MRNA संयंत्र Protoplasts से इंटरैक्टियम कैद

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

यहां, हम अरबिडोप्सिस थलियाना के पत्थरों मेसोफिल प्रोटॉप्लेट्स के लिए एक इंटरैक्टिम कैप्चर प्रोटोकॉल पेश करते हैं। यह विधि गंभीर रूप से विवो यूवी क्रॉटलिंकिंग में निर्भर करती है और एक शारीरिक वातावरण से संयंत्र एमआरएनए-बाइंडिंग प्रोटीन की अलगाव और पहचान की अनुमति देती है।

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

आरएनए बाध्यकारी प्रोटीन (आरबीपी) आरएनए के भाग्य का निर्धारण करते हैं। वे सभी आरएनए जैवनेसिस रास्ते में भाग लेते हैं और विशेष रूप से मैसेंजर आरएनए (एमआरएनए) के पोस्ट ट्रांसक्रिप्शनल जीन विनियमन (पीटीआरआर) में योगदान करते हैं। पिछले कुछ सालों में, खमीर और स्तनधारी सेल लाइनों से कई एमआरएनए-बाध्य प्रोटीओम को "एमआरएनए इंटरैक्टिम कैप्चर" नामक एक उपन्यास विधि के उपयोग से सफलतापूर्वक अलग किया गया है, जो एमआरएनए बाध्यकारी प्रोटीन (एमआरबीपी) की पहचान के लिए अनुमति देता है सीधे एक शारीरिक पर्यावरण से विधि ओलिगो (डीटी) मोती द्वारा विवो अल्ट्रावियोलेट (यूवी) क्रॉस लिंकींग, पुल डाउन और मैसेंजर रिबन्यूक्लोप्रोटीन कॉम्प्लेक्स (एमआरएनपी) की शुद्धि में बनायी गयी है, और मास स्पेक्ट्रोमेट्री (एमएस) द्वारा क्रॉस्लेन्क्क्ड प्रोटीन की बाद की पहचान। बहुत हाल ही में, एक ही विधि लागू करने से, कई पौधे एमआरएनए-बाध्य प्रोट्योम को विभिन्न अरबिडोप्सिस ऊतक स्रोतों से एक साथ सूचित किया गया है: एटिलाटेड रोपाई, पत्ती के ऊतक,पत्ती मेसोफिल प्रोटॉप्लेट्स, और सुसंस्कृत रूट कोशिकाएं। यहां, हम अरबीडोपिस थेलियाना पत्ती मेसोफिल प्रोटॉप्लेट्स के लिए अनुकूलित मॉरेनेट इंटरैक्टिम कैप्चर विधि पेश करते हैं, एक सेल प्रकार जो प्रयोगों के लिए बहुमुखी उपकरण के रूप में कार्य करता है जिसमें विभिन्न सेलुलर एशेज शामिल हैं। इष्टतम प्रोटीन उपज के लिए स्थितियों में ऊतक शुरू करने की मात्रा और यूवी विकिरण की अवधि शामिल है। एक माध्यम-स्तरीय प्रयोग (10 7 कोशिकाओं) से प्राप्त एमआरएनए-बाध्य प्रोटीम में, आरबीपी ने आरएनए बाध्यकारी क्षमता को अधिक से अधिक प्रतिनिधित्व किया है, और कई उपन्यास आरबीपी की पहचान की गई थी। प्रयोग को बढ़ाया जा सकता है (10 9 कोशिका), और पौधों में एमआरएनए-बाध्य प्रोटीयोम को मोटे तौर पर अलग, कैटलॉग और तुलना करने के लिए अन्य पौधों के प्रकार और प्रजातियों के लिए अनुकूलित विधि लागू की जा सकती है।

Introduction

सेलुलर जैविक प्रक्रियाओं को बनाए रखने के लिए यूकेरियोट्स कई आरएनए जैवनेसिस नियामक रास्ते का उपयोग करते हैं। ज्ञात प्रकार के आरएनए में, एमआरएनए बहुत विविधतापूर्ण है और प्रोटीन की कोडिंग क्षमता और उनके आईसोफॉर्म 1 को लेता है। पीटीजीआर मार्ग पूर्व-एमआरएनए 2 , 3 के भाग्य को निर्देशित करता है। विभिन्न जीन परिवारों के आरबीपी आरएनए के नियमन को नियंत्रित करते हैं, और पीटीआरआर में, प्रत्यक्ष एमआरबीपीएस गाइड एमआरएनए प्रत्यक्ष शारीरिक बातचीत के माध्यम से, कार्यात्मक एमआरएनपी बनाने इसलिए, की पहचान करने और mRBPs की विशेषताओं और उनके mRNPs पिछले तीन दशकों .over सेलुलर mRNA चयापचय 2 के नियमन को समझने के लिए महत्वपूर्ण है, विभिन्न इन विट्रो तरीकों - आरएनए electrophoretic गतिशीलता पारी (REMSA) assays, घातीय संवर्धन संसाधनों द्वारा लाइगैंडों के व्यवस्थित विकास सहित (SELEX) लाइब्रेरी-व्युत्पन्न संरचनाओं, आरएनए बाइंड-एन-सैक (आरबीएनएस), रेडियोलैलेब्ड या मात्रात्मक पर आधारितप्रतिदीप्ति आरएनए बाध्यकारी assays, एक्सरे क्रिस्टलोग्राफी, और एनएमआर स्पेक्ट्रोस्कोपी 4 , 5 , 6 , 7 , 8 , 9 - आरबीपी के अध्ययन के लिए व्यापक रूप से लागू किया गया है, मुख्य रूप से स्तनधारी कोशिकाओं से। स्तनधारी आरबीपी के इन अध्ययनों के परिणाम आरएनए बाध्यकारी प्रोटीन डाटाबेस (आरबीपीडीबी) के माध्यम से खोजा जा सकते हैं, जो प्रकाशित टिप्पणियों 10 इकट्ठा करता है

हालांकि इन इन विट्रो तरीकों में शक्तिशाली उपकरण हैं, वे अनुक्रमों के दिए गए आरएनए पूल से बाध्य आरएनए प्रारूपों का निर्धारण करते हैं और इसलिए उन्हें नए लक्ष्य आरएनए को खोजने की क्षमता में सीमित हैं। जीनोम चौड़ा आरबीपी की भविष्यवाणी करने के लिए कम्प्यूटेशनल रणनीतियों के लिए भी यही सच है, जो प्रोटीन अनुक्रम और संरचना 15 के संरक्षण पर आधारित हैं। इस पर काबू पाने के लिए, एक नया प्रयोगात्मक विधि हास्थापित किया गया है जो कि आरएनए के रूपांकनों की पहचान के लिए अनुमति देता है, जो कि आरबीपी की दिलचस्पी के साथ संपर्क करता है, साथ ही बाध्यकारी के सटीक स्थान के निर्धारण के लिए। "क्रॉसलिंकिंग एंड इम्युनोपेरेग्रेशन" (CLIP) नामक इस विधि को विवो यूवी क्रॉस्लिंकिंग में शामिल किया गया है, जिसके बाद इम्यूनोपेरेग्रेशन 11 प्रारंभिक अध्ययनों से पता चला है कि डीएनए और आरएनए न्यूक्लियोटाइड्स का फोटो एक्टिवेशन 245 एनएम से अधिक उत्तेजना यूवी तरंग दैर्ध्य पर हो सकता है। थिइमिडीन के माध्यम से प्रतिक्रिया को पसंद किया जा रहा है (कमी हुई फोटोरैक्टिविटी के क्रम में: डीटी ≥ डीसी> आरयू> आरसी, डीए, डीजी) 12 254 एनएम (यूवी-सी) की तरंग दैर्ध्य के साथ यूवी प्रकाश का उपयोग करना, यह पाया गया कि आरएनए न्यूक्लियोटाइड्स और प्रोटीन अवशेषों के बीच सहसंयोजक बंधन बनते हैं, जब केवल कुछ अंगस्ट्रम्स (ए) की सीमा में। इस घटना को आरएनए और आरबीपी की "शून्य-लंबाई" क्रॉस्लिंकिंग कहा जाता है। यह एक कड़े शुद्धि प्रक्रिया द्वारा पीछा किया जा सकता है थोड़ा पृष्ठभूमि 13 , 14 के साथ सावधान।

CLB के लिए पूरक एक रणनीति आरबीपी के परिदृश्य का वर्णन करने के लिए प्रोटीन की पहचान के साथ विवो यूवी क्रॉटलिंकिंग में संयोजित है। इस तरह के जीनोम चौड़ा एमआरएनए-बाध्य प्रोटीओम्स को खमीर कोशिकाओं, भ्रूण स्टेम कोशिकाओं (ईएससी) और मानव कोशिका लाइनों ( यानी, हेके 2 9 3 और हेला) से इस उपन्यास प्रयोगात्मक दृष्टिकोण का उपयोग किया गया है, जिसे "एमआरएनए इंटरैक्टिम कैप्चर" कहा जाता है , 18 , 19 , 20 , 21 विधि vivo यूवी crosslinking में एमआरएनपी शुद्धि और एमएस आधारित प्रोटिओमिक्स के बाद से बना है। इस रणनीति को लागू करने से, कई उपन्यास "चाँदनीकरण" वाले आरबीपी जिनमें गैर-कैनोनिकल आरबीडी शामिल हैं, और यह स्पष्ट हो गया है कि अधिक प्रोटीन को आरएएन-बाध्यकारी क्षमता में पहले से माना जाता है"> 15 , 16 , 17. इस पद्धति का उपयोग आरबीपी की जांच करते समय नए अनुप्रयोगों और नए जैविक सवालों के जवाब देने की क्षमता के लिए देता है। उदाहरण के लिए, हाल ही के एक अध्ययन में एमआरएनए-बाईड प्रोटेम (कोर आरबीपी प्रोटीम) खमीर और मानव कोशिकाओं के बीच 22

संयंत्र आरबीपी पहले से ही विकास और विकास ( जैसे , फूलों के समय के बाद ट्रांसक्रिप्शनल नियमन में, सर्कडियन घड़ी, और मिटोकोंड्रिया और क्लोरोप्लास्ट में जीन की अभिव्यक्ति) में शामिल पाया गया है 24 , 25 , 26 , 27 , 28 , 29 । इसके अलावा, वे सेल्युलर प्रक्रियाओं में अबायटीक तनाव ( जैसे, ठंड, सूखा, साललिता, और फरसीक एसिड (एबीए)) 31 , 32 , 33 , 34 आरएएनए मान्यता मोटीफ (आरआरएम) और के समरूपता (केएच) डोमेन अनुक्रम रूपांकनों पर आधारित अरबीडॉप्सिस थेलियाना जीनोम में 200 से अधिक पूर्वानुमानित आरबीपी जीन हैं; चावल में, लगभग 250 को नोट किया गया 35 , 36 यह उल्लेखनीय है कि कई भविष्यवाणियां आरबीपी पौधों के लिए अद्वितीय लगती हैं ( उदाहरण के लिए आरआरएम डोमेन वाले 50% पूर्वानुमानित अरबिडोप्सिस आरबीपी के लिए मेटाजोन ऑर्थोलॉजीज नहीं) 35 , यह सुझाव देते हुए कि कई नए फ़ंक्शन बना सकते हैं सबसे अनुमानित आरबीपी के कार्यों में 23 वर्णों का अभाव है।

अरबीपोप्सिस से युक्त बीआरएनए-बाध्य प्रोटीओमों का अलगाव, पर्ण ऊतक, सुसंस्कृत जड़ कोशिकाओं, और पत्ती मेसोफिल प्रोटॉप्लेट्स के उपयोग के माध्यम सेएमआरएनए इंटरैक्टिम कैप्चर हाल ही में 38 , 39 की सूचना मिली है। ये अध्ययन निकट भविष्य में पौधों में कार्यात्मक आरबीपी व्यवस्थित रूप से सूचीबद्ध करने की मजबूत क्षमता का प्रदर्शन करते हैं। यहां, हम पौधे के प्रोटॉप्लेट्स से एमआरएनए इंटरैक्टिम कैप्चर के लिए एक प्रोटोकॉल पेश करते हैं ( यानी सेल की दीवारों के बिना कोशिकाएं)। अरबिडोप्सिस थलियाना लीफ मेसोफिल प्रोटॉप्लेट्स लीफ सेल का मुख्य प्रकार है। पृथक प्रोटॉप्लास्ट्स कोशिकाओं को यूवी प्रकाश की इष्टतम पहुंच प्रदान करते हैं। इस सेल प्रकार का उपयोग एनासन में किया जा सकता है जो कि क्रियाशील लक्षण वर्णन 40 , 41 के लिए ट्रांजिस्टर प्रोटीन व्यक्त करता है। इसके अलावा, कई अन्य वनस्पति कोशिका प्रकारों और प्रजातियों 42 , 43 , 44 ( उदाहरण के लिए, पीटरसन एट अल ।, 200 9, बर्गमैन और बिरनबाम, 2010 और हांग एट अल ।, 2012) के लिए प्रोटोप्पन लागू किया गया है।

<P वर्ग = "jove_content"> इस पद्धति में कुल 11 चरणों ( चित्रा 1 ए ) शामिल हैं। अरबिडोप्सिस लीफ मेसोफिल प्रोटॉप्लेट्स पहले पृथक (चरण 1) हैं और बाद में यूवी को क्रॉस्लेन्क्ड एमआरएनपी (चरण 2) बनाने के लिए विकिरण किया गया है। जब प्रोटोप्लास्ट्स को झुकाने वाली स्थिति (चरण 3) के तहत लिपिक किया जाता है, तो क्रॉस्लेन्क्क्ड एमआरएनपी को लिसन / बाइंडिंग बफर में रिलीज़ किया जाता है और ओलिगो-डी (टी) 25 मोती (चरण 4) से नीचे खींच लिया जाता है। कठोर washes के कई दौर के बाद, एमआरएनपी शुद्ध कर रहे हैं और आगे का विश्लेषण किया। एमआरबीपी के विकृत पेप्टाइड्स को प्रोटीनेस के द्वारा पचाने से पहले क्रॉर्लिंक किए गए एमआरएनए शुद्ध होते हैं और आरआरए की गुणवत्ता QRT-PCR (चरण 5 और 6) द्वारा सत्यापित की जाती है। आरएनज उपचार और प्रोटीन एकाग्रता (चरण 7) के बाद, प्रोटीन की गुणवत्ता को एसडीएस पॉलीएक्लाइमाइड जेल वैद्युतोसोरिसिस (एसडीएस पृष्ठ) और चांदी की धुंधला (चरण 8) द्वारा नियंत्रित किया जाता है। प्रोटीन बैंड पैटर्न में अंतर आसानी से एक क्रॉस-लिंक्ड नमूना (सीएल) और एक गैर-क्रॉस्लेन्क्स्क्ड नमूना (गैर-सीएल;प्रोटॉप्लेट्स से नकारात्मक नियंत्रण नमूना जो कि यूवी विकिरण के अधीन नहीं है)। प्रोटीन की पहचान एमएस आधारित प्रोटिओमिक्स के माध्यम से प्राप्त की जाती है। सीएल के नमूने से प्रोटीन एक-आयामी polyacrylamide जेल वैद्युतकणसंचलन (1 डी पृष्ठ) से संभव पृष्ठभूमि प्रदूषण को दूर करने के लिए अलग-अलग पेप्टाइड्स में ट्रिप्सिन का उपयोग कर "इन-जेल पचास्ट" होते हैं, और शुद्ध (चरण 9) हैं। माइन स्पेक्ट्रोमेट्री (नैनो-एलसी-एमएस) के साथ मिलकर नैनो रिवर्स-चरण तरल क्रोमैटोग्राफी, एमआरएनए-बाईड प्रोटीम (चरण 10) में निश्चित प्रोटीन की मात्रा के निर्धारण के लिए अनुमति देता है। अंत में, पहचान की गई एमआरबीपी को जैवइन्फोर्मेटिक विश्लेषण (चरण 11) का उपयोग करके वर्णित किया गया है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. अरबिडोप्सिस लीफ मेसोफिल प्रोप्लेस्टास्ट अलगाव

नोट: एयूबीडोपिस लीफ मेसोफिल प्रोटेप्लास्ट्स मूल रूप से अलग हैं जैसा कि यू एट अल ।, 2007 द्वारा वर्णित है, कई संशोधनों के साथ 40

  1. पौधों की वृद्धि
    1. स्टरलाइज़ेशन के लिए अंधेरे में लगभग 2 3 डिग्री सेल्सियस 4 डिग्री सेल्सियस के लिए निष्फल पानी में लगभग 200 अरबिडोप्सिस थलियाना कर्नल- 0 पारिस्थितिकी बीज लीजिये।
      नोट: यह संख्या एक गैर-सीएल नमूना और एक सीएल नमूना के लिए पर्याप्त है (चरण 1.3 देखें)।
    2. मिट्टी और वर्मीकुलिट के 50% ( वी / वी ) मिश्रण के साथ बर्तन तैयार करें और मिट्टी को गीला करने के लिए एक ट्रे में डिस्टिल्ड वॉटर के साथ बर्तन को सोखें।
    3. गीली मिट्टी पर स्तरीकृत बीज बोना और वितरित करें अतिरिक्त मिट्टी के साथ बीज को कवर न करें, क्योंकि अरबीडोपिस बीज की अंकुरण के लिए प्रकाश की आवश्यकता होती है।
      नोट: पौधों की वृद्धि की स्थिति 23 डिग्री सेल्सियस पर 12 घंटे का प्रकाश / 12-एच अंधेरे चक्र है,फूलों से पहले 5 सप्ताह के लिए विकास कमरे में 100 μmol एम -2 एस -1 की हल्की तीव्रता के साथ। 4-हफ्ते के पुराने पौधों को भी 40 का इस्तेमाल किया जा सकता है।
      नोट: चरण 1.2.1 से चरण 3.2.3 में सभी वर्णित सामग्रियों और अभिकर्मकों दो नमूने के लिए हैं ( यानी, एक गैर-सीएल नमूना (नियंत्रण नमूना जो कि यूवी-सी विकिरण के अधीन नहीं है) और एक सीएल नमूना (अनुसंधान नमूना जो यूवी-सी विकिरण के अधीन है))।
  2. आइसोटोनिक एंजाइम समाधान की तैयारी
    1. 80 एमएल का प्राथमिक आइसोटोनिक एंजाइम समाधान (400 एमएम मैनिनटोल, 20 एमएम केएलएल और 20 एमएम एमईएस बफर (पीएच 5.7)) करें और तुरंत 10 मिनट के लिए 60 डिग्री सेल्सियस इनक्यूबेटर में समाधान गरम करें
    2. गर्म प्राथमिक आइसोटोनेट एंजाइम समाधान के लिए 1.2 ग्राम सेल्युलस आर 10 ( w / v 1.5%) और 0.32 ग्राम मैकरोजीम R10 ( w / v 0.4%) पाउडर जोड़ें।
    3. कोमल सरगर्मी को लागू करने से समाधान में एंजाइम पाउडर को ध्यान से ले आओ। खटखटानाजब तक कि एंजाइम समाधान स्पष्ट हल्का भूरा नहीं है, 10 मिनट के लिए एक 60 डिग्री सेल्सियस इनक्यूबेटर में हलचल आंतों को गर्म कर दें
    4. 3 मिनट के लिए बर्फ पर समाधान शांत करें और समाधान के लिए 800 μL का 1 एम CaCl 2 और 800 μL 10% ( w / v ) बीएसए जोड़ें।
    5. एक 0.22-माइक्रोन फिल्टर के माध्यम से pipetting और फ़िल्टरिंग द्वारा समाधान homogenize। दो बड़े पैमाने पर पेट्री डिश (150 मिमी x 20 मिमी) में इस अंतिम आइसोटोनेट एंजाइम समाधान को विभाजित करना।
  3. अरबडॉप्सिस रोसेट पत्ती स्ट्रिप्स की तैयारी
    नोट: प्रत्येक पेट्री डिश के लिए 150 पत्ते एक गैर सीएल नमूने या एक सीएल नमूने के लिए सिफारिश की है।
    1. चुनें और कटौती 300 के कुल पूरी तरह से विस्तृत 2 - या 3 -pair सच पत्तियों (औसत: 3 - 4 रोसेट के अनुसार) 0.5- 1-मिमी पत्ती स्ट्रिप्स में एक नया और तेज razorblade का उपयोग कर।
    2. आइसोटोनिक एंजाइम समाधान में तुरंत स्ट्रिप्स को डुबोएं और डुबकी।
      नोट: प्रकाश के साथ किसी भी संपर्क से बचने के लिए, हमेशा टी कवर करेंवह एल्यूमीनियम पन्नी के साथ पेट्री डिश पत्तियों को कुचलने न दें पुष्टि करें कि सभी स्ट्रिप्स समाधान में डूबे हुए हैं और सतह पर तैर नहीं रहे हैं।
  4. अरबिडोप्सिस लीफ मेसोफिल प्रोटॉप्लेट्स का अलगाव
    1. वैक्यूम desiccators में एल्यूमीनियम पन्नी से ढके पेट्री डिश रखें और 30 मिनट के लिए वैक्यूम के तहत पत्ती स्ट्रिप्स में घुसपैठ करें। इसके बाद, कमरे के तापमान पर 2.5 घंटे के लिए मिलाकर बिना अंधेरे में पेट्री डिश व्यंजन करें।
    2. हल्के और संक्षिप्त रूप से हाथों से क्षैतिज रूप से व्यंजन को हिलाएं, पूरी तरह से एंजाइम समाधान में प्रोटॉप्लेट्स को छोड़ने का प्रयास करते हैं।
  5. फसल काटने वाले और प्रोटोप्लास्ट्स की गिनती
    1. एक 35 से 75 सुक्ष्ममापी नायलॉन जाल के माध्यम से प्रोटॉस्टिस्ट निलंबन को फ़िल्टर करें। प्रत्येक नमूना का छानना दो 50 एमएल गोल-नीचे ट्यूबों (प्रत्येक ट्यूब में लगभग 20 एमएल का छानना) में विभाजित करना।
    2. W5 बफर के 10 एमएल के साथ प्रत्येक पेट्री डिश को कुल्ला (154 मिमी NaCl, 125 मिमी CaCl
    3. सभी चार ट्यूबों को 5 मिनट के लिए 100 xg पर गोली मारो, प्रोटोटास्ट्स गोली। सतह पर तैरनेवाला त्यागें और धीरे-धीरे प्रत्येक ट्यूब में प्रोटोप्लास्ट छल्ले को 10 एमएल का डब्लूआर 5 बफर के साथ रीसस्पेंड करें।
      नोट: जब प्रोटोप्लास्ट छल्लों को रिसाव करते हैं, धीरे-धीरे ट्यूब को उल्टा उल्टा कर दें और धीरे-धीरे ट्यूब को हाथ से स्पिन करें जब तक छर्रों में गायब नहीं हो जाते। कोशिकाओं को हानि करने से बचने के लिए गोली को सीधे पिपेट नहीं करें।
    4. चरण 1.5.3 को एक बार दोहराएं और प्रत्येक नमूने के दो ट्यूबों से प्रोटॉस्टिस्ट निलंबन को एक 50-एमएल गोल-नीचे ट्यूब में जोड़ दें। बर्फ पर ट्यूब रखें
    5. एक हेमोसिटामीटर का उपयोग करके प्रोटॉप्लास्ट्स की गणना करें
      नोट: 25 cubes के भीतर प्रत्येक 20 कोशिकाओं के बराबर 2 x 10 5 प्रोटॉप्लेट / एमएल। 150 पत्तियों से लगभग 1 x 10 7 कोशिका उत्पन्न होनी चाहिए।गैर-सीएल और सीएल नमूनों में एक समान कुल संख्या वाले प्रोटॉप्लेट रखने के लिए मॉड्यूल करें।
    6. 30 मिनट के लिए प्रोटोप्लास्ट्स बर्फ पर रखें बाद में, ट्यूबों को 100 मिनट में 5 मिनट के लिए स्पिन करें सतह पर तैरनेवाला को त्यागें और 20 मिलीलीटर एमएमजी समाधान (400 मिमी मैनिटोल, 15 मिमी एमजीसीएल 2 , और 4 एमएम एमईएस बफर (पीएच 5.7)) के साथ प्रत्येक ट्यूब में प्रोटॉप्लास्ट्स को फिर से खोलें।

2. विवो में एमआरएनए-प्रोटीन क्रॉटलिंकिंग यूवी इररायडिएशन द्वारा

नोट: बर्फ पर गैर सीएल नमूना ट्यूब रखें सीएल नमूना तुरंत यूवी विकिरणित होना चाहिए।

  1. सीएल नमूना ट्यूब से 1 x 10 7 कोशिकाओं वाले एक बड़े बड़े पैमाने पर पेट्री डिश (150 मिमी x 20 मिमी) वाले प्रोटॉस्टिस्ट निलंबन को स्थानांतरित करें और प्लेट सतह को कवर करने के लिए 30 एमएल का बर्फ-ठंडा MMG समाधान जोड़ें। कोमल pipetting द्वारा पूरे MMg बफर में कोशिकाओं फैलाओ। तुरंत एक यूवी क्रॉस्लिंकिंग उपकरण में शीर्ष कवर के बिना पेट्री डिश रखें।
    नोट: यूवी दीपक के बीच की ऊंचाईऔर पेट्री डिश 8 सेमी है
  2. 1 मिनट, 3 मिनट, या 5 मिनट के लिए 254 एनएम तरंगदैर्ध्य यूवी प्रकाश और 0.00875 डब्लू / सेमी 2 यूवी की तीव्रता के साथ नमूना इर्रियानेट करें। विकिरण के बाद, दो नए 50 एमएल गोल-नीचे ट्यूबों में प्रोटोप्लास्ट निलंबन को तेजी से विभाजित करते हैं। प्लेट के बाकी हिस्सों को इकट्ठा करने और इन दो ट्यूबों में इस सेल निलंबन को जोड़ने के लिए अतिरिक्त 5 एमएल बर्फ-ठंडा एमएमजी समाधान के साथ डिश के नीचे धो लें।
    नोट: 1 मिनट इष्टतम स्थिति के रूप में चुना गया था। स्पष्टीकरण प्रतिनिधि परिणाम में पाया जा सकता है

3. निस्संदेह स्थितियों के तहत प्रोप्लास्टल लासिस

  1. विश्लेषण के लिए प्रोटोप्लास्ट छर्रों की तैयारी
    1. गैर सीएल नमूना ट्यूब दो सीएल नमूना ट्यूबों के साथ चरण 2 से 100 मिनट में 5 मिनट के लिए स्पिन करें और सतह पर तैरनेवाला त्यागें। बर्फ पर गैर-सीएल नमूना प्रोटोकैस्ट गोली की ट्यूब रखें।
    2. प्रत्येक सीएल नमूना ट्यूब, जनरल के लिए 10 मिलीलीटर बर्फ-ठंडा MMg समाधान जोड़ेंछर्रों को पुन: resuspend, और उन्हें एक 50 एमएल गोल नीचे ट्यूब में वापस गठबंधन। 5 मिनट के लिए 100 ग्राम पर ट्यूब स्पिन करें सतह पर तैरनेवाला हटाने के बाद, बर्फ पर सीएल नमूना ट्यूब प्रोटोप्लास्ट गोली रखो।
  2. प्रोप्लास्टाइट लेसिस और होमोजनाइजिंग प्रोटॉस्टास्ट लाइसेट
    1. 9 मिलीलीटर बर्फ-कोल्ड लेसिस / बाइंडिंग बफर (500 मिमी लीक, 0.5% ( डब्लू / वी ) लिथियम डोडेकिल सल्फेट (लीडीएस), 5 मिमी डीथियोथरेथोल (डीटीटी), 20 एमएम ट्राइस-एचसीएल (पीएच 7.5), और 1 एमएम प्रत्येक नमूना के सेल गोली को EDTA (पीएच 8.0)। निलंबन समरूप रूप से हल्का हरा होने तक लगभग 20 गुना तक pipetting और नीचे द्वारा प्रोटोप्लैस्ट्स को लगभग बोलें।
    2. होमोजिनायझेशन के लिए एक संकीर्ण सुई (0.9 x 25 मिमी 2 ) के साथ एक 50-एमएल ग्लास सिरिंज के माध्यम से प्रोटोप्लास्ट lysate दो बार पास करें। 10 मिनट के लिए बर्फ पर lysate सेते हैं तरल नाइट्रोजन में lysates रुकें और -80 डिग्री सेल्सियस पर स्टोर करने के लिए 3 सप्ताह तक।

4. एमआरएनपी पुल डाउन और शुद्धिओलिगो-डी (टी) 25 माला द्वारा

नोट: सभी निम्नलिखित वर्णित सामग्री और अभिकर्मक, चरण 4.1 से चरण 4.4 तक, केवल एक नमूने के लिए हैं ( यानी, एक गैर-सीएल नमूना या एक सीएल नमूना)। मुकाबला सतह पर तैरनेवाला तंत्र / बाध्यकारी बफर को हटा दिए जाने के बाद मोती युक्त ट्यूबों के लिए प्रोटोप्लास्ट लाइसेेट को तुरंत जोड़ा जाना चाहिए।

  1. ओलिगो-डी (टी) ओलिगो (डीटी) कैप्चर के लिए 25 चुंबकीय मोती तैयार करना
    1. कमरे के तापमान पर जमे हुए प्रोटोप्लास्ट lysate पिघलना जब lysate पूरी तरह से thawed है, बर्फ पर lysate की ट्यूब रखें।
    2. बर्फ पर 6 नए 2-एमएल गोल-नीचे माइक्रोसेंट्रीफ़्यूज ट्यूबों में ओलिगो-डी (टी) 25 चुंबकीय मोती (5 मिलीग्राम / एमएल) की विभाज्य 1.8 एमएल। प्रत्येक ट्यूब में, धीरे-धीरे pipetting ऊपर और नीचे और धीरे से 4 मिनट के लिए 2 मिनट के लिए घूर्णन द्वारा 600 μL lysis / बंधन बफर के साथ homogenously मनका निलंबन धो। बर्फ पर मोती रखो
  2. बाध्यकारी
    1. जगहमोती युक्त सभी 6 ट्यूब 4 डिग्री सेल्सियस पर एक चुंबकीय रैक में 3 मिनट के लिए, जिसके परिणामस्वरूप मोती के चुंबकीय कैप्चर और निलंबन के समाशोधन के परिणामस्वरूप।
      नोट: जब ट्यूबों को चुंबकीय रैक में रखा जाता है, तब तक प्रतीक्षा करें जब तक मोती पूरी तरह से कब्जा नहीं हो जाती, कम से कम 3 मिनट तक।
    2. सतह पर तैरनेवाला त्यागें और इन 6 ट्यूबों में 9 एमएल का प्रोटॉस्टास्ट लाइसेडेट तुरंत भाग लें। जब तक एक सजातीय भूरे निलंबन प्रकट नहीं होता है तब तक pipetting द्वारा अच्छी तरह से मिलाएं और नरम रोटेशन लागू करके 1 घंटे के लिए 4 डिग्री सेल्सियस पर प्रोटॉस्टास्ट lysate में मोती सेते हैं।
      नोट: 30 मिनट से 1 घंटे तक ऊष्मायन समय की सिफारिश की जाती है।
  3. धुलाई
    1. ट्यूबों को वापस 4 डिग्री सेल्सियस पर 3 मिनट के लिए चुंबकीय रैक में रखें। जब सभी मोतियों को ट्यूबों के किनारे पर कब्जा कर लिया जाता है, तो प्रॉपोपैस्ट लाइसेैट को 6 नए 2-एमएल गोल-नीचे माइक्रोसेंटिफ़्यूज ट्यूबों में जमा करें और अस्थायी रूप से उन्हें 4 डिग्री सेल्सियस पर संग्रहीत करें तत्काल प्रोटॉस्टास्ट lysate त्याग नहीं करते; Lysate रखो4 डिग्री सेल्सियस पर
    2. 1.5 मिलीलीटर बर्फ-ठंडा धो बफर 1 (500 मिमी लीक, 0.1% (वाय / वी ) लीड्स, 5 मिमी डीटीटी, 20 मिमी त्रि-एचसीएल (पीएच 7.5), और 1 एमएम ईडीटीए (पीएच 8.0)) मोतियों को जोड़ें प्रत्येक ट्यूब में मोती को फिर से खोलें और 1 मिनट के लिए सौम्य रोटेशन लागू करें। ट्यूबों को वापस चुंबकीय रैक में 4 डिग्री सेल्सियस पर 3 मिनट के लिए रखें और सतह पर तैरनेवाला को त्याग दें। एक बार धो धो बफर के साथ इस धोने चरण दोहराएँ।
    3. 1.5 मिलीलीटर बर्फ-ठंडे धो बफर 2 (500 मिमी लीक, 5 मिमी डीटीटी, 20 मिमी त्रि-एचसीएल (पीएच 7.5), और 1 एमएम ईडीटीए (पीएच 8.0) का उपयोग करते हुए दो बार इस धोने के कदम की दोहराई दोहराएं और एक बार 1.5 मिलीलीटर बर्फ-ठंडा कम नमक बफर (200 मिमी लीकिल, 20 मिमी त्रि-एचसीएल (पीएच 7.5), और 1 एमएम ईडीटीए (पीएच 8.0))।
      नोट: यदि एमआरएनपी प्रोटोप्लास्ट lysate से कुशलता से अलग हो गए हैं, तो वॉशिंग बफर 2 ( चित्रा 1 बी ) के साथ धोने के चरण के दौरान सीएल नमूने में मनका गोली के चारों ओर दिखाई देने वाला "प्रभामंडल" होना चाहिए।
  4. क्षालन
    1. 500 μL जोड़ेंएल्यूशन बफर (20 मिमी त्रि-एचसीएल (पीएच 7.5) और 1 एमएम ईडीटीए (पीएच 8.0) प्रत्येक ट्यूब में मोती के लिए। धीरे से मोतियों को फिर से खोलें और 50 डिग्री सेल्सियस पर 3 मिनट के लिए पाली (ए) -छोटे आरएनए जारी करने के लिए सेते हैं। धीरे-धीरे पिपेट करने से एक बार मोतियों को पुन: resuspend। ट्यूबों को वापस चुंबकीय रैक में 4 डिग्री सेल्सियस पर 5 मिनट तक रखें।
    2. बर्फ पर एक स्वच्छ, बाँझ आरएनज मुक्त, 15 एमएल शंक्वाकार-नीचे ट्यूब के लिए सभी एल्यून्ट (कुल में लगभग 3 एमएल) को ट्रांसफर और गठबंधन करें।
      नोट: आरएनए की गुणवत्ता और मात्रा तुरंत एक स्पेक्ट्रोफोटोमीटर डिवाइस का उपयोग करके निर्धारित किया जा सकता है
      नोट: प्रत्येक नमूना का आरएनए एकाग्रता लगभग 10 एनजी / μ एल है, जिसमें 260 / 280 अनुपात 1.9 है। 260 / 280 अनुपात 1.6 और 2.0 के बीच होना चाहिए क्योंकि पृथक पाली (ए) -छोटे आरएनए आमतौर पर 70% से अधिक शुद्ध होते हैं। यदि आरएनए एकाग्रता बहुत कम है, तो अधिकतम 10 9 में प्रोटॉप्लेट शुरू करने की संख्या में वृद्धि। नमूनेतरल नाइट्रोजन में जमे हुए और लंबी अवधि के भंडारण के लिए 80 डिग्री सेल्सियस पर रखा जा सकता है।
    3. एक अतिरिक्त दो राउंड के लिए चरण 4.4 से चरण 4.4 को दोहराएं और प्रोटोटालेस्ट लयसेट से पॉली (ए) वाली आरएनए को खत्म करने के लिए ओलिगो-डी (टी) 25 मोती का पुन: उपयोग करें।
      नोट: पुल-डाउन प्रक्रिया के तीन राउंड के बाद, प्रत्येक गैर-सीएल या सीएल नमूने के लिए 9 एमएल की कुल एवलियंट होनी चाहिए। आरएनए की गिरावट से बचने के लिए 4 डिग्री सेल्सियस पर सभी काम करें। मोती का पुन: उपयोग या पुनर्जन्म करने के लिए चरण 4.5 या चरण 4.6 का पालन करें।
  5. फिर से इस्तेमाल किया ओलिगो-डी (टी) 25 मोतियों की तैयारी
    1. मोती को 1 मिलीलीटर बर्फ-ठंडी अलगाव बफर और दो बार 1 मिलीलीटर बर्फ-ठंडे lysis / बंधन बफर के साथ धो लें ताकि नमक लीक की एकाग्रता को 500 मिमी में समायोजित कर लें।
    2. चरण 4.1 का पालन करें, सतह पर तैरनेवाला को त्यागें, प्रत्येक ट्यूब में संग्रहीत प्रोटोप्लास्ट lysate को स्थानांतरित करें, और एक अतिरिक्त दो राउंड के लिए चरण 4.2 से चरण 4.4 तक पूरी प्रक्रिया को दोहराएं।
  6. 25 मोतियों का पुनर्जन्म
    नोट: मोती को एक और प्रयोग के लिए इस्तेमाल किया जा सकता है (अधिकतम पुन: उपयोग तीन बार होता है)
    1. चरण 4.4 का पालन करें, 1 एमएल का 0.1 एम NaOH मोती को जोड़ें, और 5 मिनट के लिए कमरे के तापमान पर घूर्णन करके सेते हैं। प्रत्येक ट्यूब के लिए, दो बार 1 एमएल धो धो बफर 1 और तीन बार 1x पीबीएस (पीएच 7.4) के साथ 0.1% ट्विल -20 संतुलन के लिए धो लें। प्रत्येक ट्यूब से 300 μL बाँझ आरएनज मुक्त 1x पीबीएस (पीएच 7.4) में मढ़ा रखें जिसमें 0.1% ट्विन -20 में 4 डिग्री सेल्सियस लंबी अवधि के भंडारण के लिए होता है।
      नोट: इस प्रयोग में अरबीडॉप्सिस सीएल नमूनों के लिए इस्तेमाल की जाने वाली मोती का उपयोग अगली बार उसी पौधे के नमूने के लिए किया जा सकता है।

5. प्रोटीनस के उपचार और एमआरएनए शुद्धि

  1. प्रोटीनसे के उपचार
    1. यूवी-क्रोसलिंकित प्रोटीन को पचाने के लिए प्रत्येक नमूना से 1 एमएल के प्रोटीनसे के समाधान (8 ग्राम / μL) के 8 μL जोड़ें। बीआरIefly भंवर
  2. एमआरएनए शुद्धि
    1. 1 घंटे के लिए 37 डिग्री सेल्सियस पर एवल्यूट सेते हैं। अवशिष्ट दूषितों को हटाने के लिए आरएनए शुद्धि किट का प्रयोग करके आरएनए को शुद्ध करना।
      नोट: शुद्धिकरण के बाद, आरएएनए आरआरए गुणवत्ता परीक्षण के लिए तैयार हैं जो qRT-PCR परख का उपयोग करते हैं।
      नोट: अन्य किट, जैसे कि आरएनए मिनी किट और ट्राइज़ोल अभिकर्मक, 14 भी इस्तेमाल किया जा सकता है।

6. qRT-PCR परख

  1. रिवर्स प्रतिलेखन
    1. रिवर्स ट्रांसक्रिप्शन सिस्टम का इस्तेमाल करते हुए प्रथम-भूग्रस्त सीडीएनए के कुशल संश्लेषण को प्राप्त करें, साथ ही टेम्पलेट के रूप में 1 माइक्रोग्राम आरएनए के साथ। नमूना को 5 एनजी / μ एल को न्युकले-फ्री पानी के साथ डालना
  2. क्यूआरटी-पीसीआर का उपयोग सीडीएनए मात्रा का ठहराव
    1. क्यूपीसीआर मास्टर मिक्स और वास्तविक समय पीसीआर साइक्लर का इस्तेमाल करते हुए सीडीएनए को बढ़ाएं और टेम्पलेट के रूप में 10 एनजी सीडीएनए के साथ। निम्न पीसीआर प्रोग्राम का प्रयोग करें: 10 मिनट के लिए 95 डिग्री सेल्सियस(चरण 1, एक चक्र) और 95 डिग्री सेल्सियस के लिए 15 सेकंड्स और 60 डिग्री सेल्सियस के लिए 1 मिनट (चरण 2, 40 चक्र)।
      नोट: यहां इस्तेमाल किया जाने वाला संदर्भ जीन एक अंतर्जात आंतरिक नियंत्रण जीन, यूबीक्यू 10 (एटी 4G05320) था। यूबीक्यू 10 और 18 एस आरआरएनए के लिए क्यूआरटी -पीसीआर प्राइमर्स ली एट अल ।, 2014 और डुरुत एट अल । 2014 में क्रमशः 45 , 46 , में वर्णित थे। प्राइमर अनुक्रम सामग्री तालिका में सूचीबद्ध हैं।

7. आरएनस उपचार और एमआरबीपी एकाग्रता

  1. आरएनज उपचार
    1. लगभग 100 यू आरएनएज़ कॉकटेल में आरएनसी ए और आरएनज़ टी 1 युक्त 8 एमएल एल्यूएन्ट जोड़ें। आरएनएज़ कॉकटेल के साथ एक नकारात्मक-नियंत्रण नमूना शामिल करें जिसमें एल्यून्ट की जगह nuclease-free पानी है। संक्षेप में भंवर और 1 घंटे के लिए 37 डिग्री सेल्सियस पर सेते हैं।
  2. एमआरबीपी एकाग्रता
    1. आरएनसी पाचन के बाद, एल्यूनेट यूज़िन पर ध्यान केंद्रित करेंजी केन्द्रापसारक फिल्टर इकाइयों एकाग्रता के बाद प्रत्येक नमूने के लगभग 2 माइक्रोग्राम की कुल प्रोटीन उपज के साथ, अंत मात्रा 75 μL है। लंबी अवधि के भंडारण के लिए -80 डिग्री सेल्सियस पर नमूने रखें।

8. एसडीएस पेज और रजत स्टीनिंग

  1. एसडीएस-पृष्ठ
    1. 15 μL 2x लदान डाई के साथ केंद्रित इन्ट्यूअंट (सीएल नमूना) या नियंत्रण नमूना (गैर सीएल नमूना) के 25 μL मिलाएं। 5 मिनट के लिए 95 डिग्री सेल्सियस पर नमूना गरम करें और इसे एसडीएस-पेज जेल पर 5% स्टैकिंग जेल युक्त और एक प्रोटीन मार्कर सहित 12% जेल को हल करें।
    2. लोड हो रही डाई के हल करने वाले जेल के अंत तक पहुंचने तक लगभग 1 घंटे के लिए 60 वी के लिए 60 वी पर प्रोटीन को कंडेन और 160 वी पर अलग रखें।
  2. चांदी-धुंधला परख
    1. एसडीएस-पेज जेल को हर बार 5 मिनट के लिए अतिपरवलर पानी में दो बार धो लें। एक वाणिज्यिक चांदी दाग ​​किट का उपयोग कर प्रोटीनों के चांदी के धुंधले प्रदर्शन करें।
      नोट: प्रोटीन बैंड को 5 मिनट के भीतर दिखाया जाना चाहिए यदि बैंड 5 मिनट से ज्यादा हल्के रंग के साथ दिखाई दे रहे हैं, तो यह अधिकतम 10 9 तक प्रोटॉप्लेट शुरू करने की संख्या में वृद्धि करने का सुझाव दिया गया है।

9. प्रोटीन बैंड और पेप्टाइड शुद्धि के ट्रिप्सिन डायजेस्ट

  1. ट्रिप्सिन डाइजेस्ट
    नोट: एमआरबीपी पहचान के लिए प्रत्येक नमूना से एक और 25 μL केंद्रित एमआरबीपी समाधान लेने के द्वारा दूसरा 1 डी पृष्ठ जेल चलाएं; चांदी के दाग वाले जैल का उपयोग नहीं किया जा सकता क्योंकि वे एमएस विश्लेषण के साथ संगत नहीं हैं।
    1. 1 डी-पेज जेल को चलाने के बाद, 1 घंटे के लिए फिक्सेशन सोल्यूशन (50% ( वी / वी ) मेथनॉल और 10% ( वी / वी ) एसिटिक एसिड) में जेल को ठीक करें। कोमल चिंब के साथ 20 मिनट के लिए दाग समाधान (0.1% ( डब्ल्यू / वी ) कॉमेस्सी ब्रिलियंट ब्लू आर-250, 50% ( वी / वी ) मेथनॉल, और 10% ( वी / वी ) एसिटिक एसिड) में जेल दाग़ें। डिस्टिन समाधान में जेल को नष्ट (40% ( वी / वी ) मेथनॉल और 10% ( वी/ वी) एसिटिक एसिड 1 घंटे के लिए नष्ट होने के बाद, 5% ( v / v ) एसिटिक एसिड में जेल रखें।
      नोट: जब तक पूरी तरह से पृष्ठभूमि पूरी तरह से नष्ट नहीं हो जाती, नष्ट होने के दौरान, नई डिस्टिन समाधान को बदला जा सकता है
    2. जेल के बाहर ब्याज के बैंड को काटें। अगले इष्टतम ट्रिप्सिन पाचन और पेप्टाइड्स के निष्कर्षण के लिए लगभग 1 मिमी 3 के टुकड़ों में आगे बैंड को काटें। 10 मिनट के लिए 50 मील अमोनियम बाइकार्बोनेट (एनएच 4 एचसीओ 3 ) के साथ जेल के टुकड़े को हाइड्रेट करें। जेल के टुकड़े पूरी तरह से कवर करें
      1. हाइड्रेटिंग समाधान को ध्यान से निकालें और 10 मिनट के लिए एसीटोनिट्रिले (सीएच 3 सीएन) के साथ जेल के टुकड़े को निर्जलीकृत करें एसिटोनिट्रियल समाधान को ध्यान से हटा दें
      2. हाइड्रेशन से निर्जलीकरण को दो बार दोहराएं। अंत में, एसीटोनिट्रियल समाधान निकालें।
        नोट: जेल चलाने का समय प्रयोग के उद्देश्य पर निर्भर करता है। एक लंबे समय से चलने वाले समय से प्रोटीन का एक अच्छा पृथक्करण हो सकता है, इसलिए दागयुक्त जेल प्रतिबंधडीएस का विश्लेषण आगे के लिए किया जा सकता है। यदि इसका उद्देश्य प्रोटीन रखने और प्रदूषण को दूर करने के लिए है, तो शॉर्ट रन का समय पर्याप्त है।
    3. 500 एमएल का 6.6 एमएम डीटीटी समाधान जोड़ें और 10 मिनट के लिए जेल के टुकड़े निकाल दें। डीटीटी समाधान निकालें और 500 μL की 95% ( वी / वी ) एसिटोनिट्रियल समाधान के साथ दो बार जेल टुकड़े धो लें।
      1. धोने के बाद, एसिटोनिट्रियल समाधान को निकालें और 500 मील का 55 एमएम आयोडोएसेटिक एसिड (आईएए) समाधान के साथ 10 मिनट के लिए अंधेरे में जेल के टुकड़े निकाल दें।
      2. ऊष्मायन के बाद, समाधान को हटा दें और जेल के टुकड़े को फिर से 500 μL 95% ( वी / वी ) एसिटोनिट्रियल समाधान के साथ धो लें। जेल के टुकड़े सूखी
    4. जेल के टुकड़े पूरी तरह से 25 μL पाचन बफर (50 मिमी एनएच 4 एचसीओ 3 , 5 एमएम CaCl 2 , और 6 एनजी / μ एल ट्रिप्सिन) के साथ एम्बेड करें और बर्फ में 45 मिनट के लिए जेल में तरल पदार्थ को पारित करने दें। जेल के टुकड़े को रात भर 37 डिग्री सेल्सियस तक सेते हैं ज़ैमायाक पाचन
  2. पेप्टाइड शुद्धि
    1. ट्रिपेटिक पेप्टाइड निकालने के लिए बार-बार पाचन बफर और भंवर में 80 एमएल एनएम 4 एचसीओ 3 को जेल टुकड़ों में जोड़ें। निकालें लीजिए इस निष्कर्षण को दोहराएं 50% ( वी / वी ) सीएच 3 सीएन और 5% ( वी / वी ) फार्मिक एसिड (एफए) के 80 μL के साथ दो बार दोहराएं।
      नोट: कुल अंतिम अर्क लगभग 240 μL होना चाहिए।
    2. पूल और अर्क को लगभग 10 μL में वैक्यूम एकाग्रता या लाइओफिलाइजेशन द्वारा ध्यान केंद्रित करें और 25 μL का 0.1% ( वी / वी ) जलीय त्रिफालोरोसिटिक एसिड (टीएफए) समाधान जोड़ें। निर्माता के प्रोटोकॉल के बाद, μ-C18 कॉलम के साथ नमूनों को उतारा।
    3. 4 - 10 μL 60% ( डब्ल्यू / वी ) सीएच 3 सीएन और 0.1% ( वी / वी ) एफए के साथ पेप्टाइड्स को नमस्कार करें। Lyophilize (फ्रीज-सूखी) पेप्टाइड्स और उन्हें -20 डिग्री सेल्सियस तक विश्लेषण तक विश्लेषण करें।
शीर्षक "> 10। नैनो-एलसी-एमएस

  1. नैनो रिवर्स-चरण तरल क्रोमैटोग्राफी
    नोट: एक द्रव्य क्रोमैटोग्राफी साधन के साथ ऑनलाइन-युग्मित एक द्रव्यमान स्पेक्ट्रोमीटर के साथ एलसी-एमएस विश्लेषण करें। इस उपकरण को सी 18 कॉलम (2 माइक्रोन कण, 100 ए पायरे आकार और 50 माइक्रोन x 15 सेमी आयाम में) से सुसज्जित किया जाना चाहिए।
    1. समाधान के 16 μL (2% ( वी / वी ) सीएच 3 सीएन और 0.1% ( वी / वी ) एफए) में लैओफिलाइज्ड पेप्टाइड्स को फिर से खोलें। सी 18 प्रील्यूम (3 माइक्रोन कण आकार, 100 ए पोर आकार, नैनोवापर, और आयाम में 75 माइक्रोन एक्स 2 सेमी) पर 5 μL / मिनट की प्रवाह दर पर पेप्टाइड समाधान के 5 μL को इंजेक्ट और लोड करें।
    2. 10.1.2। 300 एनएल / मिनट की प्रवाह दर के साथ 95-मिनट की ढाल का इस्तेमाल पेप्टाइड्स को अलग करें इस पृथक्करण ढाल के दौरान, क्रमशः 5 मिनट, 50 मिनट और 18 मिनट में मोबाइल चरण बी को 4% से 10%, 10% से 25% और 25% से 45% तक बढ़ाएं। अंत में, 1 मिनट में मोबाइल चरण बी से 95% बढ़ोतरी बादप्रत्येक 95 मिनट की पृथक्करण ढाल, एक अंतर्निहित कुल्ला चरण जिसमें 10 मिनट की ढाल होती है, 5 मिनट में 4% से 95% तक लागू होती है।
      नोट: मोबाइल चरण ए 99.9% एच 2 ओ और 0.1% ( वी / वी ) एफए है, और मोबाइल चरण बी 19.9 2 % एच 2 ओ, 80% ( डब्ल्यू / वी ) सीएच 3 सीएन और 0.08% ( वी / वी) है। ) एफए
  2. मास स्पेक्ट्रोमेट्री परख
    1. मास स्पेक्ट्रोमीटर को डेटा-आश्रित मोड में बड़े पैमाने पर 400 से 1,600 एम / जेड के साथ संचालित करें।
    2. विखंडन स्पेक्ट्रा उत्पन्न करने के लिए एमएस 1 में सबसे तीव्र आयनों में से दस तक का चयन करें एमएस 1 के लिए 70,000 पूर्ण चौड़ाई और एमएस 2 के लिए 17,000 के लिए आधे से अधिक अधिकतम (एफडब्ल्यूएचएम) सेट करें, 3,000,000 और 1,000,000 आयनों के स्वचालित अधिगम नियंत्रण (एजीसी) के लक्ष्य के साथ और 256 के अधिकतम आयन इंजेक्शन समय (आईटी) और एमएस 1 के लिए 64 एमएस और एमएस 2 क्रमशः।
    3. सबसे प्रचुर मात्रा में आयनों के दोहराए हुए विखंडन से बचने के लिए गतिशील बहिष्करण को 10 एस तक सेट करें।
      नोट: यहां, एक या छह से अधिक शुल्क वाले आयन ई हैंMS2 के लिए जोड़ा गया
  3. गुणात्मक प्रोटिओमिक्स: पेप्टाइड और प्रोटीन की पहचान
    1. पीकस्क स्टूडियो सॉफ़्टवेयर 47 , 48 , 49 जैसी सॉफ्टवेयर के उपयोग से फ्रैक्मेंटेशन स्पेक्ट्रा का विश्लेषण करें।
      नोट: अन्य सॉफ़्टवेयर पैकेज पैप्टाइड की पहचान के लिए भी उपलब्ध हैं, जैसे नोवोएचएमएम 30 और पेनोनोवो 37 डे नोवो अनुक्रमण के लिए और एसईक्ववे 54 और मैस्कॉट 55 डेटाबेस खोज के लिए।
    2. समान द्रव्यमान (<2 पीपीएम अंतर) और प्रतिधारण के समय (<2 मिनट) के साथ स्पेक्ट्रा को जोड़ना और मॉडल को निर्धारित वर्गीकरण के लिए स्विस-प्रोटोटाट डाटाबेस (संस्करण: दिसंबर 2013) की खोज के लिए 0.65 से अधिक की गुणवत्ता सीमा के साथ स्पेक्ट्रा को बरकरार रखना प्लांट अरबिडोप्सिस थलियाना निम्न खोज मापदंडों का उपयोग करें: मोन के उपयोग के माध्यम से 10 पीपीएम की पूर्ववर्ती जन सहिष्णुताओसोटोपिक जन; एक टुकड़ा बड़े पैमाने पर सहिष्णुता 20 मिमी; पाचन एंजाइम के रूप में ट्रिप्सिन, जिसमें अधिकतम 2 मिलावटी दरार हैं; सिस्टीन कारबैमिडोमैथिलैक्शन को निश्चित संशोधन के रूप में; मेथियोनीन ऑक्सीकरण चर संशोधन के रूप में; और अधिकतम पेप्टाइड प्रति 3 अनुवादित परिवर्तनों के बाद अधिकतम। पहचान के बाद, विश्वसनीय पेप्टाइड और प्रोटीन की पहचान के लिए स्कोर थ्रेशोल्ड मैन्युअल रूप से सेट करें ताकि एक गलत खोज दर (एफडीआर) <5% अधिग्रहण कर लिया गया हो।
  4. मात्रात्मक प्रोटिओमिक्स: जन स्पेक्ट्रोमेट्री डेटा का सांख्यिकीय विश्लेषण
    1. प्रोटिओमिक्स डेटा के लेबल मुक्त मात्रा के लिए एलसी-एमएस ( जैसे प्रजनन) का प्रयोग करें।
      नोट: एमएस 1 पेप्टाइड पीक क्षेत्रों (या तीव्रता) स्टूडियो सॉफ्टवेयर द्वारा उनके द्रव्यमान के अनुसार पहचाने गए पेप्टाइड्स से जुड़े होते हैं, जिसमें अधिकतम 10 पीपीएम में सहनित त्रुटि होती है।
      नोट: यह सॉफ्टवेयर 2 <के बीच सभी चार्ज राज्यों के चोटी क्षेत्रों को एकीकृत करके पेप्टाइड की बहुतायत की गणना करता हैSup> + और 8 + मात्रात्मक डेटा पीयाज़ पेप्टाइड पहचान से इनहाउस स्क्रिप्ट (अधिकतम 10 पीपीएम में सहनित त्रुटि से मेल खाती है) से जुड़ा हुआ है।
    2. प्रत्येक पेप्टाइड के लिए औसत लॉग 2-गुना परिवर्तन (सीएल / गैर-सीएल) की गणना करें प्रोटीन द्वारा अद्वितीय पेप्टाइड्स के गुना परिवर्तन का समूह बनाएं।
      नोट: प्रत्येक समूह में, एक प्रोटीन का अंतिम रूप-परिवर्तन उसके पेप्टाइड्स के औसत गुना-परिवर्तन के बराबर है।
    3. सांख्यिकीय महत्व का मूल्यांकन करने के लिए प्रत्येक समूह के लिए छात्र की टी- टेस्ट का उपयोग करके पी-मान की गणना करें। बेंजामिनि-होचबर्ग (बीएच) पद्धति का उपयोग करके सभी समूहों के एफडीआर के लिए पी-मान को सही करने के लिए आर सॉफ़्टवेयर पैकेज (संस्करण 3.3.0) लागू करें।
    4. आर सॉफ़्टवेयर पैकेज (संस्करण 3.3.0) के साथ संगत "कैलिब्रेट" फ़ंक्शन पैकेज (संस्करण 1.7.2) का उपयोग करते हुए ज्वालामुखी की साजिश को खींचें।
      नोट: यहां, -log10-adjusted p-values ​​(-log10 (adj। P-value)) सभी पहचाने गए प्रोटीनों के लॉग 2-गुना परिवर्तन का एक कार्य है। प्रोटीन हैंएमआरएनए-बाध्य प्रोटीम में सकारात्मक हिट के रूप में माना जाता है यदि उनके लॉग 2-गुना परिवर्तन 2 से अधिक, महत्व के साथ या बिना।

11. पहचानित एमआरएनए-बाध्य प्रोटोमी के कैटलॉग

  1. जीन ओनटोलॉजी (जीओ) डेटाबेस के माध्यम से और "परिवार और डोमेन" इंटरप्रो डेटाबेस के माध्यम से "आणविक कार्य और जैविक प्रक्रिया" के मदों के आधार पर चरण 10 में पहचाने जाने वाले प्रोटीन को तीन श्रेणियों में वर्गीकृत करें
  2. श्रेणी I, या "रिबोसोमल प्रोटीन" के रूप में, सभी पहचाने वाले रियोबोसोमल प्रोटीन होते हैं, श्रेणी II के प्रोटीन को परिभाषित करते हैं, या "मेन आरबीपी," एनोटेटेड प्रोटीन डोमेन के रूप में परिभाषित करते हैं, जो कि आरएनए के साथ संपर्क करते हैं या आरएनए जीव विज्ञान में ज्ञात या अज्ञात कार्यों से बाध्यकारी आरएनए ।
  3. एनोटेट किए गए आरएनए बाध्यकारी डोमेन के बिना आरएनए जीव में ज्ञात या अज्ञात कार्यों वाले प्रोटीन को श्रेणी III में रखा गया है, या "उम्मीदवार आरबीपी", श्रेणी III से एंजाइमों को INtEnz डेटाबेस

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

हमने एक विशेषता हेलो, जो कि सैल नमूने में मनका गोली से चारों ओर, वॉश बफर 2 ( चित्रा 1 बी ) के साथ धोने के चरण 4.3 में देखा। यद्यपि इसकी जांच नहीं हुई है, इस घटना को संभवतः चुंबकीय कैप्चर के दौरान मनका एकत्रीकरण के साथ क्रोसलिंक किए गए एमआरएनपी परिसरों के हस्तक्षेप से समझाया जा सकता है, जिसके कारण फार्म का एक अधिक फैलाव फैलाव हो सकता है। यह इंगित करता है कि ओलिगो-डी (टी) 25 बीड कैप्चर 14 प्रभावी था।

गैर-सीएल नियंत्रण और सीएल दोनों नमूनों में 18 एस आरआरएनए की तुलना में काफी अधिक UBQ10 संदर्भ एमआरएनए स्तर चित्रा 1 सी में दिखाए गए हैं। यह इंगित करता है कि mRNAs को एलिगो-डी (टी) 25 मोतियों द्वारा कैप्चर की वजह से समृद्ध किया जाता है, जो केवल पाली (ए) से युक्त एमआरएनए से जुड़ा हो सकता है। ओलिगो-डी (टी) 25 बीड कैप्चर की दक्षता आगे के आधार पर थीएसडीएस पृष्ठ और चांदी के धुंधला (चरण 8) द्वारा लगाया गया, जैसा कि आरएनएस उपचार और एमआरबीपी एकाग्रता (चरण 7) के बाद चित्र 1 डी में दिखाया गया है। गैर-सीएल नियंत्रण और सीएल नमूना लेन के बीच प्रोटीन बैंड पैटर्न में अंतर स्पष्ट रूप से देखा जा सकता है, और गैर-सीएल नियंत्रण नमूना लेन में उपस्थित प्रोटीन बैंड आरएनसी की उपस्थिति से समझाया जा सकता है। यह सीएल नमूने में एमआरबीपी के मजबूत संवर्धन को दर्शाता है।

यूवी विकिरण की समय अवधि को बदलकर क्रॉस-लिंकिंग की दक्षता को नियंत्रित किया जा सकता है। पर्याप्त क्रॉटलिंकिंग लेकिन प्रोटोप्लास्ट क्षति और आरएनए डिग्रेडेशन से बचाव इष्टतम है। चित्रा -1 डी में , विभिन्न यूवी विकिरण समय (1, 3, और 5 मिनट) की तुलना करते हुए सभी सीएल नमूनों में विशिष्ट प्रोटीन बैंड पैटर्न प्राप्त किए गए थे। एक ही यूवी तीव्रता (0.00875 डब्लू / सेंटीमीटर 2 ) के तहत, सबसे अनुकूलतम स्थितियों को 1 या 3 मिनट पाया गया, कारण अप्रभेद्यप्रोटीन बैंड तीव्रता कमजोर बैंड की तीव्रता को लंबे समय तक क्रॉस्लिंकिंग समय (5 मिनट) के साथ मनाया गया था। हम 1 मिनट को इष्टतम स्थिति के रूप में मानते हैं क्योंकि क्रॉसलिंकिंग की एक छोटी अवधि में पेट्री डिश से आसान स्थानांतरण और प्रोटॉप्लेट्स के संग्रह का अतिरिक्त लाभ होता है। यूपी विकिरण के दौरान पेट्रो डिश के निचले भाग में प्रोप्लाज्स्ट्स तेजी से उपजी हो सकते हैं क्योंकि वे पकवान के नीचे छड़ी करते हैं। इससे यूवी विकिरण की अवधि के बाद ट्यूबों को इकट्ठा और स्थानांतरित करना अधिक मुश्किल हो जाता है।

अनुकूल परिस्थितियों के आधार पर, तीन जैविक प्रतिकृतियों के प्रोटीन की पहचान बाद में गुणात्मक और मात्रात्मक प्रोटिओमिक्स द्वारा हासिल की गई, जिसे 9 और 10 के चरणों में वर्णित किया गया। गुणात्मक प्रोटिओमिक्स ( चित्रा -1 ई , दाएं) के विश्लेषण में, कुल 341 प्रोटीन सीएल नमूनों में पहचाने गए थे, जिनमें से 36 गैर-सीएल नियंत्रण में दोनों पाए गए थेडी सीएल नमूने, और गैर-सीएल नियंत्रण नमूने में केवल 8 प्रोटीन का पता लगाया गया था। दोनों नमूनों के बीच पहचानित प्रोटीन संख्याओं में यह बहुत बड़ा अंतर अलग-अलग प्रोटीन बैंड पैटर्न ( चित्रा 1 डी ) के अनुरूप है, इस विचार का समर्थन करते हुए कि एसडीएस पृष्ठ और चांदी-धुंधला परख oligo-d (टी) की दक्षता को मान्य करने के लिए अच्छे उपकरण हैं 25 मनका कब्जा मात्रात्मक प्रोटिओमिक्स ( चित्रा 1 ई , बाएं) के विश्लेषण में, कुल 325 प्रोटीन (नीले और हरे रंग के) ने 2 से अधिक लॉग 2-गुना परिवर्तन दिखाया है। इन प्रोटीनों में से 100 प्रोटीन (नीले रंग के) को छोटे पी -महत्व स्तर से ऊपर के स्तर इसलिए, उन्हें सकारात्मक हिट के रूप में भी परिभाषित किया गया था। यह उल्लेखनीय है कि अन्य 225 प्रोटीन (हरे रंग के रंग) का पी-वैल्यू 0.05 से अधिक है, डेटा स्पर्सिया के कारण महत्व के स्तर के नीचे। दूसरे शब्दों में, पेप्टाइड तीव्रता की उच्च परिवर्तनशीलता के साथ, प्रत्येक प्रोटीन के लिए कम प्रचुर मात्रा में पेप्टाइड्स मौजूद थेतों। हालांकि, क्योंकि उनमें से सभी गुणात्मक रूप से केवल सीएल नमूनों में पाए गए, उन्हें सकारात्मक माना जाता था

जीओ और इंटरप्रो डाटाबेस 50 (चरण 11) के आधार पर, इन 325 प्रोटीनों को श्रेणी 1 (राइबोसोमल प्रोटीन), श्रेणी II (मुख्य आरबीपी) और श्रेणी III (उम्मीदवार आरबीपी) ( चित्रा 1 एफ ) में वर्गीकृत किया गया था। वर्ग I में 123 राइबोसोमल प्रोटीन थे, जबकि श्रेणी II में, 70 एनोटेट किए गए शास्त्रीय आरबीपी को मनाया गया। ये दो श्रेणियां- जिनमें अधिकांश एनोटेटेड प्रोटीन शामिल हैं, आणविक आरएनए बाइंडिंग और आरएनए जीवविज्ञान ( चित्रा 1 एफ , दाएं) से जुड़े हैं और जो पूरे एमआरएनए-बाउंड प्रोटीम के लगभग 38% और 22% पर कब्जा करते हैं, क्रमशः अनुकूलित एमआरएनए इंटरएक्टॉम की उच्च दक्षता दर्शाते हैं कब्जा। पारंपरिक आरबीडी की कमी के कारण पिछले 40% (132 उम्मीदवार आरबीपी) श्रेणी III में वर्गीकृत किए गए थे। इसके अलावा, वें के अधिकांशआरएनए बाध्यकारी और आरएनए जैविक प्रक्रियाओं में ईआईआर भूमिकाएं मान्य नहीं हैं ( चित्रा 1 एफ , बाएं)। हम मानते हैं कि इस श्रेणी के प्रोटीन आरएनए नियमों में उपन्यास कार्यों को प्रकट कर सकते हैं।

आकृति 1
चित्रा 1: फ्लोचार्ट और अरबिडोप्सिस लीफ मेसोफिल प्रोप्लास्ट्स से एमआरएनए-बाध्य प्रोटोमी की खोज के लिए अनुकूलित पद्धति के परिणाम। ( ) पूरे विधि के प्रमुख कदम 1 से 11 तक सूचीबद्ध किए जाते हैं। चित्रकारी सेलुलर और आणविक प्रक्रियाओं को तस्वीर और कार्टून द्वारा सचित्र किया गया है। प्रत्येक चरण का विवरण प्रोटोकॉल में तीव्रता से वर्णित किया गया है। ( बी ) सीएल नमूना में मोती गोली के आस-पास एक प्रभामंडल देखा गया था, लेकिन गैर-सीएल नियंत्रण नमूने में, धोने के चरण 4.3 के दौरान। ( सी ) रिश्तेदार UBQ10 एमआरएनए और 18 एस आरआरएनए लेव की तुलनागैर-सीएल नियंत्रण में एलएस और qRT-PCR द्वारा सीएल नमूनों (मूल्यों का अर्थ है ± एसडी (एन = 3); * और **: पी <0.05 और <0.01) के साथ महत्वपूर्ण अंतर। ( डी ) 1, 3, और 5 मिनट के लिए निरंतर-तरंग यूवी स्रोत द्वारा विकिरणित सीएल नमूनों की तुलना में 0.00875 डब्लू / सेंटीमीटर 2 पर यूवी तीव्रता के साथ तुलना में गैर-सीएल नियंत्रण नमूने के साथ केंद्रित सीएनटी नियंत्रण नमूना ( ) प्रोटिओमिक्स द्वारा एमआरएनए-बाध्य प्रोटीम की पहचान प्रोजेनेसिस सॉफ्टवेयर पैकेज (बाएं) द्वारा किए गए मात्रात्मक प्रोटिओमिक्स में, ज्वालामुखी की साजिश में औसत लॉग 2-गुना परिवर्तन (सीएल / गैर-सीएल) और संबंधित समायोजित पी-मान (-log10 (adj। P-values)) प्रदर्शित करता है सभी प्रोटीन शिखर सॉफ्टवेयर पैकेज (दाएं) द्वारा किए गए गुणात्मक प्रोटिओमिक्स में, नमूनों में प्रोटीन वेन आरेख में दिखाए गए हैं। प्रोटीन की मात्रा संख्याओं में सूचीबद्ध है। पेप्टाइड और प्रोटीन स्तर पर एफडीआर 5% से नीचे है। प्रकाश-भूरा फ़्रेम के अंदर प्रोटीन की संख्या को सकारात्मक हिट माना जाता है। ( एट अल । 2016 से संशोधित किए गए थे। कृपया इस आंकड़े के एक बड़े संस्करण को देखने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

हमने सफलतापूर्वक एमआरएनए इंटरैक्टिम कैप्चर को लागू किया, जो कि खमीर और मानव कोशिकाओं के लिए विकसित किया गया था, पौधे पत्ती मेसोफिल प्रोटॉप्लेट्स। लीफ मेसोफिल कोशिका पौधे के पत्तों में प्रमुख प्रकार के ऊतक हैं। इस पद्धति का प्रमुख लाभ यह है कि यह एक शारीरिक वातावरण से प्रोटीन को खोजने के लिए विवो क्रॉस्लिंकिंग में उपयोग करता है।

इस प्रोटोकॉल में, हम मुख्य रूप से कई उपयुक्त प्रयोगात्मक स्थितियों ( जैसे, प्रारंभिक सामग्री और यूवी विकिरण की अवधि के रूप में उपयोग करने के लिए प्रोटोटालेस की संख्या) प्रस्तुत करते हैं 50 सीएल के नमूनों में कैप्चर किए गए प्रोटीन केवल एसडीएस-पेज और चांदी के धुंधला द्वारा पहचाने जा सकते हैं जब न्यूनतम 10 7 प्रोटॉप्लेट्स (मध्यम स्तर) का उपयोग किया जाता है (चरण 1.5.5)। कम सांद्रता एसडीएस पृष्ठ पर एक अवलोकनत्मक एमआरबीपी पैटर्न नहीं उत्पन्न करते हैं और संभवतः प्रोटीमिक्स द्वारा आगे के विश्लेषण के लिए उपयोग नहीं किया जाना चाहिए। दरअसल, 10 से अधिक 7 कोशिकाओं का उपयोग करना ( जैसे, 10 9 मेंएक बड़े पैमाने पर प्रयोग) 20 भी संभव है चांदी के धुंधले assays से परिणाम बताते हैं कि एक मिनट के लिए 1 मिनट के साथ यूवी विकिरण 0.00875 डब्ल्यू / सेमी तीव्रता के 2 एक सतत-लहर यूवी स्रोत द्वारा उत्पन्न इष्टतम ( चित्रा 1 डी ) है। महत्वपूर्ण कदम पर उच्च दक्षता ( यानी, ओलिगो-डी (टी) 25 मोती, चरण 4 द्वारा एमआरएनपी पुल-डाउन और शुद्धि) आरटी-क्यूपीसीआर, रजत-धुंधला हो जाना, और एमएस एसेल्स ( चित्रा -1 सी ; 1 डी और 1 ई , दाएं) गुणात्मक और मात्रात्मक प्रोटिओमिक्स का संयोजन गैर-सीएल नियंत्रण और सीएल नमूनों ( चित्रा 1 ई ) के बीच ओवरलैप क्षेत्र में सकारात्मक आरबीपी की पहचान करने में मदद कर सकता है। अधिकांश प्रोटीन पहचान किए गए आरबीपी पहले डेटासेट्स ( चित्रा 1 एफ ) में नहीं थे। हमने उम्मीदवार आरबीपी <के रूप में श्रेणी III में इन पहले अज्ञात आरएनए बाध्यकारी प्रोटीनों को प्रस्तुत कियाSup वर्ग = "xref"> 50 ( चित्रा 1 एफ )। इन उम्मीदवारों की बाध्यकारी विशिष्टताओं की खोज अन्य तरीकों से किया जाना चाहिए, जैसे पहले उल्लेखित CLIP विधि 23 एक उदाहरण है कि एक RBP के बंधन विशिष्टता की जांच क्लिप 51 के उपयोग के माध्यम Arabidopsis में अपनी लक्ष्य mRNA प्रतिलेख को विनियमित करने के झांग में पाया जा सकता एट अल।, 2015 इसके अलावा, PAR-क्लिप से एक वैकल्पिक संशोधित विधि कहा जाता है, photoactivatable- राइबोन्यूक्लियोसाइड-एन्हांस्ड क्रॉटलिंकिंग (पीएआर-सीएल, 365-एनएम यूवी-ए) को पहले खमीर और मानव कोशिकाओं 14 , 23 से एमआरएनए-बाध्य प्रोट्योम की जांच के लिए सिफारिश की गई है। PAR-CL को 4 एसयू की आवश्यकता होती है, जिसे कोशिकाओं द्वारा ले लिया जाता है और आरएनए चयापचय के दौरान नवजात आरएनए में शामिल किया जाता है और यूवी-ए (365-एनएम) इरदी के तहत एमीनो एसिड 52 के साथ सहसंयोजक बांड बनाने में अत्यधिक प्रतिक्रियाशील हो सकता हैसमझना। वर्तमान में, पौध कोशिकाओं के लिए 4 एसयू की विषाक्तता पर ध्यान केंद्रित करने और एमोजेफिल प्रोटियोप्लास्ट 53 में एक्सोजेनस 4 एसयूयू के कुशल तेज पर ध्यान केंद्रित नहीं किया गया है। हालांकि, हमें विश्वास है कि पौधों पर पारंपरिक सीएल (254-एनएम यूवी-सी) और पीएआरसीएल (365 एनएम यूवी-ए) दोनों का उपयोग करना संभव होगा, जो शारीरिक से विभिन्न आरबीपी की खोज और मान्यता में योगदान देगा। भविष्य में पर्यावरण

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

Acknowledgements

हम प्रोफेसर जोरीस वंडरिक्क्स की प्रयोगशाला को स्वीकार करते हैं, जिन्होंने पारंपरिक यूवी दीपक से लैस यूवी क्रॉसलिंकिंग उपकरण प्रदान किया था। केजी ल्यूवेन अनुसंधान फंड द्वारा समर्थित है और एफडब्ल्यूओ अनुदान G065713N से समर्थन स्वीकार करता है।

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics