MRNA-interaktomfångst från plant protoplaster

Biochemistry

GE Global Research must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Här presenterar vi ett interaktivt fångstprotokoll applicerat på Arabidopsis thaliana leaf mesophyll protoplaster. Denna metod beror kritiskt på in vivo UV-tvärbindning och möjliggör isolering och identifiering av växt-mRNA-bindande proteiner från en fysiologisk miljö.

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

RNA-bindande proteiner (RBP) bestämmer skeden av RNA. De deltar i alla RNA-biogenesvägar och bidrar särskilt till post-transkriptionell genreglering (PTGR) av messenger-RNA (mRNA). Under de senaste åren har ett antal mRNA-bundna proteomer från jäst- och däggdjurscellinjer isolerats framgångsrikt genom användning av en ny metod som kallas "mRNA-interaktionsupptagning", vilket möjliggör identifiering av mRNA-bindande proteiner (mRBPs) Direkt från en fysiologisk miljö. Metoden består av in vivo ultraviolett (UV) tvärbindning, neddragning och rening av messenger ribonukleoproteinkomplex (mRNP) med oligo (dT) pärlor och den efterföljande identifieringen av de tvärbundna proteinerna med masspektrometri (MS). Mycket nyligen har flera plant-mRNA-bundna proteomer rapporterats samtidigt från olika Arabidopsis- vävnadskällor: etiolerade plantor, bladvävnad,Blad mesofyll protoplaster och odlade rotceller. Här presenterar vi den optimerade mRNA interaktionsfångningsmetoden för Arabidopsis thaliana leaf mesophyll protoplaster, en celltyp som fungerar som ett mångsidigt verktyg för experiment som innefattar olika cellanalyser. Villkoren för optimal proteinutbyte inkluderar mängden startvävnad och varaktigheten av UV-bestrålning. I mRNA bundna proteomet erhållits från ett medium-skala experimentet (10 7-celler), RBP-anordningama noteras att ha RNA-bindningskapacitet befanns vara överrepresenterade, och många nya RBP-anordningama identifierades. Experimentet kan skalas upp (10 9 celler) och den optimerade metoden kan appliceras på andra växtcellstyper och arter för att i stor utsträckning isolera, katalogera och jämföra mRNA-bundna proteomer i växter.

Introduction

Eukaryoter använder flera RNA-biogenesreglerande vägar för att upprätthålla cellulära biologiska processer. Bland de kända typerna av RNA är mRNA väldigt varierande och bär kodningskapaciteten för proteiner och deras isoformer 1. PTGR-vägen ger upphov till förekomsten av pre-mRNAs 2 , 3 . RBP från olika genfamiljer kontrollerar reglering av RNA, och i PTGR styr specifika mRBPs mRNA genom direkta fysiska interaktioner och bildar funktionella mRNP. Identifiering och karakterisering av mRBP och deras mRNPs är därför avgörande för att förstå regleringen av cellulär mRNA-metabolism 2. Under de senaste tre decennierna har olika in vitro- metoder - inklusive RNA-elektroforetisk rörlighetskifte (REMSA) -analyser, systematisk utveckling av ligander genom exponentiella anrikningsanalyser (SELEX) baserat på bibliotek-härledda konstruktioner, RNA Bind-n-Seq (RBNS), radiomärkta eller kvantitativaFluorescens-RNA-bindningsanalyser, röntgenkristallografi och NMR-spektroskopi 4 , 5 , 6 , 7 , 8 , 9 - har applicerats i stor utsträckning på studier av RBP, huvudsakligen från däggdjursceller. Resultaten av dessa studier av mammaliska RBP kan sökas via RNA-bindande Protein DataBase (RBPDB), som samlar de publicerade observationerna 10 .

Även om dessa in vitro- metoder är kraftfulla verktyg, bestämmer de de bundna RNA-motiven från en given RNA-pool av sekvenser och är därför begränsade i deras förmåga att upptäcka nya mål-RNA. Detsamma gäller för beräkningsstrategier för att förutse genomomfattande RBP, vilka är baserade på bevarande av proteinsekvens och struktur 15 . För att övervinna detta har en ny experimentell metod haS har etablerats som möjliggör identifiering av RNA-motiv som en RBP av intresse interagerar med, liksom för bestämning av den exakta bindningsstället. Denna metod, kallad "tvärbindning och immunutfällning" (CLIP), består av in vivo UV-tvärbindning följt av immunutfällning 11 . Tidiga studier har visat att fotoaktivering av DNA- och RNA-nukleotider kan ske vid exciterings UV-våglängder större än 245 nm. Reaktionen genom tymidin verkar gynnas (rang i ordning med minskad fotoreaktivitet: dT> dC> rU> rC, dA, dG) 12 . Med användning av UV-ljus med en våglängd på 254 nm (UV-C) observerades att kovalenta bindningar mellan RNA-nukleotider och proteinrester skapas när det gäller endast några Ångström (Å). Fenomenet kallas därför "nolllängd" tvärbindning av RNA och RBP. Detta kan följas av ett stringent reningsprocedur Kosta med liten bakgrund 13 , 14 .

En strategi som kompletterar CLIP är att kombinera in vivo UV-tvärbindning med proteinidentifiering för att beskriva landskapet av RBP. Ett antal sådana genombredda mRNA-bundna proteomer har isolerats från jästceller, embryonala stamceller (ESC) och humana cellinjer ( dvs HEK293 och HeLa) med användning av detta nya experimentella tillvägagångssätt, som kallas "mRNA interactome capture" 18 , 19 , 20 , 21 . Metoden består av in vivo UV-tvärbindning följt av mRNP-rening och MS-baserad proteomik. Genom att tillämpa denna strategi har många nya "moonlighting" RBPs innehållande icke-canoniska RBDs upptäckts, och det har blivit klart att fler proteiner har RNA-bindande förmåga än vad som tidigare antagits"> 15 , 16 , 17. Användningen av denna metod möjliggör nya applikationer och för förmågan att svara på nya biologiska frågor vid undersökning av RBP. Till exempel har en nyligen genomförd studie undersökt bevarande av det mRNA-bundna proteomet (kärn-RBP Proteom) mellan jäst och humana celler 22 .

Planta RBP har redan visat sig vara involverade i tillväxt och utveckling (t ex i posttranskriptionsreglering av blomningstid, cirkadian klockan och genuttryck i mitokondrier och kloroplaster) 24 , 25 , 26 , 27 , 28 , 29 . Dessutom menas de att utföra funktioner i cellprocesserna som svarar mot abiotiska påfrestningar ( t.ex. kyla, torka, saLinitet och abscisinsyra (ABA)) 31 , 32 , 33 , 34 . Det finns mer än 200 förutsagda RBP-gener i Arabidopsis thaliana genomet, baserat på RNA-igenkänningsmotiv (RRM) och K-homologi (KH) domänföljdsmotiv; I ris har cirka 250 noterats 35 , 36 . Det är anmärkningsvärt att många förutspådda RBP verkar vara unika för växter ( t.ex. ingen metazoan orthologs till cirka 50% av predikterade Arabidopsis RBPs som innehåller en RRM-domän) 35 , vilket tyder på att många kan tjäna nya funktioner. Funktionerna hos de flesta förutspådda RBP: erna kvarstår okarakteriserade 23 .

Isoleringen av mRNA-bundna proteomer från Arabidopsis etiolerade plantor, lövvävnad, odlade rotceller och blad mesofyll protoplaster genom användning avMRNA interaktionsfångst har nyligen rapporterats 38 , 39 . Dessa studier visar den starka potentialen att systematiskt katalogisera funktionella RBP i växter inom en snar framtid. Här presenterar vi ett protokoll för mRNA-interaktionavskiljning från växtprotoplaster ( dvs. celler utan cellväggar). Arabidopsis thaliana leaf mesophyll protoplaster är den huvudsakliga typen av bladcell. De isolerade protoplasterna möjliggör optimal åtkomst av UV-ljus till cellerna. Denna celltyp kan användas i analyser som transientt uttrycker proteiner för funktionell karakterisering 40 , 41 . Vidare har protoplaster applicerats på flera andra växtcellstyper och arter 42 , 43 , 44 ( t.ex. Petersson et al ., 2009; Bargmann och Birnbaum, 2010; och Hong et al ., 2012).

<P class = "jove_content"> Metoden omfattar totalt 11 steg ( Figur 1A ). Arabidopsis leaf mesophyll protoplaster isoleras först (steg 1) och UV-bestrålas därefter för att bilda tvärbundna mRNPs (steg 2). När protoplaster lyseras under denatureringsbetingelser (steg 3) frisätts de tvärbundna mRNP: erna i lys / bindningsbuffert och dras ned av oligo-d (T) 25 pärlor (steg 4). Efter flera runda stränga tvättar renas mRNPs och analyseras ytterligare. De denaturerade peptiderna av mRBPs digereras av proteinas K innan de tvärbundna mRNA: ren renas och RNA-kvaliteten verifieras av qRT-PCR (steg 5 och 6). Efter RNas-behandling och proteinkoncentration (steg 7) styrs proteinkvaliteten genom SDS-polyakrylamidgelelektrofores (SDS-PAGE) och silverfärgning (steg 8). Skillnaden i proteinbandsmönster kan lätt visualiseras mellan ett tvärbundet prov (CL) och ett icke-tvärbundet prov (icke-CL;Det negativa kontrollprovet från protoplaster som inte utsätts för UV-bestrålning). Identifikationen av proteiner uppnås genom MS-baserad proteomik. Proteinerna från CL-provet separeras genom endimensionell polyakrylamidgelelektrofores (1D-PAGE) för att avlägsna eventuell bakgrundskontaminering, "in-gel digereras" till korta peptider med användning av trypsin och renas (steg 9). Nano reversfas vätskekromatografi kopplad till masspektrometri (nano-LC-MS) möjliggör bestämning av mängden av slutgiltiga proteiner i det mRNA-bundna proteomet (steg 10). Slutligen kännetecknas de identifierade mRBP: erna och katalogiseras med användning av bioinformatisk analys (steg 11).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Arabidopsis Leaf Mesophyll Protoplast Isolation

OBS: Arabidopsis blad mesofyll protoplaster är väsentligen isolerade såsom beskrivits av Yoo et al ., 2007, med flera modifieringar 40 .

  1. Tillväxt av växter
    1. Blöt ca 200 Arabidopsis thaliana Col-0 ekotypfrön i steriliserat vatten i 2 dagar vid 4 ° C i mörker för stratifiering.
      OBS: Detta antal frön är tillräckligt för ett icke-CL-prov och ett CL-prov (se steg 1.3).
    2. Förbered krukor med en 50% ( v / v ) blandning av jord och vermikulit och dra krukorna med destillerat vatten i en bricka för att blöda jorden.
    3. Så och fördela de stratifierade fröna på våtmark. Täck inte frön med ytterligare mark eftersom Arabidopsis frön behöver ljus för grobarhet.
      OBS: Växttillväxtbetingelserna är en 12 h ljus / 12 h mörkcykel vid 23 ° C,Med en ljusintensitet av 100 μmol m -2 s -1 , i ett tillväxtrum i 5 veckor före blomning. 4 veckor gamla växter kan också användas 40 .
      OBS: Alla beskrivna material och reagens från steg 1.2.1 till steg 3.2.3 gäller för två prover ( dvs. ett icke-CL-prov (kontrollprovet som inte utsätts för UV-C-bestrålning) och ett CL-prov (forskningen Prov som utsätts för UV-C-bestrålning)).
  2. Framställning av isotonisk enzymlösning
    1. Gör 80 ml primär isotonisk enzymlösning (400 mM mannitol, 20 mM KCl och 20 mM MES-buffert (pH 5,7)) och värm upp lösningen omedelbart i en inkubator med 60 ° C under 10 minuter.
    2. Lägg 1,2 g Cellulase R10 (vikt / volym 1,5%) och 0,32 g av Macerozyme R10 (vikt / volym 0,4%) pulver till den varma primär isotonisk enzymlösning.
    3. Tag försiktigt enzympulvret i lösning genom att applicera försiktig omrörning. RapVärm upp lösningen i en 60 ° C inkubator i 10 minuter tills enzymlösningen är klar ljusbrun.
    4. Kyl lösningen på is under 3 min och tillsätt 800 | il av en M CaCl 2 och 800 mikroliter av 10% (vikt / volym) BSA till lösningen.
    5. Homogenisera lösningen genom pipettering och filtrering genom ett 0,22 μm filter. Aliquot denna sista isotoniska enzymlösningen i två storskaliga petriskålar (150 mm x 20 mm).
  3. Framställning av Arabidopsis rosettbladremsor
    OBS! 150 blad för varje petriskål rekommenderas för ett icke-CL-prov eller ett CL-prov.
    1. Välja och skär totalt 300 expand fullt 2 nd - eller 3: e -pair riktiga blad (medeltal: 3 - 4 procent rosetten) i 0,5- till 1-mm bladremsor med användning av en ny och skarp rakblad.
    2. Överför och nedsänk remsorna omedelbart i isotonisk enzymlösning.
      OBS! För att undvika kontakt med ljus, täck alltid av tHan petriskålar med aluminiumfolie. Krossa inte bladen. Bekräfta att alla remsor är nedsänkta i lösningen och svävar inte på ytan.
  4. Isolering av Arabidopsis blad mesofyll protoplaster
    1. Placera aluminiumfoliebelagda petriskålarna i vakuumtorkare och infiltrera bladremsorna under vakuum under 30 minuter. Därefter inkubera petriskålarna i mörker utan att skaka vid rumstemperatur i 2,5 timmar.
    2. Skaka försiktigt och kortvarigt disken horisontellt för hand, försök att släppa protoplasterna helt i enzymlösningen.
  5. Skörda och räkna protoplasterna
    1. Filtrera protoplans suspension genom en 35 till 75 μm nylon mesh. Aliquot filtratet av varje prov i två 50 ml runda bottenrör (ca 20 ml filtrat i varje rör).
    2. Skölj varje petriskål med 10 ml W5-buffert (154 mM NaCl, 125 mM CaCl
    3. Snurra alla fyra rören i 5 minuter vid 100 xg för att pelletera protoplasterna. Kassera supernatanten och försiktigt resuspendera protoplastpellets i varje rör med 10 ml W5-buffert.
      ANMÄRKNING: När du resuspenderar protoplastpelletsna försiktigt röret upp och ner och försiktigt rotera röret med hand tills pelletsen har försvunnit. Pipettera inte pelleten direkt för att undvika att skada cellerna.
    4. Upprepa steg 1.5.3 en gång och kombinera protoplast-suspensionen från två rör i varje prov i ett 50 ml rundrör. Håll rören på is.
    5. Räkna protoplasterna med en hemocytometer.
      OBS! Varje 20 celler inom 25 kuber är lika med 2 x 10 5 protoplaster / ml. 150 löv bör ge ungefär 1 x 107 celler.Modulera att ha ett lika totalt antal protoplaster i icke-CL- och CL-proverna.
    6. Håll protoplasterna på is i 30 minuter. Därefter roterar rören i 5 minuter vid 100 x g. Kassera supernatanten och resuspendera protoplasterna i varje rör med 20 ml av MMG-lösning (400 mM mannitol, 15 mM MgCl2, och 4 mM MES-buffert (pH 5,7)).

2. In vivo mRNA-protein-tvärbindning genom UV-bestrålning

OBS: Håll provröret på icke-CL på is. CL-provet måste omedelbart UV-bestrålas.

  1. Överför protoplast suspensionen innehållande 1 x 107 celler från CL provröret till en ny storskalig petriskål (150 mm x 20 mm) och tillsätt 30 ml iskall MMg lösning för att täcka plattytan. Sprid cellerna i hela MMg-bufferten genom försiktig pipettering. Placera omedelbart petriskålen utan det övre locket i en UV-tvärbindningsapparat.
    OBS: Höjden mellan UV-lampanOch petriskålen är 8 cm.
  2. Bestråla provet med 254 nm våglängd UV-ljus och 0,00875 W / cm 2 UV-intensitet för en min, 3 min, eller 5 min. Efter bestrålning, snabbt alikvot protoplast suspensionen i två nya 50 ml runda bottenrör. Tvätta botten av skålen med ytterligare 5 ml iskall MMg-lösning för att samla återstoden av protoplasterna och tillsätt denna cellsuspension till dessa två rör.
    OBS: 1 min valdes som optimalt tillstånd. Förklaringen finns i representativa resultat .

3. Protoplast Lysis under denatureringsbetingelser

  1. Framställning av protoplastpellets för lysis
    1. Spinna icke-CL provröret tillsammans med de två CL provrören från steg 2 vid 100 xg i 5 min och kassera supernatanten. Placera röret i protoplastpellets icke-CL-provpellet på isen.
    2. Tillsätt 10 ml iskall MMg-lösning till varje CL-provrör, allmTly resuspendera pellets, och kombinera dem tillbaka i ett 50 mL rundbottnad rör. Snurra röret vid 100 xg under 5 minuter. Efter avlägsnande av supernatanten, behåll protoplastpellets CL-provrör på is.
  2. Protoplastlys och homogeniserande protoplastlysat
    1. Tillsätt 9 ml iskall lysis / bindningsbuffert (500 mM LiCl, 0,5% ( vikt / volym ) litiumdodecylsulfat (LiDS), 5 mM ditiotreitol (DTT), 20 mM Tris-HCl (pH 7,5) och 1 mM EDTA (pH 8,0)) till cellpelleten av varje prov. Ljusa protoplasterna grovt genom pipettering upp och ner ungefär 20 gånger tills suspensionen är homogent ljusgrön.
    2. Passera protoplastlysatet två gånger genom en 50 ml glasspruta med en smal nål (0,9 x 25 mm 2 ) för homogenisering. Inkubera lysatet på is under 10 minuter. Frys lysaten i flytande kväve och förvara vid -80 ° C i upp till 3 veckor.

4. MRNP-dragning och reningAv Oligo-d (T) 25 pärlor

OBS! Alla följande beskrivna material och reagens, från steg 4.1 till steg 4.4, är endast för ett prov ( dvs. ett icke-CL-prov eller ett CL-prov). Protoplastlysatet måste tillsättas omedelbart till rören innehållande pärlor efter det att pärlsupernatantljus / bindningsbufferten kasseras.

  1. Framställning av oligo-d (T) 25 magnetiska kulor för oligo (dT) infångning
    1. Tina det frusna protoplastlysatet vid rumstemperatur. När lysatet är helt upptat, behåll lysatröret på is.
    2. Alikvot 1,8 ml oligo-d (T) 25 magnetiska pärlor (5 mg / ml) i 6 nya 2 ml runda bottenmikrocentrifugrör på is. I varje rör tvättar pärlsuspensionen homogent med 600 | il lysis / bindningsbuffert genom att pipettera upp och ner kortvarigt och rotera försiktigt vid 4 ° C under 2 minuter. Håll pärlorna på is.
  2. Bindande
    1. PlatsAlla 6 rör som innehåller pärlorna i en magnetstativ vid 4 ° C under 3 minuter, vilket kommer att leda till magnetisk infångning av pärlorna och avlägsnande av suspensionen.
      OBS! När rören är placerade i magnetrackan, vänta tills pärlorna är helt fångade, minst 3 min.
    2. Kassera supernatanten och omedelbart alikvotera 9 ml protoplastlysat i dessa 6 rör. Blanda väl genom pipettering tills en homogen brun suspension visas och inkubera pärlorna i protoplastlysat vid 4 ° C under 1 h genom att applicera mild rotation.
      OBS: En inkubationstid från 30 min till 1 h rekommenderas.
  3. Tvättning
    1. Placera rören tillbaka i magnetstativet vid 4 ° C i 3 minuter. När alla pärlor fångas på rörets sida samlas protoplastlysatet in i 6 nya 2-ml mikrocentrifugrör med rund botten och förvarar dem tillfälligt vid 4 ° C. Kassera inte protoplastlysatet omedelbart; Behåll lysatetVid 4 ° C.
    2. Tillsätt 1,5 ml iskall tvättbuffert 1 (500 mM LiCl, 0,1% ( vikt / volym ) LiDS, 5 mM DTT, 20 mM Tris-HCl (pH 7,5) och 1 mM EDTA (pH 8,0)) till pärlorna I varje rör. Resuspendera pärlorna och använd mild rotation i 1 min. Placera rören tillbaka i magnetracket vid 4 ° C under 3 minuter och kassera supernatanten. Upprepa detta tvättsteg med tvättbuffert en gång.
    3. Upprepa samma procedur i detta tvättsteg två gånger med 1,5 ml iskall tvättbuffert 2 (500 mM LiCl, 5 mM DTT, 20 mM Tris-HCl (pH 7,5) och 1 mM EDTA (pH 8,0)) och en gång med användning 1,5 ml iskallt lågsaltbuffert (200 mM LiCl, 20 mM Tris-HCl (pH 7,5) och 1 mM EDTA (pH 8,0)).
      OBS! Om mRNP: erna isolerats effektivt från protoplastlysatet, bör det finnas en "halo" som är synlig runt pärlpelleten i CL-provet under tvättsteget med tvättbuffert 2 ( Figur 1B ).
  4. eluering
    1. Tillsätt 500 μlElueringsbuffert (20 mM Tris-HCl (pH 7,5) och 1 mM EDTA (pH 8,0)) till pärlorna i varje rör. Resuspendera pärlorna försiktigt och inkubera vid 50 ° C i 3 minuter för att släppa de poly (A) -tappade RNA: erna. Resuspendera pärlorna försiktigt en gång genom pipettering. Placera rören tillbaka i magnetstativet vid 4 ° C i 5 minuter.
    2. Överför och kombinera alla eluenter (cirka 3 ml totalt) till ett rent, sterilt RNase-fri, 15 ml koniskt bottenrör på is.
      OBS: Kvaliteten och kvantiteten av RNA kan omedelbart bestämmas med hjälp av en spektrofotometeranordning.
      ANMÄRKNING: RNA-koncentrationen för varje prov är ungefär 10 ng / μl, med ett A 260 / A 280- förhållande av 1,9. A 260 / A 280- förhållandet bör vara mellan 1,6 och 2,0 eftersom de isolerade poly (A) -tavlade RNA-värdena vanligtvis är större än 70% rena. Om RNA-koncentrationen är för låg, öka antalet startprotoplaster till maximalt 10 9 . proverKan frysas i flytande kväve och hållas vid 80 ° C för långvarig lagring.
    3. Upprepa steg 4.2 till steg 4.4 för ytterligare två omgångar och använd oligo-d (T) 25- pärlorna igen för att tömma poly (A) -tappade RNA från protoplastlysatet.
      ANMÄRKNING: Efter tre omgångar av neddragningsproceduren ska totalt 9 ml elueringsmedel för varje icke-CL- eller CL-prov ingå. Utför allt arbete vid 4 ° C för att undvika nedbrytning av RNA. Följ steg 4.5 eller steg 4.6 för att återanvända eller regenerera pärlorna.
  5. Framställning av återanvända oligo-d (T) 25 pärlor
    1. Tvätta pärlorna två gånger med 1 ml iskall elueringsbuffert och en gång med 1 ml iskall lys / bindningsbuffert för att justera salt LiCl-koncentrationen tillbaka till 500 mM.
    2. Följ steg 4.1, kassera supernatanten, överför det lagrade protoplastlysatet i varje rör och upprepa hela proceduren från steg 4.2 till steg 4.4 i ytterligare två rundor.
  6. 25 pärlor
    OBS: Pärlor kan lagras och användas för ett annat experiment (maximal återanvändning är tre gånger).
    1. Följ steg 4.4, tillsätt 1 ml 0,1 M NaOH till pärlorna och inkubera genom att rotera vid rumstemperatur i 5 minuter. För varje rör tvättas två gånger med 1 ml tvättbuffert 1 och tre gånger med 1x PBS (pH 7,4) innehållande 0,1% Tween-20 för jämviktning. Håll pärlorna från varje rör i 300 | il steril RNase-fri 1x PBS (pH 7,4) innehållande 0,1% Tween-20 vid 4 ° C för långvarig lagring.
      OBS: Pärlor som används för Arabidopsis CL-prover i detta experiment kan endast användas för samma plantprover nästa gång.

5. Proteinas K-behandling och mRNA-rening

  1. Proteinas K-behandling
    1. Tillsätt 8 μl Proteinase K lösning (2 μg / μl) till 1 ml av elueringsmedlet från varje prov för att smälta de UV-tvärbundna proteinerna. BrIewe vortex.
  2. MRNA-rening
    1. Inkubera elueringsmedlet vid 37 ° C i 1 h. Rening av RNA med RNA-reningskit för att avlägsna resterande föroreningar.
      OBS: Efter rening är RNA redo för RNA-kvalitetstestet med hjälp av qRT-PCR-analysen.
      OBS: Andra kit, som RNA mini-kit och TRIzol-reagens, kan också användas 14 .

6. qRT-PCR-analys

  1. Omvänd transkription
    1. Uppnå effektiv syntes av första sträng-cDNA med användning av det omvända transkriptionssystemet, med 1 ug RNA som mall. Späd provet till 5 ng / μl med nukleasfritt vatten.
  2. CDNA-kvantifiering med användning av qRT-PCR
    1. Förstärka och kvantifiera cDNA med användning av qPCR-masterblandningen och realtids PCR-cykler, med 10 ng cDNA som mall. Använd följande PCR-program: 95 ° C i 10 minuter(Steg 1, en cykel) och 95 ° C under 15 s och 60 ° C i 1 min (steg 2, 40 cykler).
      OBS: Referensgenen som användes här var en endogen intern kontrollgen, UBQ10 (AT4G05320). QRT-PCR-primers för UBQ10 och 18S rRNA beskrivs i Li et al ., 2014 och Durut et al ., 2014 respektive 45 , 46 . Primersekvenser är listade i materialtabellen .

7. RNasbehandling och mRBP-koncentration

  1. RNase-behandling
    1. Tillsätt ca 100 U RNase-cocktail innehållande RNase A och RNase T1 i 8 ml elueringsmedel. Inkludera ett negativt kontrollprov med RNase-cocktail där elueringsmedlet ersätts av nukleasfritt vatten. Kortvarigt virvel och inkubera vid 37 ° C under 1 h.
  2. MRBP-koncentrationen
    1. Efter RNase-digestion, koncentrera elueringsmedlet usinG centrifugalfilterenheter. Slutvolymen är 75 pl, med ett totalt proteinutbyte av ungefär 2 ug av varje prov efter koncentration. Placera proverna vid -80 ° C för långvarig förvaring.

8. SDS-PAGE och silverfärgning

  1. SDS-PAGE
    1. Blanda 25 μl av det koncentrerade elueringsmedlet (CL-provet) eller kontrollprovet (icke-CL-prov) med 15 μl 2x laddningsfärg. Värm provet vid 95 ° C i 5 minuter och laddla det på en SDS-PAGE-gel innehållande 5% stapelgel och 12% upplösande gel, inklusive en proteinmarkör.
    2. Kondensera proteinerna vid 60 V i 40 min och separera vid 160 V i ungefär 1 h tills laddningsfärgen når slutet av upplösningsgelén.
  2. Silverfärgningsanalys
    1. Tvätta SDS-PAGE gelén två gånger med ultralätt vatten i 5 minuter varje gång. Utför silverfärgningen av proteinerna med användning av en kommersiell silverfärgssats.
      OBS: Proteinbanden måste visas inom 5 minuter. Om banden är synliga utöver 5 min med mycket ljus färg rekommenderas det att öka antalet startprotoplaster upp till högst 10 9 .

9. Trypsin-uppslutning av proteinband och peptidrening

  1. Trypsin digestera
    OBS: Kör en andra 1D-PAGE gel genom att ta ytterligare 25 μL koncentrerad mRBP-lösning från varje prov för mRBP-identifiering; Silverfärgade geler kan inte användas eftersom de inte är kompatibla med MS-analys.
    1. Efter att ha kört 1D-PAGE gelén, fixa gelén i fixeringslösning (50% ( volym / volym ) metanol och 10% ( volym / volym ) ättiksyra) i 1 timme. Stänk gelén i fläcklösning (0,1% ( vikt / volym ) Coomassie Brilliant Blue R-250, 50% ( volym / volym ) metanol och 10% ( volym / volym ) ättiksyra) under 20 minuter med försiktig skakning. Destrudera gelén i destain lösning (40% ( volym / volym ) metanol och 10% ( v/ V) ättiksyra) i 1 h. Efter avlägsnande behåll gelen i 5% ( volym / volym ) ättiksyra.
      ANMÄRKNING: Under destaining kan ny destain lösning ersättas tills bakgrunden är fullständigt förstörd.
    2. Skär de intressanta banden ur gelén. Skär banden vidare i bitar av ungefär 1 mm 3 för den efterföljande optimala trypsinutjämningen och extraktion av peptider. Hydratisera gelbitama med 50 mikroliter av 100 mM ammoniumbikarbonat (NH 4 HCO 3) under 10 min. Täcka gelstyckena helt.
      1. Avlägsna hydratiserande lösningen noga och dehydratisera gelbitama med acetonitril (CH3CN) under 10 min. Ta försiktigt bort acetonitrillösningen.
      2. Upprepa processen från hydratisering till uttorkning två gånger. Slutligen avlägsna acetonitrillösningen.
        OBS: Gelens gångtid beror på experimentets syfte. En långsiktig tid tillåter en god separation av proteiner, så det färgade specifika gelförbudetDs kan klippas ut för vidare analys. Om syftet är att hålla proteinerna och avlägsna föroreningar är en kortslutstid tillräcklig.
    3. Tillsätt 500 μL 6,6 mM DTT-lösning och inkubera gelstyckena under 10 minuter. Ta bort DTT-lösningen och tvätta gelstyckena två gånger med 500 μL 95% ( v / v ) acetonitrillösning.
      1. Efter tvättning, avlägsna acetonitrillösningen och inkubera gelbitarna med 500 | il 55 mM jodättiksyra (IAA) -lösning under 10 minuter i mörkret.
      2. Efter inkubering, avlägsna lösningen och tvätta gelstyckena igen med 500 | il 95% ( v / v ) acetonitrillösning. Torka gelstyckena.
    4. Bädda gelbitama fullständigt med 25 mikroliter av digereringsbuffert (50 mM NH 4 HCO 3, 5 mM CaCl2, och 6 ng / mikroliter trypsin) och hålla på is under 45 min för att låta trypsinet tränga in i gelén. Inkubera gelbitarna över natten vid 37 ° C för en Zymatisk digestion.
  2. Peptidrening
    1. Lägga 80 mikroliter av 50 mM NH 4 HCO 3 till gelbitama i digereringsbuffert och virvel upprepade gånger för att extrahera de tryptiska peptiderna. Samla extraktet. Upprepa detta extraktionssteg två gånger med 80 mikroliter av 50% (volym / volym) CH3CN och 5% (volym / volym) myrsyra (FA).
      OBS: Det totala slutliga extraktet bör vara ca 240 μl.
    2. Pool och koncentrera extrakten till ca 10 | il genom vakuumkoncentration eller lyofilisering och tillsätt 25 | il 0,1% ( v / v ) vattenhaltig trifluorättiksyra (TFA) -lösning. Sleta proven med μ-C18 kolumner, enligt tillverkarens protokoll.
    3. Eluera peptiderna med 4 - 10 | il av 60% (vikt / vol) CH3CN och 0,1% (vol / vol) FA. Lyofilisera (frystorka) peptiderna och lagra dem vid -20 ° C till analys.
Titeln "> 10. Nano-LC-MS

  1. Nano revers-fas vätskekromatografi
    OBS: Utför LC-MS-analysen med en masspektrometer som är onlinekopplad med ett vätskekromatografiinstrument. Detta instrument bör utrustas med en C18-kolonn (2 pm partikel, 100 Å porstorlek och 50 μm x 15 cm i dimension).
    1. Resuspendera de lyofiliserade peptiderna i 16 mikroliter av lösning (2% (vol / vol) CH3CN och 0,1% (vol / vol) FA). Injicera och ladda 5 μl peptidlösning vid en flödeshastighet av 5 | il / min på en C18-precolumn (3 | im partikelstorlek, 100 Å porstorlek, nanoviper och 75 | xm x 2 cm i dimension).
    2. 10.1.2. Separera peptiderna med en 95-min-gradient med en flödeshastighet av 300 nL / min. Under denna separationsgradient ökar den mobila fasen B från 4% till 10%, 10% till 25% och 25% till 45% i 5 minuter, 50 minuter respektive 18 minuter. Slutligen ökar mobilfasen B kraftigt till 95% på 1 min. EfterVarje separationsgradient på 95 min tillämpar ett inneboende sköljningssteg innehållande en 10 min-gradient från 4% till 95% i 5 min.
      OBS: Mobil fas A är 99,9% H2O och 0,1% (vol / vol) FA, och mobil fas B är 19,92% H 2 O, 80% (vikt / volym) CH 3 CN och 0,08% (volym / volym ) FA.
  2. Masspektrometrianalys
    1. Använd masspektrometern i databeroende läge med ett massintervall från 400 till 1600 m / z.
    2. Välj upp till tio av de mest intensiva joner i MS1 för att generera fragmenteringsspektra. Ställ upplösningen till 70 000 full bredd vid halvmaximum (FWHM) för MS1 och 17 000 för MS2, med ett mål för automatisk förstärkningskontroll (AGC) på 3.000.000 och 1.000.000 joner och en maximal joninsprutningstid (IT) på 256 och 64 ms för MS1 Respektive MS2.
    3. Ställ in den dynamiska uteslutningen till 10 s för att undvika upprepad fragmentering av de mest överflödiga joner.
      OBS: Här är joner med en eller flera än sex laddningar eXcluded för MS2.
  3. Kvalitativ proteomik: peptid och proteinidentifiering
    1. Analysera fragmenteringsspektra med användning av mjukvara som Peaks Studio Software 47 , 48 , 49 .
      OBS! Andra mjukvarupaket är också tillgängliga för peptididentifiering, såsom NovoHMM 30 och PepNovo 37 för de novo- sekvensering och SEQUEST 54 och Mascot 55 för databasökning.
    2. Kombinera spektra med samma massa (<2 ppm skillnad) och retentionstider (<2 min) och behåll bara spektra med en kvalitetströskel högre än 0,65 för att söka i Swiss-Prot-databasen (version: december 2013) för att taxonomin ska vara modell Växt Arabidopsis thaliana . Använd följande sökparametrar: en förstadiumsmassatolerans på 10 ppm genom användning av monOisotopmassa; En fragmentmassatolerans av 20 mmu; Trypsin som digestionsenzym, med högst 2 missade klyvningar; Cysteinkarbamidometylering som den fasta modifieringen; Metioninoxidation som den variabla modifieringen; Och maximalt 3 variabla post-translationella modifieringar per peptid. Efter identifiering sätter man manuellt tröskelvärdena för pålitlig peptid- och proteinidentifiering så att en falsk upptäckthastighet (FDR) <5% förvärvas.
  4. Kvantitativ proteomik: statistisk analys av masspektrometri data
    1. Använd LC-MS ( t.ex. Progenesis) för etikettfri kvantifiering av proteomics data.
      OBS: MS1-peptid toppområden (eller intensitet) är kopplade till de peptider som identifierats av studiosoftware enligt deras massa, med tolererat fel på högst 10 ppm.
      OBS: Denna programvara beräknar överflöd av en peptid genom att integrera toppområdena för alla laddningstillstånd mellan 2 <Sup> + och 8 + . Den kvantitativa data är kopplad till PEAKS-peptididentifiering med ett inhouse-skript (massa matchning med tolererat fel vid max 10 ppm).
    2. Beräkna de genomsnittliga log2-faldiga ändringarna (CL / non-CL) för varje peptid. Gruppa vikningsförändringarna av de unika peptiderna genom protein.
      OBS! I varje grupp motsvarar den slutliga vikten av ett protein de genomsnittliga vikförändringarna av dess peptider.
    3. Beräkna p-värdet med studentens t- test för varje grupp för att utvärdera statistisk signifikans. Applicera R-programvarupaketet (version 3.3.0) för att korrigera p-värdena för FDR för alla grupper med Benjamini-Hochberg (BH) -metoden.
    4. Rita vulkanplanen med funktionen "kalibrera" (version 1.7.2) som är kompatibel med programvarupaketet R (version 3.3.0).
      OBS! Här är de -log10-justerade p-värdena (-log10 (adj. P-värde)) en funktion av de log2-faldiga ändringarna av alla identifierade proteiner. Proteiner ärBehandlas som positiva träffar i det mRNA-bundna proteomet om deras log2-faldiga förändringar är större än 2, med eller utan betydelse.

11. Katalog av det identifierade mRNA-bundna proteinet

  1. Klassificera de identifierade proteinerna från steg 10 till tre kategorier baserade på "molekylära funktioner och biologiska processer" via Gene Ontology (GO) -databasen och "familj och domän" via InterPro-databasen.
  2. Som kategori I eller "Ribosomala proteiner" innehåller alla upptäckta ribosomala proteiner, definierar proteiner från kategori II eller "Huvudsakliga RBP", som innehåller annoterade proteindomäner som interagerar med RNA eller länk till RNA-bindning med kända eller okända funktioner i RNA-biologi .
  3. Eftersom proteiner med kända eller okända funktioner i RNA-biologi utan annoterade RNA-bindande domäner placeras i kategori III, eller "Kandidat-RBP", definierar enzymer från kategori III baserat på annoteringar från INtEnz-databasen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Vi observerade en karakteristisk halo som omger pärlpelleten i CL-provet, i tvättsteg 4.3 med tvättbuffert 2 ( Figur 1B ). Fastän det inte har undersökts kan detta fenomen förmodligen förklaras av interferensen av tvärbundna mRNP-komplex med pärlaaggregation under magnetisk infångning, vilket orsakar ett mer diffust aggregat att bilda. Det indikerar att oligo-d (T) 25- pärlinfångningen var effektiv 14 .

De signifikant högre UBQ10- referensmRNA-nivåerna än 18S-rRNA i både icke-CL-kontroll och CL-prover visas i figur 1C . Detta indikerar att mRNA berikas i elueringsmedlet på grund av infångningen av oligo-d (T) 25 pärlor, som endast kan binda till poly (A) -tappade mRNA. Effektiviteten av oligo-d (T) 25- pärlainfångningen var ytterligare suppOrted genom SDS-PAGE och silverfärgning (steg 8), såsom visas i Figur 1D efter RNas-behandling och mRBP-koncentration (steg 7). En skillnad i proteinbandsmönster mellan icke-CL-kontroll- och CL-provbanor kan tydligt observeras, och de proteinband som finns närvarande i icke-CL-kontrollprovbanan kan förklaras av närvaron av RNas. Detta illustrerar den starka anrikningen av mRBP i CL-provet.

Effektiviteten av tvärbindningen kan regleras genom att variera tidsperioden för UV-bestrålning. Tillräcklig tvärbindning men undvikande av protoplastskador och RNA-nedbrytning är optimal. I Figur 1D erhölls specifika proteinbandsmönster i alla CL-prover vid jämförelse av olika UV-bestrålningstider (1, 3 och 5 min). Under samma UV-intensitet (0,00875 W / cm 2), de mest optimala förhållanden befanns vara 1 eller 3 min, eftersom den inte kan särskiljasProteinbandintensiteter. Svagare bandintensiteter observerades med längre tvärbindningstid (5 min). Vi ansåg 1 minut som det optimala tillståndet, eftersom en kortare längd av tvärbindning har den extra fördelen att det är lättare att överföra och samla protoplaster från petriskålen. Protoplaster kan snabbt utfällas till botten av petriskålen under UV-bestrålning eftersom de håller fast vid skålen. Detta gör det svårare att samla in och överföra dem till rören efter längre UV-bestrålningstid.

Baserat på de optimerade förhållandena uppnåddes identifieringen av proteiner från tre biologiska replikat genom kvalitativ och kvantitativ proteomik, vilken beskrivits i steg 9 och 10. I analysen med kvalitativa proteomiker ( Figur 1E , höger), totalt 341 proteiner Identifierades i CL-prover, varav 36 hittades både i icke-CL-kontroll anD CL-prover, och endast 8 proteiner detekterades i icke-CL-kontrollprovet. Denna enorma skillnad i identifierade proteinantal mellan båda proverna överensstämmer med de olika proteinbandsmönstren ( Figur 1D ), vilket stöder tanken att SDS-PAGE och silverfärgningsanalysen är bra verktyg för att validera effektiviteten hos oligo-d (T) 25 pärla fånga. I analysen av kvantitativa proteomiker ( Figur 1E , vänster) uppvisade totalt 325 proteiner (blå- och grönfärgade) en log2-faldig förändring större än 2. Bland dessa proteiner hade 100 proteiner (blåfärgade) små p -värden över signifikansnivån. Därför definierades de också som positiva träffar. Det är anmärkningsvärt att p-värdena för ytterligare 225 proteiner (grönfärgade) var större än 0,05, under signifikansnivån på grund av datarsparsitet. Det var med andra ord låga rikliga peptider som var närvarande för varje protein, med hög variabilitet av peptidintensitetes. Men eftersom alla av dem endast kvalitativt upptäcktes i CL-prover, ansågs de vara positiva.

Baserat på GO- och InterPro-databaserna 50 (steg 11) klassificerades dessa 325 proteiner vidare i kategori I (ribosomala proteiner), kategori II (huvudsakliga RBP) och kategori III (kandidat-RBP) ( Figur 1F ). Det fanns 123 ribosomala proteiner i kategori I, medan i kategori II observerades 70 annoterade klassiska RBP. Dessa två kategorier, som innehåller de flesta annoterade proteiner som kopplar till molekylär RNA-bindning och RNA-biologi ( Figur 1F , höger) och som upptar approximativt 38% och 22% av hela mRNA-bundna proteomen, anger hög effektivitet hos optimerad mRNA-interaktom fånga. De senaste 40% (132 kandidat-RBP) klassificerades i kategori III på grund av bristen på konventionella RBD. Dessutom är det mesta av thEir roller i RNA-bindning och RNA biologiska processer har inte validerats ( Figur 1F , vänster). Vi antar att proteiner från denna kategori skulle kunna avslöja nya funktioner i RNA-reglerna.

Figur 1
Figur 1: Flödesschema och resultat av den optimerade metoden för att upptäcka det mRNA-bundna proteinet från Arabidopsis Leaf Mesophyll Protoplasts. ( A ) Stora steg i hela metoden är listade från 1 till 11. Putativa cellulära och molekylära processer illustreras av fotot och tecknen. Detaljer för varje steg har beskrivits intensivt i protokollet. ( B ) En halo observerades omgivande pärlpelleten i CL-provet, men inte i icke-CL-kontrollprovet under tvättsteg 4.3. ( C ) Jämförelse av relativ UBQ10 mRNA och 18S rRNA-leveI icke-CL-kontroll och CL-prover med qRT-PCR (värden är medelvärde ± SD (n = 3); * och **: signifikanta skillnader med p <0,05 och <0,01). (D) Koncentrerad protein elueringsmedel av icke-CL kontrollprov jämfört med CL prover bestrålats med en kontinuerlig våg UV-källa för en, tre och fem minuter, med en UV-intensitet vid 0,00875 W / cm 2. ( E ) Identifikation av mRNA-bunden proteom av proteomics. I de kvantitativa proteomerna som utförs av Progenesis-mjukvarupaketet (vänster) visar vulkanplanen de genomsnittliga log2-faldiga ändringarna (CL / non-CL) och de relaterade justerade p-värdena (-log10 (adj. P-värden)) av Alla proteiner. I den kvalitativa proteomiken som utförs av Peaks mjukvarupaket (höger) illustreras proteinerna i proverna i Venn-diagram. Mängden proteiner anges i antal. FDR vid peptid- och proteinhalterna ligger under 5%. Antalet proteiner inuti de ljusbruna ramarna betraktas som positiva träffar. ( et al ., 2016. Vänligen klicka här för att se en större version av denna figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Vi tillämpade framgångsrikt mRNA interactome capture, utvecklad för jäst och mänskliga celler, till planta blad mesofyll protoplaster. Blad mesofyllceller är den huvudsakliga typen av markvävnad i växtblad. Den största fördelen med denna metod är att den använder in vivo tvärbindning för att upptäcka proteinerna från en fysiologisk miljö.

I detta protokoll presenterar vi främst ett antal optimerade experimentella förhållanden (t ex antalet protoplaster som ska användas som utgångsmaterial och varaktigheten av UV-bestrålning) 50 . De fångade proteinerna i CL-proverna kan endast detekteras genom SDS-PAGE och silverfärgning när minst 10 7 protoplaster (medelstora) används (steg 1.5.5). Lägre koncentrationer ger inte ett observerbart mRBP-mönster på SDS-PAGE och bör antagligen inte användas för ytterligare analys av proteomics. I själva verket använder man mer än 10 7 celler (t ex 10 9 tumEtt storskaligt experiment) är också möjligt 20 . Resultat från silver-färgnings analyser tyder på att UV-bestrålning under 1 min med 0,00875 W / cm 2 intensitet genereras av en kontinuerlig våg UV-källa är optimal (figur 1D). Hög effektivitet vid det kritiska steget ( dvs mRNP-neddragning och rening genom oligo-d (T) 25 pärlor, steg 4) stöds av resultaten från RT-qPCR, silverfärgning och MS-analyser ( Figur 1C ; 1D och 1E , höger). Kombinationen av kvalitativ och kvantitativ proteomik kan bidra till att identifiera de positiva RBP: erna i överlappningsområdet mellan icke-CL-kontroll och CL-prover ( Figur 1E ). Majoriteten av identifierade proteiner var RBP som inte tidigare annoterade i dataset ( Figur 1F ). Vi presenterade dessa tidigare okända RNA-bindande proteiner i kategori III som kandidat-RBP <Sup class = "xref"> 50 ( Figur 1F ). Explorering av bindningsspecificiteterna hos dessa kandidat-RBP måste ske med användning av andra metoder, såsom de tidigare nämnda CLIP-metoderna 23 . Ett exempel som undersöker bindningsspecificiteten hos en RBP för att reglera sitt målmRNA-transkript i Arabidopsis genom användning av CLIP 51 finns i Zhang et al ., 2015. Dessutom är en alternativ modifierad metod från PAR-CLIP, kallad photoactivatable- Ribonukleosidförbättrad tvärbindning (PAR-CL, 365 nm UV-A) har också tidigare rekommenderats för undersökning av mRNA-bundna proteomer från jäst- och humana celler 14 , 23 . PAR-CL kräver 4Su, som tas upp av celler och inkorporeras i nascent RNA under RNA-metabolism och kan vara mycket reaktiva, bildande kovalenta bindningar med aminosyror 52 under UV-A (365 nm) irradiation. För närvarande finns inga studier som fokuserar på toxiciteten hos 4sU till växtcellerna och den effektiva upptagningen av exogena 4sU i mesofyllprotoplaster 53 . Vi tror emellertid att det blir möjligt att använda både konventionella CL (254 nm UV-C) och PAR-CL (365 nm UV-A) på växter, vilket kommer att bidra till upptäckt och validering av olika RBP från de fysiologiska Miljö i framtiden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att avslöja.

Acknowledgements

Vi erkänner lab av prof Joris Winderickx, som tillhandahöll UV-tvärbindningsapparaten utrustad med den konventionella UV-lampan. KG stöds av KU Leuvens forskningsfond och bekräftar stöd från FWO-bidrag G065713N.

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics