MRNA Interactome ללכוד מן Protoplasts הצמח

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

כאן, אנו מציגים פרוטוקול האינטראקציה ללכוד להחיל על Arabopopsis thaliana עלה mesophyll protoplasts. שיטה זו מסתמכת באופן קריטי על vivo UV crosslinking ומאפשר בידוד וזיהוי של חלבונים mRNA מחייב הצמח מסביבה פיזיולוגית.

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

RNA מחייב חלבונים (RBPs) לקבוע את גורלם של RNAs. הם משתתפים בכל המסלולים ביוגנזה רנ"א ובמיוחד לתרום שלאחר תקנת גנים תקנה (PTGR) של RNAs השליח (mRNAs). בשנים האחרונות, מספר mRNA-proteomes כבול מן השמרים שורות תאים יונקים היו מבודדים בהצלחה באמצעות שיטה חדשנית בשם "mRNA אינטראקציה ללכוד", המאפשר זיהוי של mRNA מחייב חלבונים (mRBPs) ישירות מתוך סביבה פיזיולוגית. השיטה מורכבת מ - vivo אולטרה סגול (UV) crosslinking, משוך מטה וטיהור של מסנג 'ר ribonucleoprotein קומפלקסים (mRNPs) על ידי חרוזים אוליגו (DT), ואת זיהוי שלאחר מכן של חלבונים crosslinked על ידי ספקטרומטריית מסה (MS). לאחרונה, על ידי יישום שיטה זהה, כמה צמחים mRNA כבול חלבונים דווחו בו זמנית ממקורות רקמה שונים ארבידופסיס : שתילים etiolated, רקמת עלה,עלה prooplasts mesophyll, ותאי שורש תרבותי. כאן, אנו מציגים את אופטימיזציה mRNA אינטראקציה ללכוד שיטת ארבידופסיס thaliana protoplasts mesophyll עלה, סוג התא המשמש כלי רב תכליתי עבור ניסויים הכוללים מבחני הסלולר השונים. התנאים התשואה חלבון אופטימלי כוללים את כמות הרקמות החל ואת משך קרינה UV. ב- mRNA-proteome שהתקבל בניסוי בקנה מידה בינוני (10 7 תאים), RBPs ציינו כי קיבולת ה- RNA מחייב נמצאו לייצג יתר על המידה, ורבים RBPs מזוהים זוהו. הניסוי יכול להיות scaled up (10 9 תאים), ואת השיטה אופטימיזציה ניתן להחיל על סוגי תאים צמחיים אחרים מינים כדי לבודד באופן רחב, קטלוג, ולהשוות proteomes mRNA- קשורה בצמחים.

Introduction

Eukaryotes להשתמש RNA מספר ביוגנזה מסלולים רגולטוריים כדי לשמור על תהליכים ביולוגיים תאיים. בין סוגים ידועים של רנ"א, mRNA הוא מגוון מאוד ונושא קיבולת קידוד של חלבונים ואת האיזופורמים שלהם 1. מסלול PTGR מכוון את גורלם של pre-mRNAs 2 , 3 . RBPs ממשפחות גנים שונים לשלוט על הרגולציה של RNA, ב PTGR, mRNAs ספציפיים mRNAs מדריך דרך אינטראקציות פיזיות ישירות, יצירת mRNPs תפקודית. לכן, זיהוי ואפיון mRBPs ו mRNPs שלהם הוא קריטי להבנת הרגולציה של חילוף החומרים mRNA נייד 2. מעל שלושת העשורים האחרונים, שונים בשיטות חוץ גופית - כולל מבחני ניידות RNASA ניידות (REMSA) מבחנים, אבולוציה שיטתית של ligands ידי מבחני העשרה מעריכי (SELEX) מבוסס על ספריות הנגזרות בונה, RNA Bind-N-Seq (RBNS), radiolabeled או כמותיפלואורסצנטי RNA מחייב מבחני, קריסטלוגרפיה רנטגן, ו ספקטרוסקופיה תמ"ג 4 , 5 , 6 , 7 , 8 , 9 - יושמו באופן נרחב על מחקרים של RBPs, בעיקר תאים יונקים. התוצאות של מחקרים אלה של RBPs יונקים ניתן לחפש באמצעות RNA מחייב DataBase חלבון (RBPDB), אשר אוספת את התצפיות שפורסמו 10 .

למרות אלה בגישות חוץ גופית הם כלים רבי עוצמה, הם קובעים את מוטיבים RNA קשורות מתוך מאגר RNA נתון רצפים ולכן מוגבלים ביכולתם לגלות RNAs היעד החדש. הדבר נכון גם לגבי אסטרטגיות חישוביות לחזות RBPs גנום רחב, אשר מבוססים על שימור רצף מבנה חלבון 15 . כדי להתגבר על זה, שיטה ניסיונית חדשה חהS שהוקם המאפשר זיהוי של מוטיבים RNA כי RBP של עניין אינטראקציה עם, כמו גם על קביעת המיקום המדויק של מחייב. שיטה זו, המכונה "crosslinking ו immunoprecipitation" (CLIP), מורכב ב crosslinking UV vivo ואחריו immunoprecipitation 11 . מחקרים מוקדמים הראו כי photactivation של DNA ו RNA נוקליאוטידים יכול להתרחש אורכי גל UV גדול מ 245 ננומטר. התגובה באמצעות thymidine נראה מועדף (דרגה של photoreactivity ירד: dT ≥ dC> rU> rC, dA, dG) 12 . באמצעות אור UV עם אורך גל של 254 ננומטר (UV-C), נצפתה כי קשרים קוולנטיים בין נוקליאוטידים RNA ו שאריות חלבון נוצרות כאשר בטווח של רק כמה אנגסטרומים (Å). התופעה נקראת אפוא "crosslinking" באורך אפס של RNA ו- RBP. זה יכול להיות ואחריו פרוטה טיהור מחמירים Dure עם רקע קטן 13 , 14 .

אסטרטגיה משלימה CLIP היא לשלב ב vivo UV crosslinking עם זיהוי חלבון כדי לתאר את הנוף של RBPs. מספר פרוטוקולים כאלה של גנום- mRNA, היו מבודדים מתאי שמרים, תאי גזע עובריים (ESCs) וקווים של תאים אנושיים ( כלומר, HEK293 ו- HeLa) תוך שימוש בגישה הניסויית החדשה, הנקראת "mRNA אינטראקציה ללכוד" 18 , 19 , 20 , 21 . השיטה מורכבת של vivo UV crosslinking ואחריו טיהור mRNP ו- MS מבוסס proteomics. על ידי יישום אסטרטגיה זו, רבים חדשים "moonlighting" RBPs המכילים RBDs שאינם קנוניים התגלו, וזה הפך ברור כי יותר חלבונים יש RNA מחייב קיבולת מאשר בעבר היה אמור להיות"15 , 16 , 17. השימוש בשיטה זו מאפשר ליישומים חדשים וליכולת לענות על שאלות ביולוגיות חדשות בעת חקר RBPs לדוגמה, מחקר שנערך לאחרונה בחן את שימור של פרוטאומה ה- mRNA קשור (הליבה RBP פרוטאומה) בין שמרים לתאים אנושיים 22 .

RBPs צמחים כבר נמצא להיות מעורב בצמיחה ופיתוח ( למשל , בתקנה שלאחר תעתיק של זמן הפריחה, השעון היממה, ביטוי גנים במיטוכונדריה ו chloroplasts) 24 , 25 , 26 , 27 , 28 , 29 . יתר על כן, הם חשבו לבצע פונקציות בתהליכים הסלולר להגיב על מדגיש abiotic ( למשל, קר, בצורת, saLines, וחומצה אבסיסית (ABA)) 31 , 32 , 33 , 34 . ישנם יותר מ 200 גנים RBP החזוי בגנום ארבידופסיס thaliana , המבוססת על מוטיב הכרה RNA (RRM) ו K הומולוגיה (KH) מוטיבים רצף מושלם; באורז, כ -250 כבר ציינו 35 , 36 . יש לציין כי רבים חזו כי RBPs נראים ייחודיים לצמחים ( למשל, לא מטאזואנים אורתולוגים לכ 50% של ארבידופסיס RBPs החזוי המכיל תחום RRM) 35 , מה שמרמז כי רבים עשויים לשרת פונקציות חדשות. הפונקציות של רוב RBPs החזוי להישאר uncharacterized 23 .

בידוד של proteomes mRNA קשורה מן שתילים ארבידופסיס etiolated, רקמת עלה, תאים שורש תרבותי, ו protoplasts mesophyll עלה באמצעות שימושלכידת mRNA אינטראקציה לאחרונה דווח 38 , 39 . מחקרים אלה מדגימים את הפוטנציאל החזק של קיטלוג שיטתי של RBPs פונקציונליים בצמחים בעתיד הקרוב. כאן, אנו מציגים פרוטוקול לכידת mRNA אינטראקציה מן protoplasts צמח ( כלומר, תאים ללא קירות התא). ארבידופסיס thaliana עלה prooplasts mesophyll הם הסוג העיקרי של תא עלה. Protoplasts מבודד לאפשר גישה אופטימלית של אור UV לתאים. סוג תא זה יכול לשמש מבחני כי transiently להביע חלבונים אפיון פונקציונלי 40 , 41 . יתר על כן, Protoplasting הוחל על סוגים אחרים של תאים צמחיים ומינים 42 , 43 , 44 ( למשל, Petersson et al ., 2009; Bargmann and Birnbaum, 2010, ו- Hong et al , 2012).

<P class = "jove_content"> השיטה כוללת סך של 11 צעדים ( איור 1 א ). ארבידופסיס protoplasts mesophyll עלה מבודדים הראשון (שלב 1) והם לאחר מכן UV מוקרן ליצירת mRNPs crosslinked (שלב 2). כאשר protoplasts lysed תחת תנאי denaturing (שלב 3), mRNPs crosslinked משתחררים במאגר תמוגה / מחייב ומשוך למטה על ידי אוליגו d (T) 25 חרוזים (שלב 4). לאחר מספר סיבובים של שוטף מחמירים, mRNPs הם מטוהרים עוד ניתח. פפטידים denatured של mRBPs מתעכלים על ידי K proteinase לפני mRNAs crosslinked הם מטוהרים ואת איכות ה- RNA מאומת על ידי qRT-PCR (שלבים 5 ו -6). לאחר טיפול RNase וריכוז חלבון (שלב 7), איכות החלבון נשלטת על ידי SDS polyacrylamide ג'ל אלקטרופורזה (SDS-PAGE) ואת מכתים כסף (שלב 8). ההבדל בין דפוסי הלהקה חלבון יכול בקלות להיות דמיינו בין מדגם crosslinked (CL) ומדגם לא crosslinked (לא CL;מדגם השליטה השלילי מ protoplasts כי אינו חשוף קרינה UV). זיהוי החלבונים מושגת באמצעות proteomics MS מבוססי. החלבונים מן המדגם CL מופרדים על ידי חד מימדי polyacrylamide ג'ל אלקטרופורזה (1D-PAGE) כדי להסיר זיהום רקע אפשרי, הם "בתוך ג 'ל מתעכל" לתוך פפטידים קצרים באמצעות טריפסין, והם מטוהרים (שלב 9). ננו בשלב ההפוך כרומטוגרפיה נוזלית מצמידים ספקטרומטריית מסה (ננו LC-MS) מאפשר קביעת כמות של חלבונים סופי של פרוטאומה כבול mRNA (שלב 10). לבסוף, mRBPs מזוהים מאופיינים וקטלג באמצעות ניתוח ביואינפורמאטי (שלב 11).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. ארבידופסיס עלה Mesophyll Protoplast בידוד

הערה: ארבידופסיס prooplasts mesophyll עלה מבודדים למעשה כפי שתואר על ידי Yoo et al ., 2007, עם מספר שינויים 40 .

  1. גידול של צמחים
    1. משרים כ 200 ארבידופסיס thaliana Col-0 זרעים ecotype במים מעוקרים במשך 2 ימים ב 4 ° C בחושך לריבוד.
      הערה: מספר זה של זרעים הוא מספיק עבור מדגם אחד לא CL ודגימה אחת CL (ראה שלב 1.3).
    2. מכינים סירים עם תערובת 50% ( V / V ) של אדמה vermiculite ו להשרות את הסירים עם מים מזוקקים במגש כדי להרטיב את הקרקע.
    3. לזרוע ולהפיץ את הזרעים מרובדת על אדמה רטובה. אין לכסות את הזרעים עם קרקע נוספת כי זרעים Arabidopsis צריך אור נביטה.
      הערה: תנאי הגידול של הצמח הם 12 ° h / 12-h כהה מחזור ב 23 ° C,עם עוצמת האור של 100 μmol מ -2 s -1 , בחדר צמיחה במשך 5 שבועות לפני הפריחה. צמחים בני 4 שבועות יכולים לשמש גם 40 .
      הערה: כל החומרים המתוארים והריאגנטים משלב 1.2.1 עד שלב 3.2.3 הם עבור שני דגימות ( כלומר, מדגם שאינו CL) מדגם הבקרה שאינו נתון לקרינה UV-C (ומדגם CL אחד) המחקר מדגם זה נתון לקרינה UV-C)).
  2. הכנת תמיסת אנזים איזוטונית
    1. הפוך 80 מ"ל של פתרון איזוטוני איזוטוני ראשוני (400 mNitol מ"מ, 20 מ"מ KCl, ו 20 mM חיץ MES (pH 5.7)) ומיד לחמם את הפתרון של חממה 60 מעלות צלזיוס למשך 10 דקות.
    2. הוסף 1.2 גרם של Cellulase R10 ( w / v 1.5%) ו 0.32 גרם של Macrozyme R10 ( w / v 0.4%) אבקת כדי פתרון איזוטוני ראשוני חם חם.
    3. בזהירות להביא את אבקת האנזים לתוך פתרון על ידי יישום ערבוב עדין. ראפלחמם את הפתרון בחום 60 מעלות צלזיוס במשך 10 דקות עד כי הפתרון האנזים הוא בהיר בהיר בהיר.
    4. מגניב הפתרון על הקרח במשך 3 דקות ולהוסיף 800 μL של 1 M CaCl 2 ו 800 μL של 10% ( w / V ) BSA לפתרון.
    5. Homogenize את הפתרון על ידי pipetting וסינון דרך מסנן 0.22 מיקרומטר. Aliquot זה סופי פתרון איזוטוני איזוטוני לתוך שתי מנות פטרי בקנה מידה גדול (150 מ"מ x 20 מ"מ).
  3. הכנת רצועות עלים של ארבידופסיס
    הערה: 150 עלים לכל צלחת פטרי מומלץ עבור מדגם אחד לא CL או מדגם CL אחד.
    1. בחר וחותכים סכים של 300 במלואה הרחיב 2 nd - או 3 rd -pair עלים אמיתיים (ממוצעים: 3 - 4 לכל שושנה) לתוך 0.5- עד 1 מ"מ רצועות עלים באמצעות גילוח חדש וחד.
    2. העברה לצלול את רצועות מיד לפתרון האנזים איזוטוניים.
      הערה: כדי למנוע מגע עם האור, כסה תמיד אתהוא צלחות פטרי עם רדיד אלומיניום. לא לרסק את העלים. ודא שכל הרצועות שקועות בתמיסה ואינן צפות על פני השטח.
  4. בידוד של ארבידופסיס עלה mesophyll protoplasts
    1. מניחים את רדיד אלומיניום מכוסה צלחות פטרי לתוך desiccators ואקום לחדור את רצועות עלה תחת ואקום במשך 30 דקות. לאחר מכן, דגירה צלחות פטרי בחושך ללא רועד בטמפרטורת החדר למשך 2.5 שעות.
    2. בעדינות ובקצרה לנער את הכלים אופקית ביד, מנסה לשחרר את protoplasts לחלוטין לתוך פתרון האנזים.
  5. קצירת וספירת הפרוטופלסטים
    1. מסנן את ההשעיה protoplast דרך 35 עד 75 מיקרומטר רשת ניילון. Aliquot תסנין של כל מדגם לתוך שתי צינורות 50 מ"ל התחתונה התחתונה (כ 20 מ"ל של תסנין בצינור זה).
    2. שוטפים כל צלחת פטרי עם 10 מ"ל של חיץ W5 (154 מ"מ NaCl, 125 מ"מ CaCl
    3. ספין כל ארבע צינורות 5 דקות ב 100 xg כדי גלולה protoplasts. מחק supernatant בעדינות resuspend את כדורי protoplast בצינור כל עם 10 מ"ל של חיץ W5.
      הערה: כאשר resuspending את כדורי protoplast, בעדינות להפוך את הצינור במהופך בעדינות לסובב את הצינור ביד עד כדורי נעלמו. לא פיפטה גלולה ישירות, כדי למנוע נזק לתאים.
    4. חזור על שלב 1.5.3 פעם אחת ולשלב ההשעיה protoplast משני צינורות של כל מדגם לתוך צינור אחד 50 מ"ל התחתונה התחתונה. שמור את הצינורות על הקרח.
    5. ספירת protoplasts באמצעות hemocytometer.
      הערה: כל 20 תאים בתוך 25 קוביות שווה 2 x 10 5 protoplasts / מ"ל. 150 עלים צריך להניב כ 1 x 10 7 תאים.Modulate יש מספר שווה של protoplasts בדגימות CL ו- CL.
    6. שמור על protoplasts על הקרח במשך 30 דקות. לאחר מכן, לסובב את צינורות 5 דקות ב 100 x גרם. מחק supernatant ו resuspend protoplasts בכל צינור עם 20 מ"ל של פתרון MMg (400 mnitol mM, 15 מ"מ MgCl 2 , ו 4 mM חיץ MES (pH 5.7)).

2. ב vivo mRNA חלבון Crosslinking על ידי קרינה UV

הערה: שמור על הצינור הלא מדגם CL על הקרח. המדגם CL חייב להיות מיד קרינה UV.

  1. מעבירים את ההשעיה protoplast המכיל 1 x 10 7 תאים מן צינור מדגם CL לצלחת פטרי בקנה מידה גדול חדש (150 מ"מ x 20 מ"מ) ולהוסיף 30 מ"ל של פתרון MMG קר כקרח כדי לכסות את משטח הצלחת. מורחים את התאים במאגר MMG כולו על ידי pipetting עדין. מיד מקום צלחת פטרי ללא כיסוי העליון במנגנון crosslinking UV.
    הערה: הגובה בין מנורת UVואת צלחת פטרי הוא 8 ס"מ.
  2. מסננים את המדגם עם אור UV 254 ננומטר UV ו 0.00875 W / ס"מ 2 עוצמת UV במשך 1 דקות, 3 דקות, או 5 דקות. לאחר הקרנה, במהירות aliquot ההשעיה protoplast לשני צינורות חדשים 50 מ"ל התחתונה התחתונה. שטפו את החלק התחתון של המנה עם תוספת 5 מ"ל של פתרון MMG קר כקרח לאסוף את שארית protoplasts ולהוסיף ההשעיה תא אלה שתי צינורות.
    הערה: דקה אחת נבחרה כתנאי אופטימלי. ההסבר ניתן למצוא תוצאות נציג .

3. Protoplast תמוגה בתנאים דנטורינג

  1. הכנת כדורי פרוטופלאסט עבור תמוגה
    1. ספין את הצינור הלא CL המדגם יחד עם שני צינורות מדגם CL משלב 2 ב 100 xg במשך 5 דקות וזורקים את supernatant. מניחים את הצינור של non-CL מדגם protoplast גלולה בחזרה על הקרח.
    2. הוסף 10 מ"ל של פתרון MMG קר כקרח כל צינור מדגם CL, genTly resuspend את כדורי, ולשלב אותם בחזרה לתוך צינור 50 מ"ל התחתונה התחתונה. ספין את הצינור ב XG 100 במשך 5 דקות. לאחר הסרת supernatant, לשמור על הדגימה CL גלולה protoplast גלולה על הקרח.
  2. פרוטופלאסט תמוגה ו lysate protogenlast homogenizing
    1. הוסף 9 מ"ל של חיץ קר כקרח / חיץ מחייב (500 מ"מ LiCl, 0.5% ( w / V ) ליתיום Dodecyl סולפט (LiDS), 5 מ"מ Dithiothreitol (DTT), 20 מ"מ טריס HCl (pH 7.5), ו 1 מ"מ EDTA (pH 8.0)) לתא גלולה של כל מדגם. בערך lyse הפרוטופלסטים ידי pipetting למעלה ולמטה כ 20 פעמים עד ההשעיה הוא אור ירוק homogenously.
    2. לעבור lysate protoplast פעמיים דרך מזרק 50 מ"ל זכוכית עם מחט צרה (0.9 x 25 מ"מ 2 ) עבור homogenization. דגירה lysate על קרח במשך 10 דקות. להקפיא lysates בחנקן נוזלי בחנות ב -80 מעלות צלזיוס למשך עד 3 שבועות.

4. mRNP משוך מטה טיהורעל ידי אוליגו ד (T) 25 חרוזים

הערה: כל החומרים ריאגנטים המתואר להלן, משלב 4.1 לשלב 4.4, הם רק מדגם אחד (כלומר, מדגם שאינו CL אחד או אחת מדגם CL). את lysate protoplast יש להוסיף מיד צינורות המכילים חרוזים לאחר חיץ supernatant חרוז / מחייב מחייב מושלך.

  1. הכנה של אוליגו d (T) 25 חרוזים מגנטיים עבור אוליגו (dT) ללכוד
    1. להפשיר את lysate protoplast קפוא בטמפרטורת החדר. כאשר lysate הוא מופשר לחלוטין, לשמור על הצינור של lysate על הקרח.
    2. Aliquot 1.8 מ"ל של אוליגו ד (T) 25 חרוזים מגנטיים (5 מ"ג / מ"ל) לתוך 6 חדש 2 מ"ל עגול צינורות microcentrifuge התחתונה על הקרח. בכל צינור, לשטוף את החרוז השעיה homogenously עם μL 600 של חיץ תמוגה / מחייב ידי pipetting לזמן קצר למעלה ולמטה בעדינות מסתובב ב 4 מעלות צלזיוס למשך 2 דקות. שמור את החרוזים על הקרח.
  2. כריכה
    1. מקוםכל 6 צינורות המכילים את החרוזים לתוך מדף מגנטי ב 4 מעלות צלזיוס למשך 3 דקות, אשר יביא לכידת מגנטי של החרוזים ואת ניקוי של ההשעיה.
      הערה: כאשר הצינורות ממוקמים במעמד מגנטי, לחכות עד החרוזים הם שנתפסו לחלוטין, לפחות 3 דקות.
    2. מחק supernatant ו מיד aliquot 9 מ"ל של lysate protoplast אלה 6 צינורות. מערבבים היטב על ידי pipetting עד ההשעיה חום הומוגני מופיע דגירה החרוזים lysate protoplast ב 4 מעלות צלזיוס למשך 1 שעות על ידי החלת סיבוב עדין.
      הערה: מומלץ זמן הדגירה מ 30 דקות עד 1 שעות.
  3. כְּבָסִים
    1. מניחים את הצינורות בחזרה המדף מגנטי ב 4 מעלות צלזיוס למשך 3 דקות. כאשר כל חרוזים נלכדים בצד של צינורות, לאסוף את lysate protoplast לתוך 6 חדש 2-mL עגול צינורות microcentrifuge התחתונה באופן זמני לאחסן אותם 4 מעלות צלזיוס. אין להשליך את lysate protoplast מיד; לשמור על lysateב 4 ° C.
    2. הוסף 1.5 מ"ל של חיץ כביסה קר כקרח 1 (500 מ"מ LiCl, 0.1% ( w / V ) LiDS, 5 מ"מ DTT, 20 מ"מ טריס HCl (pH 7.5), ו 1 מ"מ EDTA (pH 8.0)) כדי חרוזים בכל צינור. Resuspend את החרוזים ולהחיל סיבוב עדין במשך 1 דקות. מניחים את הצינורות בחזרה לתוך המדף מגנטי ב 4 מעלות צלזיוס למשך 3 דקות וזורקים את supernatant. חזור על צעד זה לשטוף עם חיץ לשטוף פעם אחת.
    3. חזור על אותו הליך של שלב שטיפה זה פעמיים באמצעות 1.5 מ"ל של חיץ לשטוף קרח קר 2 (500 מ"מ LiCl, 5 מ"מ DTT, 20 מ"מ טריס HCl (pH 7.5), ו 1 מ"מ EDTA (pH 8.0)) ופעם באמצעות 1.5 מ"ל של חיץ קר נמוך מלח מלח (200 מ"מ LiCl, 20 מ"מ טריס HCl (pH 7.5), ו 1 מ"מ EDTA (pH 8.0)).
      הערה: אם mRNPs היו מבודדים ביעילות מן lysate protoplast, לא צריך להיות "הילה" גלוי סביב גלולה חרוז במדגם CL במהלך שלב לשטוף עם חיץ לשטוף 2 ( איור 1 ב ).
  4. אלוטי
    1. הוסף 500 μLשל חיץ elution (20 מ"מ טריס- HCl (pH 7.5) ו 1 מ"מ EDTA (pH 8.0)) כדי חרוזים בכל צינור. בעדינות resuspend חרוזים לדגור על 50 מעלות צלזיוס למשך 3 דקות לשחרר את RNAs (A) זנב פולי. בעדינות resuspend את החרוזים פעם אחת על ידי pipetting. מניחים את הצינורות בחזרה המדף מגנטי ב 4 מעלות צלזיוס למשך 5 דקות.
    2. מעבירים לשלב את כל eluents (כ 3 מ"ל בסך הכל) כדי נקי, סטרילי RNase חינם, 15 מ"ל חרוט התחתית התחתית על הקרח.
      הערה: איכות וכמות של RNA ניתן לקבוע באופן מיידי באמצעות מכשיר ספקטרופוטומטר.
      הערה: ריכוז RNA של כל דגימה היא כ 10 ng / μL, שזכה לציון 260 / A 280 יחס של 1.9. A 260 / A 280 יחס צריך להיות בין 1.6 ו 2.0, כי מבודדים פולי (א) RNAs מוזל הם בדרך כלל יותר מ 70% טהור. אם ריכוז ה- RNA נמוך מדי, להגדיל את מספר protoplasts החל עד למקסימום של 10 9 . דגימותיכול להיות קפוא בחנקן נוזלי נשמר על 80 מעלות צלזיוס לאחסון לטווח ארוך.
    3. חזור על שלב 4.2 כדי צעד 4.4 עבור שני סיבובים נוספים ולהשתמש מחדש את oligo-d (T) 25 חרוזים כדי לרוקן את רנ"א (R) E-polyed מ lysate protoplast.
      הערה: לאחר שלושה סיבובים של הליך הנפתח, לא אמור להיות סך של 9 מ"ל של eluent עבור כל דגימה CL או CL. בצע את כל העבודה ב 4 ° C כדי למנוע השפלה של רנ"א. בצע את שלב 4.5 או שלב 4.6 כדי להשתמש מחדש או לחדש את החרוזים.
  5. הכנת מחדש בשימוש oligo-d (T) 25 חרוזים
    1. שטפו את החרוזים פעמיים עם 1 מ"ל של חיץ elution קר קר פעם אחת עם 1 מ"ל של תמוגה קר כקרח / חיץ מחייב כדי להתאים את ריכוז LiCl מלח בחזרה 500 מ"מ.
    2. בצע את שלב 4.1, להשליך supernatant, להעביר את lysate protoplast מאוחסנים בכל צינור, וחזור על התהליך כולו משלב 4.2 לשלב 4.4 עבור שני סיבובים נוספים.
  6. 25 חרוזים
    הערה: ניתן לאחסן חרוזים ולהשתמש בהם לניסוי נוסף (שימוש חוזר מקסימלי הוא שלוש פעמים).
    1. בצע את שלב 4.4, להוסיף 1 מ"ל של 0.1 M NaOH כדי חרוזים, ו דגירה על ידי סיבוב בטמפרטורת החדר למשך 5 דקות. עבור כל צינור, לשטוף פעמיים עם 1 מ"ל של חיץ לשטוף 1 ו שלוש פעמים עם 1x PBS (pH 7.4) המכיל 0.1% Tween-20 עבור איזון. שמור את החרוזים מכל צינור μL 300 של סטרילי RNase חינם 1x PBS (pH 7.4) המכיל 0.1% Tween-20 ב 4 מעלות צלזיוס לאחסון לטווח ארוך.
      הערה: חרוזים המשמשים דגימות CL Arabidopsis בניסוי זה יכול לשמש רק עבור דגימות צמח אותו בפעם הבאה.

5. Proteinase K טיפול טיהור mRNA

  1. טיפול ב- Proteinase K
    1. הוסף 8 μL של פתרון K Proteinase (2 מיקרוגרם / μL) ל 1 מ"ל של eluent מכל מדגם לעכל את החלבונים UV crosslinked. ברמערבולת iefly.
  2. טיהור mRNA
    1. דגירה eluent ב 37 מעלות צלזיוס למשך 1 שעות. לטהר את RNA באמצעות ערכת טיהור RNA להסיר מזהמים שיורית.
      הערה: לאחר טיהור, RNAs מוכנים למבחן איכות RNA באמצעות assay qRT-PCR.
      הערה: ערכות אחרות, כגון ערכת מיני RNA ו מגיב TRIzol, ניתן להשתמש גם 14 .

6. QRT-PCR Assay

  1. שעתוק לאחור
    1. להשיג סינתזה יעילה של cDNA גדיל הראשון באמצעות מערכת שעתוק לאחור, עם 1 מיקרוגרם של רנ"א כתבנית. לדלל את המדגם ל 5 ng / μL עם מים nuclease ללא.
  2. CDNA כימות באמצעות qRT-PCR
    1. להגביר לכמת את cDNA באמצעות תערובת הורים qPCR ו בזמן אמת cycler PCR, עם 10 ng של cDNA כמו התבנית. השתמש בתוכנית הבאה PCR: 95 מעלות צלזיוס למשך 10 דקות(שלב 1, מחזור אחד) ו 95 מעלות צלזיוס במשך 15 שניות ו 60 מעלות צלזיוס למשך דקה 1 (שלב 2, 40 מחזורים).
      הערה: גן הייחוס המשמש כאן הוא גן בקרה פנימי אנדוגני, UBQ10 (AT4G05320). QRT-PCR primers עבור UBQ10 ו 18S rRNA תוארו Li et al ., 2014 ו Durut ואח ' , 2014, בהתאמה 45 , 46 . רצפי פריימר מופיעים בטבלת החומרים .

7. RNase טיפול ריכוז mRBP

  1. טיפול RNase
    1. הוסף בערך 100 U של קוקטייל RNase המכיל RNase ו- RNase T1 לתוך 8 מ"ל של eluent. כלול מדגם שלילי שליטה עם קוקטייל RNase שבו eluent מוחלף על ידי מים ללא nuclease. מערבולת בקצרה ו דגירה על 37 מעלות צלזיוס למשך 1 שעות.
  2. ריכוז mRBP
    1. לאחר עיכול RNase, לרכז את usu eluentG יחידות מסנן צנטריפוגלי. נפח הסיום הוא 75 μL, עם תשואה חלבון הכולל של כ 2 מיקרוגרם של כל מדגם לאחר ריכוז. מניחים את הדגימות ב -80 מעלות צלזיוס לאחסון לטווח ארוך.

8. SDS-PAGE וכסף מכתים

  1. SDS-PAGE
    1. מערבבים 25 μL של eluent מרוכז (מדגם CL) או מדגם שליטה (מדגם לא CL) עם μL 15 של צבע 2x טוען. מחממים את המדגם ב 95 מעלות צלזיוס למשך 5 דקות לטעון אותו על ג'ל SDS-PAGE המכיל 5% ג 'ל לערום ו 12% פתרון ג'ל, כולל סמן חלבון.
    2. לעבות את החלבונים ב 60 V במשך 40 דקות נפרד ב 160 V במשך כ 1 שעות עד צבע הטעינה מגיע לסוף של ג'ל לפתרון.
  2. מכתים כסף assay
    1. לשטוף את ג'ל SDS-PAGE פעמיים עם מים ultrapure במשך 5 דקות בכל פעם. בצע את הכתם כסף של חלבונים באמצעות ערכת כסף כסף מסחרי.
      הערה: להקות חלבון חייב להיות מוצג בתוך 5 דקות. אם להקות גלויים מעבר 5 דקות עם צבע בהיר מאוד, הוא הציע להגדיל את מספר protoplasts החל עד למקסימום של 10 9 .

9. טריפסין תקציר של חלבון להקות טיהור פפטיד

  1. טריפסין לעכל
    הערה: הפעלת ג'ל 1D-PAGE השני על ידי לקיחת עוד 25 μL של פתרון mRBP מרוכזים מכל מדגם עבור זיהוי mRBP; כסף מוכתמים ג'לים לא ניתן להשתמש בהם מאז הם אינם תואמים ניתוח MS.
    1. לאחר הפעלת ג'ל 1D-PAGE, לתקן את הג'ל פתרון קיבעון (50% ( V / V ) מתנול ו 10% ( V / V ) חומצה אצטית) עבור 1 ח '. כתם הג'ל בפתרון הכתם (0.1% ( w / v ) Coomassie מבריק R-250, 50% ( v / v ) מתנול, ו 10% ( v / v ) חומצה אצטית) במשך 20 דקות עם רעד עדין. להשמיד את הג'ל ב תמיסת destain (40% ( v / v ) מתנול ו 10% ( v/ V) חומצה אצטית) עבור 1 h. לאחר destaining, לשמור את הג'ל ב 5% ( v / v ) חומצה אצטית.
      הערה: במהלך destaining, פתרון destain חדש ניתן להחליף עד הרקע לחלוטין destained.
    2. חותכים את הלהקות של עניין מתוך הג'ל. חותכים את להקות נוספת לחתיכות של כ 1 מ"מ 3 עבור עיכול טריפסין אופטימלי מיצוי של פפטידים. הידר את חתיכות ג'ל עם 50 μL של 100 mM אמוניום ביקרבונט (NH 4 HCO 3 ) במשך 10 דקות. מכסים את חתיכות ג'ל לחלוטין.
      1. הסר את הפתרון לחות בזהירות להתייבש חתיכות ג'ל עם acetonitrile (CH 3 CN) במשך 10 דקות. בזהירות להסיר את הפתרון אצטוניטריל.
      2. חזור על התהליך מ הידרציה כדי התייבשות פעמיים. לבסוף, להסיר את הפתרון אצטוניטריל.
        הערה: זמן ריצה ג'ל תלוי במטרה של הניסוי. ריצה ארוכה פעמים מאפשר הפרדה טובה של חלבונים, ולכן האיסור ג 'ל מוכתמים ספציפייםDs ניתן לחתוך לניתוח נוסף. אם המטרה היא לשמור על חלבונים ולהסיר מזהמים, זמן ריצה קצר מספיק.
    3. הוסף 500 μL של 6.6 מ"מ פתרון DTT ו דגירה חתיכות ג'ל במשך 10 דקות. הסר את הפתרון DTT ולשטוף את חתיכות ג'ל פעמיים עם 500 μL של 95% ( V / V ) פתרון אצטוניטריל.
      1. לאחר הכביסה, להסיר את הפתרון acetonitrile ו דגירה חתיכות ג'ל עם 500 μL של 55 מ"מ חומצה iodoacetic (IAA) פתרון במשך 10 דקות בחושך.
      2. לאחר הדגירה, להסיר את הפתרון לשטוף את חתיכות ג'ל שוב עם 500 μL של 95% ( V / V ) פתרון אצטוניטריל. יבש את חתיכות ג'ל.
    4. הטמע את חתיכות ג'ל לחלוטין עם 25 μL של חיץ העיכול (50 מ"מ NH 4 HCO 3 , 5 מ"מ CaCl 2 , ו 6 ng / μL טריפסין) ולשמור על קרח 45 דקות לתת טריפסין לחדור לתוך הג 'ל. דגירה חתיכות ג'ל לילה ב 37 מעלות צלזיוס עבור en עיכול zymatic.
  2. טיהור פפטיד
    1. הוסף 80 μL של 50 מ"מ NH 4 HCO 3 לחתיכות ג'ל במאגר העיכול ואת מערבולת שוב ושוב כדי לחלץ את הפפטידים tryptic. אסוף את התמצית. חזור על צעד החילוץ הזה פעמיים עם 80 μL של 50% ( V / V ) CH 3 CN ו 5% ( V / V ) חומצה פורמית (FA).
      הערה: התמצית הסופי הסופי צריך להיות כ 240 μL.
    2. בריכה לרכז את תמציות לתוך μL כ 10 על ידי ריכוז ואקום או lyophilization ולהוסיף 25 μL של 0.1% ( V / V ) חומצה trifluoroacetic מימית (TFA) פתרון. Desalt דגימות עם μ-C18 עמודות, בעקבות פרוטוקול של היצרן.
    3. Elute הפפטידים עם μL 4-10 של 60% ( w / v ) CH 3 CN ו 0.1% ( v / v ) FA. Lyophilize (להקפיא יבש) הפפטידים ולאחסן אותם ב -20 מעלות צלזיוס עד הניתוח.
כותרת "> 10. ננו LC-MS

  1. ננו בשלב ההפוך כרומטוגרפיה נוזלית
    הערה: בצע את ניתוח LC-MS עם ספקטרומטר מסה כי הוא מחובר יחד עם מכשיר כרומטוגרפיה נוזלית. מכשיר זה צריך להיות מצויד עם טור C18 (2 מיקרומטר חלקיק, 100 גודל הנקבוביות Å, ו 50 מיקרומטר x 15 ס"מ בממד).
    1. Resuspend הפפטידים lyophilized ב 16 μL של פתרון (2% ( v / v ) CH 3 CN ו 0.1% ( v / v ) FA). להזריק לטעון 5 μL של פתרון פפטיד בקצב זרימה של 5 μL / min על C18 precolumn (גודל מיקרומטר 3 מיקרומטר, 100 גודל הנקבוביות Å, nanoviper, ו 75 מיקרומטר x 2 ס"מ בממד).
    2. 10.1.2. הפרד את הפפטידים באמצעות שיפוע 95 דקות עם קצב הזרימה של 300 nL / min. במהלך שיפוע זה ההפרדה, להגדיל את השלב הנייד B מ 4% ל 10%, 10% עד 25%, ו 25% ל 45% 5 דקות, 50 דקות ו 18 דקות, בהתאמה. לבסוף, עלייה תלולה בשלב B נייד עד 95% ב 1 דקות. לאחרכל שיפוע 95 דקות ההפרדה, להחיל שלב שטיפה הטמון המכיל שיפוע 10 דקות מ 4% ל 95% ב 5 דקות.
      הערה: השלב הנייד A הוא 99.9% H 2 O ו- 0.1% ( v / v ) FA, והשלב הנייד B הוא 19.92% H 2 O, 80% ( w / v ) CH 3 CN ו- 0.08% ( v / v ) FA.
  2. המסה ספקטרומטריית המסה
    1. הפעל את ספקטרומטר מסה במצב נתונים תלויי עם טווח המוני בין 400 ל 1,600 מ '/ z.
    2. בחר עד עשרה של יונים אינטנסיבי ביותר MS1 כדי ליצור את ספקטרום פיצול. קבע את הרזולוציה ל -70,000 רוחב מלא בחצי מרבי (FWHM) עבור MS1 ו -17,000 עבור MS2, עם יעד בקרה אוטומטי (AGC) של 3,000,000 ו -1,000,000 יונים וזמן הזרקת יון מרבי (IT) של 256 ו- 64 ms עבור MS1 ו - MS2, בהתאמה.
    3. הגדר את ההדרה הדינמית ל 10 שניות כדי למנוע פיצול חוזר של יונים שופע ביותר.
      הערה: כאן, יונים עם אחד או יותר שישה חיובים הם הXcluded עבור MS2.
  3. פרוטאומיקה איכותית: זיהוי פפטיד וחלבון
    1. ניתוח ספקטרום פיצול באמצעות תוכנה כגון פסגות סטודיו תוכנה 47 , 48 , 49 .
      הערה: חבילות תוכנה אחרות זמינים גם עבור זיהוי פפטיד, כגון NovoHMM 30 ו PepNovo 37 עבור רצף novo ו SEQUEST 54 ו Mascot 55 לחיפוש באתר.
    2. שלב את הספקטרה עם אותה מסה (הפרש של <2 ppm) וזמני שימור (<2 דק ') ושמור רק על ספקטרום עם סף איכות גבוה מ -0.65 כדי לחפש את מסד הנתונים Swiss-Prot (גרסה: דצמבר 2013) עבור הטקסונומיה שנקבעה לדגם thaliana ארבידופסיס צמח. השתמש בפרמטרים הבאים של החיפוש: מבשר סובלנות המונית של 10 עמודים לדקה באמצעות השימוש של monהמסה oisotopic; סף המסה של קטע של 20 mmu; טריפסין כמו אנזים העיכול, עם מקסימום של 2 cleavages החמיצו; ציסטאין carbamidomethylation כמו שינוי קבוע; Methionine חמצון כמו שינוי משתנה; ו מקסימום של 3 שינויים לאחר טרנספורמציה משתנה לכל פפטיד. לאחר הזיהוי, להגדיר באופן ידני את סף ניקוד עבור זיהוי פפטיד אמין חלבון, כך שיעור גילוי מזויף (FDR) <5% נרכש.
  4. פרוטאומיקס כמותי: ניתוח סטטיסטי של נתונים ספקטרומטריית מסה
    1. השתמש LC-MS ( למשל Progenesis) עבור quantitation ללא תווית של נתונים proteomics.
      הערה: אזורי הפפטיד של MS1 (או העוצמה) מקושרים לפפטידים שזוהו על-ידי תוכנת האולפן לפי המסה שלהם, עם השגיאה הסבירה בכל היותר של 10 עמודים לדקה.
      הערה: תוכנה זו מחשבת את השפע של פפטיד על ידי שילוב אזורי השיא של כל מדינות החיוב בין 2 <Sup> + ו + 8. הנתונים הכמותיים מקושרים לזיהוי הפפטידים של PEAKS על ידי התסריט inhouse (התאמת המסה עם השגיאה הסבירה ב -10 ppm).
    2. חישוב ממוצע log2 קיפול שינויים (CL / לא CL) עבור כל פפטיד. קבוצת לקפל שינויים של פפטידים ייחודיים על ידי חלבון.
      הערה: בכל קבוצה, שינוי הקפל הסופי של חלבון שווה לשינויים הממוצעים בקפל של הפפטידים.
    3. חישוב p- ערך באמצעות t- test של הסטודנט עבור כל קבוצה כדי להעריך את המשמעות סטטיסטית. החלת R חבילת תוכנה (גרסה 3.3.0) לתקן את ערכי p עבור ה- FDR של כל הקבוצות באמצעות שיטת Benjaminamini-Hochberg (BH).
    4. צייר את חלקה הר געש באמצעות חבילת "כיול" פונקציה (גרסה 1.7.2) תואם את חבילת התוכנה R (גרסה 3.3.0).
      הערה: כאן, ערכי ה- p-10 המותאמים ל- loglog (-log10 (adj-p-value) הם פונקציה של שינויי log2-fold של כל החלבונים שזוהו. חלבונים הםמטופלים כניסות חיוביות בפרוטאומה של ה- mRNA, אם השינויים שלהם בקפל 2 גדולים מ -2, עם או בלי משמעות.

11. קטלוג של Proteome מזוהה mRNA מזוהה

  1. סיווג את החלבונים מזוהה משלב 10 לשלוש קטגוריות על בסיס פריטים של "פונקציות מולקולריות ותהליכים ביולוגיים" באמצעות מאגר אונטולוגיה (GO) נתונים ו "משפחה ודומיין" באמצעות מסד הנתונים InterPro.
  2. כקטגוריה I, או "חלבונים ריבוזומליים", מכילים את כל החלבונים הריבוזומליים המזוהים, מגדירים חלבונים מקטגוריה II, או "RBPs ראשיים", כמכילים תחליפי חלבון מעובדים המפעילים אינטראקציה עם RNA או קישור למחבר RNA עם תפקודים ידועים או לא ידועים בביולוגיה של RNA .
  3. כאשר חלבונים עם תפקודים ידועים או לא ידועים בביולוגיה של RNA ללא תחומים מחברים של RNA מחייב ממוקמים בקטגוריה III, או "RBPs מועמדים", מגדירים אנזימים מקטגוריה III המבוססת על הערות מ Iמסד נתונים ntEnz.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

ראינו הילה אופיינית, המקיפה את גלולה חרוז במדגם CL, לשטוף שלב 4.3 עם חיץ לשטוף 2 ( איור 1 ב ). למרות שזה לא נחקר, התופעה הזאת כנראה ניתן להסביר על ידי הפרעה של מתחמי mRNP crosslinked עם צבירה חרוז במהלך לכידת מגנטי, גרימת צבירה מפוזר יותר להיווצר. זה מציין כי אוליגו d (T) 25 חרוז ללכוד היה יעיל 14 .

גבוה משמעותית רמות URQ10 התייחסות mRNA מאשר rSNA 18S בשליטה הן לא CL ודגימות CL מוצגים באיור 1C . זה מצביע על כך mRNAs מועשרים ב eluent בשל לכידת ידי אוליגו d (T) 25 חרוזים, אשר יכול רק להיקשר פולי (א) mRNAs. היעילות של לכידת אוליגו d (T) 25 חרוז היה עוד יותרמעוות על ידי SDS-PAGE ו מכתים כסף (שלב 8), כפי שמוצג בתרשים 1D לאחר טיפול RNase וריכוז mRBP (שלב 7). הבדל בתבנית הלהקה חלבון בין שליטה לא CL ו- CL נתיבים מדגם יכול להיות בבירור, ואת להקות חלבון הנוכחי של הלא CL בקרת דגימה נתיב ניתן להסביר על ידי נוכחות של RNase. זה ממחיש את העשרה חזקה של mRBPs במדגם CL.

את היעילות של crosslinking ניתן לשלוט על ידי שינוי משך הזמן של קרינה UV. מספיק crosslinking אבל הימנעות של נזק protoplast ו RNA השפלה היא אופטימלית. בתרשים 1D , דפוסי חלבון ספציפיים בכל דגימות CL התקבלו בעת השוואת פעמים קרינה שונים UV (1, 3, ו 5 דקות). תחת אותה עוצמת UV (0.00875 W / cm 2 ), התנאים האופטימליים ביותר נמצאו להיות 1 או 3 דקות, בשל הבלתי ניתן להבחיןעוצמות חלבון הלהקה. חלשות הלהקה חלשה נצפו עם זמן crosslinking עוד (5 דקות). שקלנו 1 דקות כתנאי אופטימלי, כי משך קצר של crosslinking יש יתרון נוסף של העברה קלה יותר אוסף של protoplasts מהצלחת פטרי. Protoplasts יכול להיות זירז במהירות לתחתית צלחת פטרי במהלך קרינה UV כי הם מקל על צלחת התחתונה. זה עושה את זה יותר קשה לאסוף ולהעביר אותם צינורות לאחר עוד קרינה UV משך.

בהתבסס על התנאים אופטימיזציה, זיהוי של חלבונים משלושה משכפלים ביולוגיים הושגה לאחר מכן על ידי proteomics איכותי וכמותי, אשר תוארה הצעדים 9 ו 10. בניתוח על ידי proteomics איכותי ( איור 1E , מימין), סך של 341 חלבונים זוהו בדגימות CL, מתוכם 36 נמצאו הן בשליטה שאינה CLD דגימות CL, ורק 8 חלבונים זוהו במדגם בקרת ה- CL. זה ההבדל העצום במספרים חלבון מזוהה בין שתי דגימות עולה בקנה אחד עם דפוסי הלהקה חלבון שונים ( איור 1D ), תמיכה ברעיון כי SDS-PAGE ו assay מכתים כסף הם כלים טובים כדי לאמת את היעילות של אוליגו- D (T) 25 לכידת חרוז. בניתוח על ידי פרוטאומיקה כמותית ( איור 1E , משמאל), סך של 325 חלבונים (כחול וירוק צבע) הראו שינוי פי 2 לקפל יותר מאשר 2. בין חלבונים אלה, 100 חלבונים (כחול) היה p קטן - הערכים מעל רמת החשיבות. לכן, הם הוגדרו גם כניסות חיוביות. זה ראוי לציון כי ערכי p של 225 חלבונים אחרים (בצבע ירוק) היו גדולים מ -0.05, מתחת לרמת המשמעות בגלל נתונים דלילות. במילים אחרות, היו פפטידים בשפע נמוך עבור כל חלבון, עם משתנות גבוהה של אינטטיטי פפטידEs. עם זאת, מכיוון שכולם זוהה איכותית רק דגימות CL, הם נחשבו חיוביים.

בהתבסס על מסדי הנתונים של GO ו- InterPro 50 (שלב 11), 325 חלבונים אלו סווגו עוד לקטגוריה I (חלבונים ריבוזומליים), קטגוריה II (RBPs ראשיים) וקטגוריה III (מועמדים RBP) ( איור 1F ). היו 123 חלבונים ribosomal בקטגוריה I, ואילו בקטגוריה II, 70 RBPs קלאסיים מסומנים נצפו. אלה שתי הקטגוריות, אשר מכילים רוב החלבונים המצוין המקושרים מחייב RNA מולקולרית ביולוגיה RNA ( איור 1F , מימין) ואשר לכבוש כ 38% ו 22% של כל פרוטאומה כבול mRNA, בהתאמה, מצביעים על היעילות הגבוהה של אינטראקציה mRNA אופטימיזציה לִלְכּוֹד. האחרון 40% (132 מועמד RBPs) סווגו בקטגוריה III בשל היעדר RBDs קונבנציונאלי. יתר על כן, רוב התפקידים EIR ב RNA מחייב ותהליכים ביולוגיים RNA לא אומתו ( איור 1F , משמאל). אנו מניחים כי חלבונים מקטגוריה זו יכולים לחשוף פונקציות חדשות בתקנות רנ"א.

איור 1
איור 1: תרשים זרימה ותוצאות של השיטה המיטבית לגילוי proteome מחויב mRNA מ ארבידופסיס עלה Protoplasts Mesophyll. ( א ) הצעדים העיקריים של השיטה כולה מופיעים 1 עד 11. תהליכים תאיים ומולקולריים putative מודגים על ידי צילום וקריקטורות. פרטים על כל צעד תוארו באופן אינטנסיבי בפרוטוקול. ( ב ) הילה נצפתה סביב גלולה חרוז במדגם CL, אבל לא במדגם בקרת הלא CL, במהלך שלב הרחצה 4.3. ( ג ) השוואה של mRNA UBQ10 יחסית 18s rRNA leveLs ב non-CL ו דגימות CL על ידי qRT-PCR (ערכים הם ממוצע ± SD (n = 3); * **: הבדלים משמעותיים עם p <0.05 ו <0.01). ( D ) חלבון מרוכז eluent של מדגם ללא CL לעומת דגימות CL מוקרן על ידי מקור UV גל רציף עבור 1, 3, ו 5 דקות, עם עוצמת UV ב 0.00875 W / cm 2 . ( ה ) זיהוי של פרוטאומה מחויב mRNA ידי proteomics. בפרוטומיה הכמותית המבוצעת על-ידי חבילת התוכנה Progenesis (משמאל), העלילה של הר געש מציגה את השינויים הממוצעים של log2-fold (CL / non-CL) ואת ערכי ה- p המותאמים (-log10 (ערכי p)) של כל החלבונים. ב proteomics האיכותי המבוצע על ידי חבילת התוכנה פיקס (מימין), החלבונים בדגימות מאוירים דיאגרמות ון. כמות החלבונים מופיעה במספרים. ה- FDR ברמת הפפטיד והחלבון הוא מתחת ל -5%. מספר חלבונים בתוך מסגרות חום בהיר נחשבים להיטים חיוביים. ( et al ., 2016. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

אנו בהצלחה להחיל mRNA אינטראקציה ללכוד, שפותח עבור שמרים ותאי אדם, לשתול protoplasts mesophyll עלה. תאים עלה mesophyll הם הסוג העיקרי של רקמת הקרקע עלים צמח. היתרון העיקרי של שיטה זו היא כי היא משתמשת vivo crosslinking לגלות את החלבונים מסביבה פיזיולוגית.

בפרוטוקול זה, אנו מציגים בעיקר מספר תנאים ניסיוניים אופטימיזציה ( למשל, מספר protoplasts להשתמש כחומר המוצא ומשך קרינה UV) 50 . החלבונים שנתפסו דגימות CL יכול רק להיות מזוהים על ידי SDS-PAGE וכסף מכתים כאשר מינימום של 10 7 protoplasts (בינוני) משמש (שלב 1.5.5). ריכוזים נמוכים אינם מניבים תבנית mRBP נצפתה על SDS-PAGE, וכנראה לא ישמשו לניתוח נוסף על ידי proteomics. ואכן, באמצעות יותר מ 10 7 תאים ( למשל, 10 9 בניסוי בקנה מידה גדול) אפשר גם 20 . תוצאות מבחני כסף מכתים עולה כי קרינה UV במשך 1 דקות עם 0.00875 W / cm 2 של עוצמת שנוצר על ידי מקור UV גל רציף הוא אופטימלי ( איור 1D ). יעילות גבוהה בשלב קריטי ( כלומר, mRNP הנמכת מטה וטיהור ידי oligo-d (T) 25 חרוזים, שלב 4) נתמך על ידי התוצאות של RT-qPCR, מכתים כסף, מבחני MS ( איור 1 ג ; 1D , ו 1E , מימין). השילוב של proteomics איכותי וכמותי יכול לעזור לזהות את RBPs חיובי באזור חפיפה בין הלא CL הבקרה דגימות CL ( איור 1E ). רוב החלבונים שזוהו היו RBPs לא ביאורים בעבר במערכי נתונים ( איור 1F ). הצגנו אלה בעבר ידוע RNA מחייב חלבונים בקטגוריה III כמו מועמד RBPs <Sup class = "xref"> 50 ( איור 1F ). חקר הספציפיות המחייבות של RBP אלה מועמד חייב להיעשות באמצעות שיטות אחרות, כגון שיטות CLIP שהוזכרו לעיל 23 . דוגמה אחת החוקר את הספציפיות המחייב של RBP כדי להסדיר את תעתיק mRNA היעד ב Arabidopsis באמצעות KIP 51 ניתן למצוא ב Zhang et al ., 2015. בנוסף, שיטה חלופית שונה מ PAR-CLIP, שנקרא photoactivatable- Ribonucleoside משופרת crosslinking (PAR-CL, 365 ננומטר UV-A) יש גם בעבר מומלץ בחקר של proteomes mRNA מחויב מ שמרים ותאי אדם 14 , 23 . PAR-CL דורש 4Su, אשר נלקח על ידי תאים שולבו RNAs המתהווה במהלך חילוף החומרים RNA והוא יכול להיות תגובתי מאוד, יצירת קשרים קוולנטיים עם חומצות אמינו 52 תחת קרינה UV-A (365 ננומטר)Ation. נכון לעכשיו, אין מחקרים המתמקדים רעילות של 4UU לתאי הצמח ואת ספיגת יעיל של 4sU אקסוגני לתוך protoplasts mesophyll 53 . עם זאת, אנו מאמינים כי ניתן יהיה להשתמש הן CL רגיל (254 ננומטר UV-C) ו PAR-CL (365 ננומטר UV-A) על צמחים, אשר יתרום לגילוי ואימות של RBPs מגוונים מן הפיזיולוגיים סביבה בעתיד.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

למחברים אין מה לחשוף.

Acknowledgements

אנו מכירים במעבדה של פרופ 'יוריס וינדריקס, שסיפק את המנגנון crosslinking UV מצויד מנורת UV קונבנציונאלי. KG נתמך על ידי קרן מחקר KU Leuven ומכיר תמיכה של FWO להעניק G065713N.

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics