carbamidomethylering als de vaste wijziging; Methionine oxidatie als de variabele modificatie; En maximaal 3 variabele post-translationele modificaties per peptide. Na identificatie stelt u de score drempels voor betrouwbare peptide- en eiwitidentificatie in, zodat een valse ontdekkingsfrequentie (FDR) <5% wordt verkregen.
  4. Kwantitatieve proteomics: statistische analyse van massaspectrometrie data
    1. Gebruik LC-MS ( bijv. Progenesis) voor de etiketvrije kwantificering van proteomics data.
      OPMERKING: MS1 peptide piek gebieden (of intensiteit) zijn gekoppeld aan de peptiden die door de studio software zijn geïdentificeerd volgens hun massa, met de tolerante fout op maximaal 10 ppm.
      OPMERKING: Deze software berekent het overvloed van een peptide door de piekoppervlakken van alle ladingsstaten tussen 2 <te integrerenSup> + en 8 + . De kwantitatieve data is gekoppeld aan de PEAKS peptide identificatie door een inhouse script (massa matching met de tolerante fout bij maximaal 10 ppm).
    2. Bereken de gemiddelde log2-vouwveranderingen (CL / niet-CL) voor elk peptide. Groepeer de vouwveranderingen van de unieke peptiden door eiwitten.
      OPMERKING: In elke groep komt de uiteindelijke vouwverandering van een eiwit overeen met de gemiddelde vouwveranderingen van zijn peptiden.
    3. Bereken de p-waarde met behulp van de t- toets van de student voor elke groep om de statistische betekenis te evalueren. Pas R-softwarepakket toe (versie 3.3.0) om de p-waarden voor de FDR van alle groepen te corrigeren met behulp van de Benjamini-Hochberg (BH) methode.
    4. Teken de vulkaanplot met behulp van het functiepakket "Kalibreren" (versie 1.7.2) dat compatibel is met het R-softwarepakket (versie 3.3.0).
      OPMERKING: hier zijn de -log10-aangepaste p-waarden (-log10 (bijv. P-waarde)) een functie van de log2-voudige wijzigingen van alle geïdentificeerde eiwitten. Proteïnen zijnBehandeld als positieve hits in het mRNA gebonden proteoom als hun log2-voudige veranderingen groter zijn dan 2, met of zonder betekenis.

11. Catalogus van het geïdentificeerde mRNA gebonden proteome

  1. Klassificeer de geïdentificeerde eiwitten van stap 10 in drie categorieën op basis van de items van "moleculaire functies en biologisch proces" via de Gene Ontology (GO) database en "familie en domein" via de InterPro database.
  2. Zoals categorie I, of "Ribosomale eiwitten" bevat alle gedetecteerde ribosomale eiwitten, definiëren eiwitten uit categorie II, of "Main RBPs," zoals geannoteerde eiwitdomeinen die interactie hebben met RNA's of koppelen aan RNA-binding met bekende of onbekende functies in RNA-biologie .
  3. Aangezien eiwitten met bekende of onbekende functies in RNA-biologie zonder geannoteerde RNA-bindende domeinen in categorie III of "Kandidaat RBP's" worden gedefinieerd, definiëren enzymen uit categorie III op basis van annotaties van de INtEnz database.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

We hebben een karakteristieke halo waargenomen die de kralenpelletje in het CL-monster omsluit, in wasstap 4.3 met wasbuffer 2 ( Figuur 1B ). Hoewel het niet is onderzocht, kan dit fenomeen waarschijnlijk worden verklaard door de interferentie van verknoopte mRNP complexen met kraal aggregatie tijdens de magnetische opname waardoor een meer diffuus aggregaat wordt gevormd. Het geeft aan dat de oligo-d (T) 25 kraalvangst effectief was 14 .

De aanzienlijk hogere UBQ10 referentie mRNA niveaus dan 18S rRNA in zowel niet-CL controle en CL monsters zijn getoond in Figuur 1C . Dit wijst erop dat mRNA's in het eluens verrijkt worden door de opname door oligo-d (T) 25 kralen, die alleen binden aan poly (A) -taire mRNA's. De efficiëntie van de oligo-d (T) 25 kraalvangst was verder suppDoor SDS-PAGE en zilverkleuring (stap 8), zoals getoond in Figuur 1D na RNase-behandeling en mRBP-concentratie (stap 7). Een verschil in eiwitbandpatroon tussen niet-CL-controle en CL-monsterbanen kan duidelijk worden waargenomen en de eiwitbanden die aanwezig zijn in de niet-CL-controlemonsterbaan kunnen verklaard worden door de aanwezigheid van RNase. Dit illustreert de sterke verrijking van mRBP's in het CL-monster.

De efficiëntie van verknoping kan geregeld worden door de tijdsduur van UV-bestraling te variëren. Voldoende verknoping, maar het vermijden van protoplastschade en RNA-afbraak is optimaal. In Figuur 1D werden specifieke eiwitbandpatronen in alle CL-monsters verkregen bij het vergelijken van verschillende UV-bestralingstijden (1, 3 en 5 minuten). Onder dezelfde UV-intensiteit (0,00875 W / cm2), werden de optimale omstandigheden gevonden voor 1 of 3 min, vanwege de onderscheidenEiwitbandintensiteiten. Zwakkere bandintensiteiten werden waargenomen bij de langere verknopingstijd (5 min). We beschouwden 1 minuut als de optimale conditie, omdat een kortere duur van verknoping het extra voordeel heeft van een makkelijkere overdracht en verzameling van protoplasten uit de Petri-schotel. Protoplasten kunnen snel worden neergeslagen naar de bodem van de Petri schotel tijdens UV-bestraling omdat ze vasthouden aan de schotelbodem. Dit maakt het moeilijker om ze na de UV-bestraling langer te verzamelen en over te brengen naar de buizen.

Op basis van de geoptimaliseerde omstandigheden werd de identificatie van eiwitten uit drie biologische replicaten vervolgens bereikt door kwalitatieve en kwantitatieve proteomics, die beschreven werd in stappen 9 en 10. In de analyse door kwalitatieve proteomics ( Figuur 1E , rechts) werden in totaal 341 eiwitten Werden geïdentificeerd in CL-monsters, waarvan 36 beide werden gevonden in niet-CL-controle anD CL monsters, en slechts 8 eiwitten werden gedetecteerd in het non-CL controle monster. Dit enorme verschil in geïdentificeerde eiwitgetallen tussen beide monsters is in overeenstemming met de verschillende eiwitbandpatronen ( Figuur 1D ), die het idee ondersteunen dat de SDS-PAGE en zilverkleuringstest een goed instrument zijn om de efficiëntie van oligo-d (T) te valideren. 25 kraalvangst. In de analyse door kwantitatieve proteomics ( Figuur 1E , links), bleek in totaal 325 eiwitten (blauw- en groenkleurig) een log2-voudige verandering groter dan 2. Onder deze eiwitten hadden 100 eiwitten (blauwkleurige) kleine p -waarden boven het significante niveau Daarom werden ze ook gedefinieerd als positieve hits. Het is opmerkelijk dat de p-waarden van nog eens 225 eiwitten (groenkleurig) groter waren dan 0,05, onder het significante niveau als gevolg van data-slapheid. Met andere woorden, er waren weinig proteïnen aanwezig, met hoge variabiliteit van peptide intensities. Echter, omdat ze allemaal kwalitatief werden gedetecteerd in CL-monsters, werden ze als positief beschouwd.

Op basis van de GO en InterPro databases 50 (stap 11) werden deze 325 eiwitten verder ingedeeld in categorie I (ribosomale eiwitten), categorie II (hoofd-RBP's) en categorie III (kandidaat-RBP's) ( Figuur 1F ). Er waren 123 ribosomale eiwitten in categorie I, terwijl in categorie II 70 geannoteerde klassieke RBP's werden waargenomen. Deze twee categorieën - die de meeste geannoteerde eiwitten bevatten die koppelen aan moleculaire RNA binding en RNA biologie ( Figuur 1F , rechts) en die ongeveer 38% en 22% van het gehele mRNA gebonden proteome bezetten, geven de hoge efficiëntie aan van geoptimaliseerde mRNA interactome vangst. De laatste 40% (132 kandidaat-RBP's) werden ingedeeld in categorie III door het gebrek aan conventionele RBD's. Bovendien, de meeste van thEir rollen in RNA bindende en RNA biologische processen zijn niet gevalideerd ( Figuur 1F , links). Wij veronderstellen dat eiwitten uit deze categorie nieuwe functies in RNA-regelgeving kunnen onthullen.

Figuur 1
Figuur 1: Flowchart en resultaten van de geoptimaliseerde methode voor het ontdekken van het mRNA-gebonden eiwit van Arabidopsis Leaf Mesophyll Protoplasten. ( A ) De belangrijkste stappen van de gehele methode zijn vermeld van 1 tot 11. Gepaste cellulaire en moleculaire processen worden geïllustreerd door de foto en cartoons. Details voor elke stap zijn intensief beschreven in het protocol. ( B ) Een halo werd waargenomen rond de kralenpellet in het CL-monster, maar niet in het niet-CL-controlemonster tijdens wasstap 4.3. ( C ) Vergelijking van relatief UBQ10 mRNA en 18S rRNA leveLs in niet-CL-controle en CL-monsters met qRT-PCR (waarden zijn gemiddelde ± SD (n = 3); * en **: significante verschillen met p <0,05 en <0,01). (D) Geconcentreerde eiwit eluent van niet-CL controlemonster vergeleken met CL monsters bestraald door een continue-golf UV bron voor 1, 3 en 5 minuten, met UV-intensiteit bij 0,00875 W / cm2. ( E ) Identificatie van mRNA gebonden proteoom door proteomics. In de kwantitatieve proteomics die door het Progenesis-softwarepakket (links) worden uitgevoerd, toont de vulkaanplot de gemiddelde log2-vouwveranderingen (CL / niet-CL) en de bijbehorende aangepaste p-waarden (-log10 (bijv. P-waarden)) van Alle eiwitten. In de kwalitatieve proteomics uitgevoerd door het Peaks softwarepakket (rechts) worden de eiwitten in de monsters geïllustreerd in Venn-diagrammen. De hoeveelheid eiwitten staat vermeld in cijfers. De FDR bij het peptide- en eiwitgehalte is lager dan 5%. De aantallen eiwitten in de lichtbruine frames worden beschouwd als positieve hits. ( et al ., 2016. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

We hebben succesvol mRNA interactome capture toegepast, ontwikkeld voor gist en menselijke cellen, om blad mesofyl protoplasten te planten. Bladmacofylcellen zijn de belangrijkste aardweefsel in plantenblaadjes. Het grote voordeel van deze methode is dat het in vivo verknoping gebruikt om de eiwitten uit een fysiologische omgeving te ontdekken.

In dit protocol presenteren we voornamelijk een aantal geoptimaliseerde experimentele condities ( bijvoorbeeld het aantal protoplasten die als uitgangsmateriaal dienen en de duur van UV-bestraling) 50 . De gevangen eiwitten in de CL-monsters kunnen alleen gedetecteerd worden door SDS-PAGE en zilverkleuring wanneer er minimaal 10 7 protoplasten (middelgrote) worden gebruikt (stap 1.5.5). Lagere concentraties geven geen waarneembaar mRBP patroon op SDS-PAGE en zouden waarschijnlijk niet moeten worden gebruikt voor verdere analyse door proteomics. Inderdaad, met meer dan 10 7 cellen ( bijv. 10 9 inEen grootschalig experiment) is ook mogelijk 20 . Resultaten van zilver-kleuring testen suggereren dat UV bestraling gedurende 1 min aan 0,00875 W / cm2 intensiteit gegenereerd door een continue-golf UV bron optimaal (figuur 1D). Hoge efficiëntie bij de kritische stap ( d.w.z. mRNP-aftrek en zuivering door oligo-d (T) 25 kralen, stap 4) wordt ondersteund door de resultaten van de RT-qPCR, zilververf en MS-assays ( Figuur 1C ; 1D ; en 1E , rechts). De combinatie van kwalitatieve en kwantitatieve proteomics kan helpen bij het identificeren van de positieve RBP's in het overlappingsgebied tussen niet-CL-controle en CL-monsters ( Figuur 1E ). De meerderheid van geïdentificeerde eiwitten waren RBP's die niet eerder in data sets werden geannoteerd ( Figuur 1F ). We presenteren deze eerder onbekende RNA-bindende eiwitten in categorie III als kandidaat-RBP's <Sup class = "xref"> 50 ( figuur 1F ). Het onderzoeken van de bindingsspecificiteiten van deze kandidaat-RBP's moet worden uitgevoerd met behulp van andere methoden, zoals de eerder genoemde CLIP-methoden 23 . Een voorbeeld dat de bindingsspecificiteit van een RBP onderzoekt om zijn target mRNA transcript in Arabidopsis te regelen door het gebruik van CLIP 51, is te vinden in Zhang et al ., 2015. Daarnaast is een alternatieve gewijzigde methode van PAR-CLIP, genaamd fotoactivatable- Ribonucleoside versterkte verknoping (PAR-CL, 365 nm UV-A) is ook eerder aanbevolen voor het onderzoek van mRNA gebonden proteomen uit gist- en menselijke cellen 14 , 23 . PAR-CL vereist 4Su, die door cellen wordt opgenomen en opgenomen in nascent RNA's tijdens het metabolisme van het RNA en kan zeer reactief zijn, waarbij covalente bindingen worden gevormd met aminozuren 52 onder UV-A (365 nm) irradiatie. Momenteel zijn er geen studies gericht op de toxiciteit van 4sU aan de plantencellen en de efficiënte opname van exogene 4sU in mesofylprotoplasten 53 . Wij geloven echter dat het mogelijk wordt om zowel conventionele CL (254 nm UV-C) als PAR-CL (365 nm UV-A) op planten te gebruiken, die zal bijdragen tot de ontdekking en validatie van diverse RBP's uit de fysiologische Milieu in de toekomst.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgements

Wij erkennen het laboratorium van prof. Joris Winderickx, die de UV-verknopingsapparaat heeft voorzien van de conventionele UV-lamp. KG wordt ondersteund door het onderzoeksfonds KU Leuven en erkent steun van FWO-subsidie ​​G065713N.

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics