Generazione di immunoprecipitazione della cromatina nativo sequenziamento librerie per analisi di densità del nucleosoma

Genetics
 

Summary

Vi presentiamo un'immunoprecipitazione della cromatina native modificate sequenziamento (ChIP-seq) metodologia per la generazione di sequenza DataSet adatto per un quadro analitico di densità ChIP-seq nucleosoma integrando l'accessibilità nucleasi di micrococcal (MNase) con misure di modifica dell'istone.

Cite this Article

Copy Citation | Download Citations

Lorzadeh, A., Lopez Gutierrez, R., Jackson, L., Moksa, M., Hirst, M. Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis. J. Vis. Exp. (130), e56085, doi:10.3791/56085 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vi presentiamo un'immunoprecipitazione della cromatina native modificate sequenziamento protocollo sperimentale (ChIP-seq) compatibile con una miscela gaussiana distribuzione basata metodologia di analisi (densità nucleosoma ChIP-seq; ndChIP-seq) che consente la generazione di combinato misure di accessibilità di nucleasi di micrococcal (MNase) con modifica dell'istone genoma. Posizione nucleosome e densità locale e le modifiche post-traduzionali di loro subunità dell'istone, agire di concerto per regolare la trascrizione locale Stati. Combinatoriale misure di accessibilità nucleosome con modifica dell'istone generata da ndChIP-seq consente l'interrogazione simultanea di queste caratteristiche. La metodologia di ndChIP-seq è applicabile ad un piccolo numero di cellule primarie inaccessibili al cross-linking base protocolli di ChIP-seq. Presi insieme, ndChIP-seq consente la misurazione di modifica dell'istone in combinazione con densità nucleosoma locale per ottenere nuove visioni dei meccanismi comuni che regolano la trascrizione del RNA all'interno delle popolazioni cellulari primarie rara.

Introduction

Il genoma eucariotico è confezionato in cromatina via ripetendo strutture nucleosoma che consistono di due copie di quattro proteine istoniche (ad es., H2A, H2B, H3 e H4) circoscritte da 146 paia di basi di DNA1,2. Complessi di rimodellamento della cromatina controllano nucleosoma posizione entro i confini di gene promotore e partecipano alla regolazione dell'espressione genica alterando l'accessibilità del DNA ai fattori di trascrizione e alla RNA polimerasi macchinari3, 4.

Terminale amminica code degli istoni entro il nucleosoma sono sottoposti a varie modificazioni covalenti, tra cui acetilazione, metilazione, fosforilazione, ubiquitilazione, sumoilazione, formilazione e idrossilazione di specifici amminoacidi5 , 6 , 7 , 8. posizioni e gradi di queste modifiche determinano uno stato di cromatina che influenzano l'accesso di controllo e struttura della cromatina dei complessi molecolari che consentono l'attivazione della trascrizione7. Dato che entrambi modifica di densità e istone nucleosoma svolgono un ruolo nel controllo locale della trascrizione genica, abbiamo sviluppato un approccio nativo di ChIP che consente la misurazione simultanea di densità nucleosoma e istone modifica9, 10.

Nativo di ChIP-seq sfrutta la nucleasi di micrococchi endonucleasi (MNase) per digerire la cromatina intatta nel suo stato nativo all'interno del nucleo11,12, una proprietà che è stata sfruttata per mappare il nucleosoma posizionamento13 , 14 , 15. densità nucleosome ChIP-seq (ndChIP-seq) sfrutta la proprietà di accesso preferenziale di MNase per aprire le regioni di cromatina per generare misure che combinano MNase accessibilità con istone modifica10. ndChIP-seq è adatto per la profilatura delle modificazioni istoniche in cellule primarie rare, tessuti e cellule in coltura. Qui, presentiamo un protocollo dettagliato che consente la generazione di sequenza DataSet adatto per un telaio analitico descritto in precedenza opera10 che integra frammento dimensione post immunoprecipitazione, determinato da accoppiato-fine leggere i confini, per contemporaneamente indagare MNase accessibilità con misure di modifica dell'istone. In precedenza, l'applicazione del presente protocollo a 10.000 sangue del cordone ombelicale umano primario derivato CD34+ cellule e cellule staminali embrionali umane hanno rivelato relazioni uniche tra modificazioni della cromatina struttura e istone all'interno di questi tipi10 cellulari . Data la sua capacità di misurare simultaneamente nucleosoma accessibilità e modifica dell'istone, ndChIP-seq è capace di rivelare caratteristiche epigenomic in una popolazione delle cellule a livello di singolo nucleosoma e risoluzione eterogenee firme in loro elementi costitutivi. Un esempio dell'esplorazione di eterogenee popolazioni cellulari di ndChIP-seq è indagine dei promotori bivalenti, dove sia H3K4me3, un marchio di attivo e H3K27me3, un marchio repressivo, sono presenti10.

Protocol

Nota: L'input minimo per questo protocollo è 10.000 cellule per reazione della singola immuno-precipitazione (IP). Stampare il foglio di lavoro sperimentale fornito e utilizzare come guida per pianificare l'esperimento. Dopo incubazione a temperatura ambiente sono presupposti per essere a ~ 22 ° C. Tutte le ricette del buffer sono fornite nella tabella 1. Tutti i buffer deve essere conservati a 4 ° C e tenuti su ghiaccio durante la procedura, se non diversamente specificato.

1. cella preparazione

  1. Cellule in coltura
    1. Lavare le cellule con 1 mL di soluzione salina tampone fosfato (PBS) e determinare con precisione la concentrazione cellulare mediante un emocitometro. Se ci sono più di 1 milione di cellule, aumentare il volume di PBS.
    2. Basato sul conteggio delle cellule, aliquota un equivalente di 70.000-100.000 cellule in una provetta sterile da 1,5 mL e centrifugare a 500 x g per 6 min a 4 ° C. Utilizzando una pipetta, lentamente rimuovere e scartare il surnatante (senza disturbare il pellet cellulare) e risospendere il pellet in tampone di lisi ghiacciata + 1x inibitore di proteasi cocktail (PIC) a una concentrazione di 1.000 cellule / µ l. Miscelare bene pipettando su e giù per 20-30 volte. È fondamentale che i grumi di cellule sono interrotti. Cercate di non creare bolle.
    3. Procedere direttamente al giorno 1 (sezione 2) del protocollo ndChIP-seq o flash congelare il pellet cellulare in azoto liquido e conservare a-80 ° C.
  2. Ordinato le cellule
    1. Raccogliere 70.000-100.000 ordinato16 cellule in una provetta da 1,5 mL con 350 µ l di soluzione salina tamponata di Hank (HBSS), o PBS + 2% siero bovino fetale (FBS).
    2. Rotazione verso il basso ogni cella aliquota a 500 x g per 6 min a 4 ° C. Utilizzando una pipetta, lentamente rimuovere il supernatante (senza disturbare il pellet cellulare) e risospendere in tampone di lisi ghiacciata + 1 x PIC ad una concentrazione finale di 1.000 cellule / µ l. Miscelare bene in tampone di lisi pipettando su e giù 20 - 30 volte. Garantire che i grumi di cellule sono interrotti. Cercate di non creare bolle.
    3. Procedere direttamente al giorno 1 (sezione 2) del protocollo ndChIP-seq, o flash congelare il pellet cellulare in azoto liquido e conservare a-80 ° C.

2. giorno 1: ndChIP-seq

  1. Preparazione del complesso anticorpo-perlina
    1. Preparare un bagno di acqua di 37 ° C e un secchio di ghiaccio. Lavorando sul ghiaccio, preparare 1 tampone di x IP/1 x PIC e 1x tampone di diluizione dell'anticorpo (Ab) e tenerli sul ghiaccio. Recuperare A proteina (o G) biglie magnetiche (Vedi discussione per criteri di selezione) dal deposito di 4 ° C e mescolare molto bene delicato impulso-Vortex. Tenerlo su ghiaccio.
      Nota: Pulse-Vortex significa Vortex è fermato ogni volta che un vortice di completo è formato nel tubo.
    2. Trasferire 24 branelli magnetici µ l di proteina A (o G) per reazione di IP in una nuova provetta da 2 mL. Registrare il volume di perline e tenere il tubo sul ghiaccio. Per esempio, per 7 IPs, utilizzare µ l 24 x 7 = 168 µ l.
    3. Collocare la provetta sul magnete tubo e attendere che la soluzione diventare chiaro indicando perlina separazione. Senza disturbare le perline, con attenzione rimuovere il surnatante con una pipetta e scartare. Prendere il tubo fuori il magnete di tubo e collocarlo sul ghiaccio.
    4. Aggiungere un volume uguale (cioè, volume iniziale di perline) di gelida IP buffer + 1 x PIC mescolare. Mescolare pipettando su e giù. Non centrifugare.
    5. Posizionare il tampone IP + 1 x PIC + perline indietro sul magnete tubo e attendere che la soluzione diventare chiaro indicando perlina separazione. Senza disturbare le perline, con attenzione rimuovere il surnatante con una pipetta e scartare. Ripetere freddo IP buffer + 1 X lavare PIC due volte per un totale di 3 lavaggi.
    6. Dopo il lavaggio finale, risospendere le perle in un volume uguale (cioè, volume iniziale di perline) di gelida IP buffer + 1 x PIC mescolare. Mescolare pipettando su e giù. Non centrifugare. Tenere il tubo sul ghiaccio.
    7. Il ghiaccio, versare 10 mL di buffer IP + PIC in un serbatoio a forma di V di 25 mL. Usando una pipetta multicanale, aggiungere 130 µ l di gelida IP buffer + 1x mix di PIC in singoli pozzetti di un pulito fondo V 96 pozzetti piastra. Riempire un pozzo per IP. Etichettare la piastra come "complesso Ab-tallone".
    8. Aggiungere 12 biglie magnetiche µ l della proteina A lavato (o G) in ciascuna contenente ben IP buffer + PIC e Miscelare pipettando su e giù. Mantenere la lavata di perline restanti sul ghiaccio.
    9. Ottenere anticorpi convalidati dalle loro celle frigorifere e disgelo sul ghiaccio, se necessario. Lavorando sul ghiaccio, diluire gli anticorpi con tampone di diluizione di 1 x Ab alle concentrazioni indicate nella tabella 2.
    10. In ciascun pozzetto della piastra complesso Ab-perlina, aggiungere 1 µ l di anticorpo appropriato, diluito (tabella 1). Registrare il pozzo alla chiave dell'anticorpo. Utilizzando la pipetta multicanale, mescolare ogni riga pipettando su e giù per 20 volte. Cambiare consigli tra le righe. La piastra complesso Ab-tallone molto bene con un coperchio in lamiera alluminio ed incubare a 4 ° C su una piattaforma rotante per almeno 2 h.
      Nota: al termine dell'incubazione può procedere fino al momento di avviare il passaggio 2.4.
  2. Digestione di lisi e cromatina delle cellule
    1. Lavorando sul ghiaccio, preparare il tampone di lisi: 1x + 1 x PIC e 1 mL di MNase ho diluizione buffer (tabella 3) e tenerli sul ghiaccio.
    2. Recuperare il pellet di cellule dal loro deposito di-80 ° C (o da ghiaccio, se preparata). Sciolga ogni pellet cellulare in bagnomaria a 37 ° C per un 10 s, poi trasferimento al ghiaccio.
    3. Ogni pellet cellulare immediatamente aggiungere ghiacciata 1x buffer di lisi + 1 x PIC ad una concentrazione finale di 10.000 cellule/20 µ l e mix 10 volte pipettando su e giù, senza creare bolle. Ad esempio, per 70.000 cellule il volume finale è 140 µ l.
    4. Lavorando sul ghiaccio, aliquota 20 µ l/pozzetto dei lisati risultanti in una piastra a 96 pozzetti. Coprire la piastra con un sigillo di plastica e incubare in ghiaccio per 20 min. etichetta la piastra "MNase digestione" e registrare i pozzi a una chiave del modello. Al fine di garantire un'esatta tempistica per la reazione di digestione della cromatina, non procedere alla digestione con più di 2 righe di campioni alla volta.
    5. Poco prima la lisi di 20 min è completa, diluire il MNase ho enzima con MNase ho diluizione nel buffer, a una concentrazione finale di 20 U / µ l e tenerlo sul ghiaccio.
    6. Lavorando sul ghiaccio, preparare il MNase ho digestione master mix secondo tabella 4 e aliquota 20 µ l della miscela per ogni riga di campioni più 5 µ l di volume morto in una riga di una piastra a 96 pozzetti serbatoio e tenerlo sul ghiaccio. Per le due righe, il volume dovrebbe essere: (20 µ l x 2) + 5 µ l = 45 µ l.
    7. Al termine dell'incubazione i lisati, rimuovere la piastra di digestione di MNase da ghiaccio. Usando una pipetta multicanale, aggiungere 20 µ l di MNase ho digestione master mix in ogni riga di campioni e mescolare 10 volte pipettando su e giù. Cambiare consigli tra le righe. Incubare a temperatura ambiente per esattamente 5 min.
    8. Dopo 5 min, per fermare la reazione, utilizzare una pipetta multicanale per aggiungere 6 µ l di acido di 250 µM etilendiamminotetraacetico (EDTA) in ogni riga di campioni e mescolare su e giù un paio di volte. Cambiare consigli tra le righe. Dopo l'aggiunta di EDTA, cambiare l'impostazione della pipetta a 20 µ l e mix 10 volte pipettando su e giù per assicurare il completo arresto della reazione di digestione. Cambiare consigli tra le righe.
    9. Usando una pipetta multicanale, a ogni riga dei campioni MNase digerito, aggiungere 6 µ l di tampone di lisi e mix: 10x ben pipettando su e giù per 10 volte. Coprire con un sigillo di plastica e incubare in ghiaccio per 15 min.
  3. Pre-compensazione e separazione ingresso
    1. Dopo l'incubazione di 15 min, lavorando su ghiaccio, piscina tutti i pozzetti per lo stesso delle cellule pellet/modello in uno sterile, pre-raffreddati su ghiaccio, provetta da 1,5 mL (pre-etichettata con l'ID del modello) e mescolare accuratamente, ma lentamente utilizzando una pipetta per evitare la formazione di schiuma detergente.
    2. Per ogni pallina/modello di cellulare, trasferire 8 µ l della cromatina digerita in un nuovo sterile, 0,5 mL tubo (pre-etichettata con l'ID del modello) e conservare a 4 ° C durante la notte. Questo servirà come il controllo di input.
    3. Distribuire il rimanente volume della cromatina digerito in 48 aliquote µ l, in una nuova piastra a 96 pozzetti. Pellet/modello di cella 1 entra in pozzi A01-A06, pellet/modello di cella 2 va in pozzi A07-A12, ecc. Registrare i pozzi a una chiave del modello. La targhetta di etichettatura "Pre-clearing".
    4. Usando una pipetta multicanale, aggiungere 120 µ l di tampone di IP 1x + 1 x PIC e 12 µ l di lavato biglie magnetiche di proteina A (o G) in ciascun pozzetto della piastra pre-schiarimento dal punto 2.3.3. Mescolare ogni riga pipettando su e giù per 10 volte. Cambiare consigli tra le righe. La piastra molto bene con un coperchio in lamiera alluminio ed incubare su una piattaforma rotante a 4 ° C per un minimo di 2 h.
  4. Reazione di immunoprecipitazione
    1. Prima di iniziare questo passaggio, assicurarsi che la piastra complessa Ab-perlina (passo 2.1.10) e quella pre-clearing (passo 2.3.4) sono incubate per almeno 2 h. Quick spin entrambe le piastre di centrifugazione per 10 s a 200 x g.
    2. Posizionare la piastra complessa Ab-perlina (dal punto 2.1.10) su una piastra magnetica e aspettare 15 s per la soluzione di diventare chiaro. Rimuovere con cautela e scartare il surnatante con una pipetta senza disturbare le perline. Togliere la piastra dal magnete piatto e tenerlo sul ghiaccio.
    3. Posizionare la piastra di reazione pre-clearing (dal punto 2.3.4) su una piastra magnetica e aspettare 15 s per le perline separare e per la soluzione di diventare chiaro. Senza disturbare le perline, trasferire con cautela il surnatante con una pipetta nei pozzetti corrispondenti di microsfera Ab piastra complesso mantenuto il ghiaccio e mescolare delicatamente 15 volte pipettando su e giù. Guarnizione piastra bene con un alluminio targa copertura e incubare durante la notte (12-18 h) a 4 ° C su una piattaforma rotante. Ri-etichettare la piastra "Reazione di IP".

3. giorno 2: ndCHIP-seq

  1. Lavaggi ed eluizione
    1. Impostare il mixer riscaldamento a 65 ° C. Su ghiaccio, preparare un tampone di lavaggio di basso contenuto di sale e il tampone di lavaggio del alto-sale. Quick spin la piastra di reazione IP dal punto 2.4.3 per 10 s a 200 x g.
    2. Posizionare la piastra di reazione IP su una piastra magnetica e aspettare 15 s per la soluzione di diventare chiaro. Usando una pipetta multicanale, senza disturbare le perline, con attenzione rimuovere e scartare il surnatante. Prendere il piatto fuori la piastra magnetica e posizionarlo sul ghiaccio.
    3. Per ogni riga di campioni nella piastra di reazione di IP, aggiungere 150 µ l di basso contenuto di sale ghiacciata lavare buffer e mescolare lentamente 10 volte su e giù per risospendere completamente le perline.
    4. Posizionare la piastra di reazione IP torna sul magnete piatto, attendere per le perline separare e usando una pipetta multicanale, senza disturbare le perline rimuovere e scartare il surnatante. Riposizionare la piastra sul ghiaccio e ripetere i passaggi da 3.1.3 e 3.1.4 per un totale di 2 lavaggi.
    5. Su ghiaccio, a ogni riga di campioni nella piastra di reazione di IP, aggiungere 150 µ l del sale alto lavare buffer e mescolare lentamente 10 volte pipettando su e giù per risospendere completamente le perline.
    6. Posizionare la piastra di reazione IP torna sul magnete piatto, attendere per le perline separare e usando una pipetta multicanale, senza disturbare le perline rimuovere e scartare il surnatante. Posizionare la piastra di reazione IP su ghiaccio e pre-chill una nuova piastra a 96 pozzetti al lato di esso.
    7. Per ogni riga di campioni nella piastra di reazione di IP, aggiungere 150 µ l del sale alto lavare buffer e mescolare lentamente 10 volte pipettando su e giù per risospendere completamente le perline. Dopo la risospensione, trasferire ogni riga di campioni per la riga corrispondente della piastra nuova, pre-refrigerata, 96 pozzetti. La targhetta di etichettatura "Reazione di IP". Eliminare la vecchia zolla.
    8. Posizionare la nuova piastra di reazione IP sul magnete piatto e attendere per le perline separare. Usando una pipetta multicanale, senza disturbare le perline, con attenzione rimuovere e scartare il surnatante. Tenere la piastra a temperatura ambiente.
    9. Per ogni riga di campioni nella piastra di reazione di IP, aggiungere 30 µ l di tampone di eluizione di ChIP (EB) e mescolare lentamente 10 volte pipettando su e giù. Assicurarsi di evitare la formazione di bolle.
    10. La piastra bene con una cover PCR ed incubare in un mixer di riscaldamento a 65 ° C per 1,5 h con una velocità di miscelazione di 1.350 giri/min.
    11. Dopo 1,5 h di incubazione, rotazione verso il basso la piastra di reazione IP a 200 x g per 1 min a 4 ° C. Modificare l'impostazione del riscaldamento Miscelatore a 50 ° C.
    12. Dopo lo spin, posizionare la piastra di reazione IP su una piastra magnetica e attendere che la soluzione cancellare. Usando una pipetta multicanale, senza disturbare le perline, attentamente trasferire 30 µ l del surnatante in una nuova piastra a 96 pozzetti. Utilizzare punte freschi per ogni riga. La targhetta di etichettatura "Reazione di IP" e tenerlo a temperatura ambiente.
  2. Digestione delle proteine
    1. Recuperare17 (tabella composizione buffer) soluzione al 30% PEG/1 M NaCl Beads magnetiche dal frigorifero 4 ° C e tenerlo a temperatura ambiente per almeno 30 min. critica: garantire che la soluzione della perla completamente raggiunga la temperatura ambiente prima di procedere.
    2. Recuperare campioni di controllo di input da stoccaggio di 4 ° C (punto 2.3.2) e giro veloce. Misurare il volume utilizzando una pipetta e aggiungere acqua ultrapura per ogni controllo di input per un volume finale di 30 µ l. trasferire i campioni di controllo di input ai pozzetti ingresso pre-selezionati (pozzi vuoti) nella piastra di reazione di IP (punto 3.1.12). Registrare il pozzo alla chiave del campione.
    3. Su ghiaccio, è necessario preparare la miscela di proteine digestione Master come mostrato nella tabella 5 e aliquota uguale volume in un'unica riga di una piastra a 96 pozzetti serbatoio.
    4. Usando una pipetta multicanale, a ogni riga di campioni nella piastra di reazione di IP, aggiungere 40 µ l di proteina digestione Master Mix e mescolare lentamente 10 volte su e giù. Sigillare la piastra con una cover PCR, si sono fermati a 200 x g per 1 min e incubare in un mixer di riscaldamento a 50 ° C per 30 min a 650 rpm. Mentre la piastra è in incubazione, preparare fresco 70% di etanolo (EtOH) e tenerlo a temperatura ambiente.
    5. Dopo aver completato l'incubazione di 30 minuti, girare la piastra di reazione IP a 200 x g per 1 min, 4 ° C. Tenere la piastra a temperatura ambiente.
      Nota: Il volume totale dovrebbe essere ora ~ 70 µ l/pozzetto.
  3. Branello pulizia utilizzando soluzione 30% PEG/1 M NaCl biglie magnetiche
    1. Aliquotare il temperatura ambiente 30% di PEG/1 M NaCl magnetico tallone soluzione in un'unica riga di una piastra 96 pozzetti pulito serbatoio (75 µ l per campione x n. di righe).
    2. Lavorando a temperatura ambiente, usando una pipetta multicanale, aggiungere 70 µ l (rapporto 1:1) della soluzione 30% PEG/1 M NaCl Beads magnetiche a ogni riga di campioni nella piastra di reazione di IP e mescolare 10 volte pipettando su e giù. Cambiare consigli tra le righe. Incubare la piastra per 15 min a temperatura ambiente.
    3. Posizionare la piastra sul magnete piatto e incubare per 5 min consentire le perline per separare.
    4. Utilizzando una pipetta, senza disturbare le perline, con attenzione rimuovere e scartare il surnatante. Mantenere le perline.
    5. Mentre la piastra di reazione IP è ancora sul magnete piatto, usando una pipetta multicanale, a ogni riga di campioni, aggiungere 150 µ l di temperatura 70% EtOH e incubare per 30 s. Dopo 30 s, usando una pipetta multicanale, rimuovere e scartare il surnatante. Ripetere questo passaggio un'altra volta per un totale di 2 lavaggi.
    6. Dopo il secondo lavaggio EtOH, incubare la piastra 'a secco' sul magnete piatto per 3 min. Ispezionare visivamente la piastra per assicurarsi che tutti l'EtOH è evaporato. In caso contrario, incubare la piastra per 1 min. sovra i risultati di perle in una resa inferiore.
    7. Prendere il piatto fuori la piastra magnetica e usando una pipetta multicanale, aggiungere 35 µ l EB (Tabella materiali). Miscelare bene pipettando su e giù 10 volte. Cambiare consigli tra le righe. Incubare a temperatura ambiente per 3 min eluire.
    8. Dopo l'incubazione, posizionare la piastra di reazione IP torna sul magnete piatto e incubare per 2 min. Le perle devono essere separati e la soluzione diventerà chiara.
    9. Usando una pipetta multicanale, senza disturbare le perline, trasferire con cautela il surnatante nei rispettivi pozzetti di una piastra a 96 pozzetti nuovo.
    10. Sigillare la piastra con un coperchio in lamiera alluminio, etichetta "IPed + Input DNA" e conservare a 4 ° C durante la notte, o a-20 ° C per il lungo termine (> 48h) deposito.

4. giorno 3: Costruzione della libreria

  1. Fosforilazione e fine riparazione
    1. L'input per la reazione di fine riparazione/fosforilazione è l'IPed + piastra dal passaggio 3.3.10 di Input. Dopo lo scongelamento, rallentare la piastra a 200 x g per 1 min a 4 ° C e tenerlo sul ghiaccio.
    2. Recuperare dal congelatore a-20 ° C tutti i reagenti (ad eccezione di enzimi) necessaria per la reazione di fine riparazione/fosforilazione (tabella 6) e li scongelare a temperatura ambiente, quindi trasferire immediatamente in ghiaccio.
    3. Lavorando sul ghiaccio, seguire la tabella 6 per impostare la fine riparazione/fosforilazione Master Mix in una provetta sterile, microcentrifuga da 1,5 mL. Dopo l'aggiunta di tutti i componenti non-enzima, mescolare bene di impulso-Vortex e riposizionare il tubo sul ghiaccio.
    4. Recuperare gli enzimi pertinenti dalle loro celle frigorifere e trasporto al banco in un portaprovette cool refrigerati. Mescolare ogni enzima, spostando il tubo, giro veloce e posizionarlo nel portaprovette cool refrigerati. Quando l'enzima il pipettaggio, aspirare lentamente per assicurare un trasferimento preciso volume. Dopo l'aggiunta, lavare la punta nel mix master pipettando su e giù.
    5. Una volta che gli enzimi sono aggiunti, delicatamente impulso-vortice il master mix 5 volte per assicurare una distribuzione uniforme di tutti i componenti, poi giro veloce e mettere immediatamente il tubo indietro sul ghiaccio.
    6. Su ghiaccio, aliquota un volume adeguato di fine riparazione/fosforilazione Master Mix in un'unica riga di una nuova piastra 96 pozzetti serbatoio; volume per essere aliquotati: (15 µ l x n. di righe) + 5 µ l di volume morto. Un esempio di calcolo per le due righe: (15 µ l x 2) + 5 µ l = 35 µ l/pozzetto.
    7. Usando una pipetta multicanale, aggiungere 15 µ l di fine riparazione/fosforilazione Master Mix per ogni riga di campioni e mescolare 10 volte pipettando su e giù. Cambiare consigli tra le righe. Sigillare la piastra con un coperchio di plastica, si sono fermati a 200 x g per 1 min a 4 ° C e incubare a temperatura ambiente per 30 min.
  2. Branello pulitura dopo fine riparazione e fosforilazione
    1. Dal frigorifero 4 ° C, è necessario recuperare la soluzione Beads magnetiche PEG/1 M di NaCl al 20% e 30% PEG/1 M NaCl soluzione e incubare a temperatura ambiente per almeno 30 min.
      Nota: La soluzione di PEG/1 M NaCl del 30% non contengono biglie magnetiche.
    2. Dopo che entrambe le soluzioni raggiungano la temperatura ambiente, per ogni campione preparare 80 µ l di miscela di 1:2 di 30% PEG/1 M NaCl e 20% PEG/1 M NaCl Beads magnetiche soluzioni. Un esempio per 24 campioni: 80 µ l x 24 = 1.920 µ l (µ l 640 del 30% PEG/1 M NaCl e 1.288 µ l delle soluzioni di biglie magnetiche di 20% PEG/1 M NaCl).
    3. Aliquotare la soluzione perlina mix, volume uguale, in un'unica riga di una piastra a 96 pozzetti serbatoio e tenerlo a temperatura ambiente. Aliquotare buffer di EB (40 µ l per campione x n. di righe) in una sola riga di una piastra 96 pozzetti pulire serbatoio. Un esempio per le due righe: 40 µ l x 2 = 80 µ l/pozzetto.
    4. Usando una pipetta multicanale, aggiungere 75 µ l di mix di perle preparato passo 4.2.2 in ogni riga di campioni dal passaggio 4.1.7 e mescolare su e giù per 10 volte. Cambiare consigli tra le righe. Incubare a temperatura ambiente per 15 minuti continua con la procedura di pulitura della perla come descritto nella procedura 3.3.3-3.3.10. Coprire la piastra con un sigillo in plastica, giro veloce e posizionarlo sul ghiaccio. Procedere al punto 4.3.
  3. A-Tailing reazione
    1. Recuperare da-20 ° C congelatore tutti i reagenti (ad eccezione di enzimi) necessaria per la reazione A-Tailing (tabella 7), li scongelare a temperatura ambiente quindi trasferire immediatamente in ghiaccio.
    2. Lavorando sul ghiaccio, seguire la tabella 7 per impostare A-Tailing Master Mix in una provetta sterile, microcentrifuga da 1,5 mL. Seguire le istruzioni di configurazione di brew enzimatica generale come descritto nella procedura 4.1.4-4.1.6.
    3. Usando una pipetta multicanale, aggiungere 15 µ l di Master Mix A-Tailing a ogni riga di campioni e mescolare 10 volte pipettando su e giù. Cambiare consigli tra le righe. Sigillare la piastra con un coperchio PCR, rotazione verso il basso a 200 x g per 1 min a 4 ° C ed incubare in un termociclatore a 37 ° C per 30 min. Dopo l'incubazione, rallentare la piastra a 200 x g per 1 min e tenerlo a temperatura ambiente.
  4. Branello pulitura dopo A-Tailing
    1. Procedere come descritto al punto 4.2. Coprire la piastra con un sigillo in plastica, giro di etichetta "coda A + BC", veloce e posizionarlo sul ghiaccio. Procedere al punto 4.5.
  5. Legatura di adattatore
    1. Recuperare da-20 ° C congelatore tutti i reagenti (ad eccezione di enzimi) necessaria per la reazione di legatura di adattatore (tabella 8), li scongelare a temperatura ambiente quindi trasferire immediatamente in ghiaccio.
    2. Recuperare la soluzione stock 10 µM PE adattatore (Supplemental tabella 1) e diluire a 0,5 µM utilizzando EB. Mescolare bene su Vortex impulso. Il volume richiesto è di 3 µ l x n. di campioni. Lavorando sul ghiaccio, aliquota scheda di 0,5 µM PE, volume uguale, in 12 pozzetti di una piastra 96 pozzetti pulire serbatoio. Tenerlo su ghiaccio.
    3. Lavorando sul ghiaccio, seguire la tabella 8 per impostare l'adattatore legatura Master Mix in una provetta sterile, microcentrifuga da 1,5 mL. Seguire le istruzioni di configurazione di brew enzimatica generale come descritto nella procedura 4.1.4-4.1.6. Assicurarsi che il 5 X rapida legatura Buffer è completamente scongelati e molto ben miscelati prima dell'uso.
    4. Su ghiaccio, aliquota un volume adeguato di adattatore legatura Master Mix in un'unica riga di una nuova piastra 96 pozzetti serbatoio. Ad esempio, calcolo per due righe: (23 µ l x 2) + 5 µ l = 51 µ l/pozzetto. Tenere la piastra sul ghiaccio.
    5. Usando una pipetta multicanale, aggiungere 2 µ l di 0,5 µM adattatore abbinato fine (PE) in ogni riga di campioni da passo 4.4.1 e mix. Cambiare consigli tra le righe.
    6. Usando una pipetta multicanale, aggiungere 23 µ l di adattatore legatura Master Mix per ogni riga di campioni e miscelare 15 volte pipettando su e giù. Cambiare consigli tra le righe. Sigillare la piastra con un coperchio di metallo, etichetta "Legatura", spin down a 200 x g per 1 min a 4 ° C ed incubare a temperatura ambiente per una notte.
  6. Giorno 4: Perlina pulizia #1 dopo la legatura adattatore
    1. Dal frigorifero 4 ° C, è necessario recuperare la soluzione di biglie magnetiche PEG/1 M NaCl 20% e incubare a temperatura ambiente per almeno 30 min. Mentre la soluzione è equilibrare preparare fresco 70% EtOH.
    2. La soluzione di biglie magnetiche PEG/1 M NaCl 20% aliquota, 55 µ l per campione, in un'unica riga di un serbatoio di 96 pozzetti piastra e tenerlo a temperatura ambiente. Un esempio per le due righe: 55 µ l x 2 = 110 µ l/pozzetto.
    3. Aliquotare buffer di EB, 50 µ l per campione, in un'unica riga di una piastra 96 pozzetti pulire serbatoio. Un esempio per le due righe: 50 µ l x 2 = 100 µ l/pozzetto.
    4. Usando una pipetta multicanale, aggiungere 48 µ l della soluzione 20% PEG/1 M NaCl Beads magnetiche in ogni riga di campioni nella piastra di legatura da passo 4.5.6 e mescolare su e giù per 10 volte. Cambiare consigli tra le righe. Incubare a temperatura ambiente per 15 minuti continua con la procedura di pulitura della perla come descritto nella procedura 3.3.3-3.3.7.
    5. Prendere il piatto fuori la piastra magnetica e usando una pipetta multicanale, aggiungere 45 µ l EB (Tabella materiali). Miscelare bene pipettando su e giù 10 volte. Cambiare consigli tra le righe. Incubare a temperatura ambiente per 3 min eluire.
    6. Dopo l'incubazione, posizionare la piastra di reazione IP torna sul magnete piatto e incubare per 2 minuti usando una pipetta multicanale, senza disturbare le perline, attentamente trasferire il surnatante nei rispettivi pozzetti di una piastra a 96 pozzetti nuovo. La targhetta di etichettatura "Legatura + 1 BC".
    7. A ciascun pozzetto aggiungere 5 µ l di tampone di alta fedeltà 10 x PCR e miscelare bene pipettando su e giù. Cambiare consigli tra le righe. Coprire la piastra con un sigillo in plastica, giro veloce e tenerlo a temperatura ambiente.
  7. Branello pulire-up #2 dopo la legatura adattatore
    1. Eseguire la pulitura della perla come descritto nel paragrafo 4.6 con le seguenti modifiche: 60 µ l di soluzione di biglie magnetiche PEG/1 M NaCl 20% ad ogni pozzetto attivo nella legatura + 13 piastra (passo 4.6.7) ed eluire dai branelli utilizzando 35 µ l di tampone EB. La targhetta di etichettatura "Legatura + 2 BC" e tenerlo sul ghiaccio.
  8. Amplificazione di PCR
    1. Recuperare dal congelatore a-20 ° C tutti i reagenti (ad eccezione di enzimi) necessari per la reazione di PCR (tabella 9), li scongelare a temperatura ambiente, poi immediatamente posto sul ghiaccio.
    2. Lavorando sul ghiaccio, seguire la tabella 9 per impostare la PCR Master Mix in una provetta sterile, microcentrifuga da 1,5 mL. Seguire le istruzioni di configurazione generale brew come indicato nella procedura 4.1.4-4.1.5. Su ghiaccio, aliquota un volume adeguato di PCR Master Mix in un'unica riga di una nuova piastra 96 pozzetti serbatoio. Tenerlo su ghiaccio. Vedere il punto 4.5.4 per i calcoli del campione.
    3. Lavorando sul ghiaccio, usando una pipetta multicanale, aggiungere 2 µ l di ogni unico 12,5 µM PCR inversa indicizzazione primer (Supplemental tabella 2) in ogni pozzetto in legatura + piastra 2 BC (punto 4.7.1) e mescolare lentamente su e giù. Cambiare consigli tra le righe. Tenere la piastra sul ghiaccio.
    4. Lavoro sul ghiaccio, usando una pipetta multicanale, aggiungere 23 µ l della miscela PCR padrone in ogni riga di campioni da passo 4.8.3 e mix 10 volte pipettando su e giù. Sigillare la piastra con un coperchio PCR, rotazione verso il basso a 200 x g per 1 min e incubare in un termociclatore (Vedi tabella 10 per ciclismo condizioni di PCR).
  9. Branello pulitura dopo l'amplificazione di PCR
    1. Dopo l'amplificazione di PCR girare la piastra a 200 x g per 1 min, 4 ° C. Eseguire la pulizia del tallone come descritto nel paragrafo 4.6 con le seguenti modifiche: aggiungere 51 µ l di soluzione 20% PEG/1 M NaCl Beads magnetiche ad ogni reazione di PCR ed eluire dai branelli utilizzando 25 µ l di tampone EB. Sigillare la piastra con un coperchio in alluminio e spin giù a 200 x g per 1 min. Store i campioni a-20 ° C.
    2. Per convalidare costruiti biblioteche, eseguire la quantificazione di DNA usando un'analisi di fluorescenza-basata, visualizzare il prodotto finale utilizzando un analizzatore di elettroforesi capillare basato su chip (analisi di sensibilità alta) ed eseguire arricchimento PCR quantitativa (qPCR) (Vedi Rappresentante Results, convalida di qualità libreria ndChIP-seq di qPCR).

Representative Results

Profili di digestione della cromatina
Ottimizzazione della digestione MNase è essenziale per il successo del presente protocollo. È fondamentale per generare un profilo di digestione dominato dalle dimensioni del frammento di singolo nucleosoma, mentre non eccessivamente digeriti, per consentire il recupero di frammenti di nucleosoma di ordine superiore. Un profilo ideale digestione è costituito da una maggioranza di frammenti di singolo nucleosoma con una piccola frazione che rappresenta frammenti più piccoli e più grandi di singoli nucleosomi. La figura 1 Mostra esempi di profili di distribuzione una dimensione ideale, sovra- digerito e sotto-digerito. Si noti che sub-ottima digestione della cromatina sarà anche apparente nel profilo della libreria sequenza generata dal materiale di IP (Figura 2).

Convalida di qualità libreria ndChIP-seq di qPCR
qPCR è un metodo ben consolidato per la valutazione della qualità dei ChIP18,19,20. Quando eseguire ndChIP-seq su 10.000 cellule la resa di acido nucleico dopo IP sarà inferiore a 1 ng. Pertanto, è essenziale eseguire qPCR dopo la costruzione della libreria per valutare il relativo arricchimento delle regioni di destinazione sopra priorità bassa. Per fornire una stima di sfondo, librerie costruite da cromatina MNase digerito (Input) vengono generate. Per ogni libreria IP, due insiemi degli iniettori sono necessari (vedere Supplementaltabella 3 per un elenco degli iniettori per i contrassegni dell'istone comunemente utilizzati). Un set di primer deve essere specifico per una regione genomica che è costantemente associata con la modifica dell'istone di interesse (positivo destinazione) e un'altra regione che non è contrassegnata con la modifica dell'istone di interesse (target negativo). La qualità della biblioteca ChIP-seq sarà valutata come piegare arricchimento rispetto alla libreria di input. Arricchimento di piega può essere calcolato usando la seguente equazione che presuppone l'amplificazione esponenziale della regione genomica target: 2Ctingresso-CtIP. Il nostro custom made pacchetto software statistico R, qcQpcr_v1.2, è adatto per analisi di arricchimento di qPCR di librerie native ingresso basse di ChIP-seq (File supplementari di codice). Figura 3 rappresenta un risultato di qPCR per le librerie di ChIP-seq di successo e insuccesso. Il valore di arricchimento minima piega previsto per le librerie di ndChIP-seq di buona qualità sono 16 per marcature strette, come H3K4me3 e 7 per grandi marchi, ad esempio H3K27me3.

Modellazione MNase accessibilità
Analisi computazionale di ChIP-seq sono complessa e unica per ogni impostazione sperimentale. Un insieme di linee guida stabilite dal Consorzio di Epigenomic umana internazionale (IHEC) e l'enciclopedia di DNA Elements (ENCODE) può essere utilizzato per valutare la qualità del ChIP-seq librerie21. È importante notare che la profondità di sequenziamento delle librerie influisce il rilevamento e la risoluzione di regioni arricchito20. Il numero di picchi rilevato aumento e si avvicina un altopiano come lettura profondità aumenta. Si consiglia di ndChIP-seq librerie da sequenziare conformemente alle raccomandazioni IHEC di 50 milioni accoppiato-letture (frammenti di 25 milioni) per marcature strette (per esempio, H3K4me3) e 100 milioni accoppiato-letture (frammenti di 50 milioni) per i grandi marchi ( ad esempio, H3K27me3) e22di input. Queste profondità di sequenziamento forniscono sufficiente allineamenti di sequenza per il rilevamento delle cime più significative utilizzando ampiamente utilizzati i chiamanti di picco di ChIP-seq, come MACS2 e HOMER, senza raggiungere la saturazione23,24. Una libreria di mammiferi ndChIP-seq di alta qualità ha un tasso di duplicati di PCR di < 10% e riferimento tasso di allineamento di genoma di > 90% (tra cui letture duplicate). Librerie di successo ndChIP-seq conterrà replica altamente correlate con una parte significativa (> 40%) dei picchi di letture allineati all'interno MACS222 identificato arricchite e ispezione di letture allineate su un browser del genoma dovrebbe rivelare visivamente arricchimenti rilevabili rispetto alla libreria di input (Figura 4). Inoltre, ndChIP-seq può essere utilizzato per valutare la densità nucleosoma utilizzando un algoritmo di distribuzione gaussiana miscela (w1 * n(x; Μ 1,σ1) + w2 * n(x; μ2, σ2) = 1) presso MACS2 identificato regioni arricchite di densità nucleosoma modello come definito da confini accessibili MNase. In questo modello, w1 rappresenta mono-nucleosoma distribuzione peso e w2 rappresenta il nucleosoma di distribuzione peso. Dove w1 è maggiore di w2, c'è dominanza di mono-nucleosoma frammenti e viceversa. Questa analisi richiede che librerie essere sequenziato in modo accoppiato-fine affinché frammento dimensioni possono essere definiti. Al fine di applicare l'algoritmo di distribuzione gaussiana miscela, statisticamente significative regioni arricchite in primo luogo sono identificate. Ti consigliamo di chiamare picco, con MACS2, utilizzando Input come un controllo e con le impostazioni predefinite per un taglio di valore q di 0,01 per grandi marchi e i segni stretti. Un numero di pacchetti statistici che impiega un algoritmo di distribuzione gaussiana miscela è disponibile dai pacchetti di software statistici ampiamente usato. Utilizzando la dimensione del frammento medio, determinato dai contorni lettura accoppiato-fine dei campioni IPed, distribuzioni di MACS2 identificato promotori arricchiti, e un algoritmo di distribuzione gaussiana miscela può essere applicato a ogni promotore utilizzando il pacchetto statistico-R Mclust versione 3.025 per calcolare una distribuzione ponderata. In questa applicazione, si consiglia di eliminare promotori contenenti meno di 30 frammenti allineati perché sotto questa soglia il peso risultante stime diventano inaffidabili. Una biblioteca di ndChIP-seq di buona qualità genera una distribuzione gaussiana miscela che consistono di due componenti con valori medi corrispondenti ai mono-, lunghezze di frammento di-nucleosoma.

Figure 1
Figura 1 : Valutazione della digestione MNase prima generazione della libreria. Profili di analizzatore di elettroforesi capillare basato su chip di un MNase ottimale digerito (A), sotto-digerito (B) e sovra-digerito della cromatina (C). Replicati biologici sono mostrati come tracce di blue, rosse e verde. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 : Valutazione della digestione di MNase dopo la generazione della libreria. (A) Post profili di costruzione di libreria di input in modo ottimale digerito (replicati biologici; rosso, verde, nero) e IP (replicati biologici; ciano, viola, blu) e (B) ingresso sub-ottima (replicati biologici; rosso, verde, blu) e IP ( replicati biologici; librerie di ciano, viola, arancione). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3 : Post costruzione della libreria PCR quantitativa può essere utilizzato per valutare la qualità delle biblioteche ndChIP-seq. Arricchimento di piega delle librerie H3K4me3 IP rispetto alle librerie di input viene calcolato come 2(Ct di input - Ct di IP) per obiettivi positivi e negativi utilizzando qcQpcr_v1.2. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4 : Rappresentante ndChIP-seq libreria costruita da 10.000 primario CD34+ cavo globuli. Correlazione di Pearson del segnale H3K4me3 (letture al milione letture mappate) calcolati nei promotori (TSS + /-2Kb) tra 3 replicati biologici, replicare (A) 1 e 2, (B) replicare 1 e 3, replicare (C) 2 e 3. (D) UCSC Vista browser del mazzo del gene HOXA di reticolato ChIP-seq generato da 1 milione di cellule per IP, successo ndChIP-seq da 10.000 cellule per IP e infruttuoso ndChIP-seq da 10.000 cellule per IP. (rosso: H3K27me3, verde: H3K4me3 e nero: Input). (E) frazione di letture mappate all'interno MACS2 identificato regioni arricchite di H3K4me3 (nero) e H3K27me3 (grigio). Clicca qui per visualizzare una versione più grande di questa figura.

Composizione del buffer
A. 1. buffer di immunoprecipitazione (IP)
20 mM Tris-HCl a pH 7.5
2 mM EDTA
150 mM NaCl
0,1% Triton X-100
0,1% desossicolato
10 mM sodio butirrato
A. 2. tampone di lavaggio sale basso
20 mM Tris-HCl a pH 8.0
2 mM EDTA
150 mM NaCl
1% Triton X-100
0,1% SDS
A. 3. tampone di lavaggio sale alta
20 mM Tris-HCl a pH 8.0
2 mM EDTA
500 mM NaCl
1% Triton X-100
0,1% SDS
A. 4. tampone di eluizione di ChIP
100 mM NaHCO3
1% SDS
A. 5. 1 x buffer di lisi – 1 mL
0,1% Triton
0,1% desossicolato
10 mM sodio butirrato
Tampone di diluizione Ab. 6.
0,05% (p/v) Azide
0.05% ampio spettro antimicrobico (ad es. ProClin 300)
in PBS
A. 7. 30% soluzione di PEG/1m NaCl magnetica perlina (riferimento16)
30% PEG
NaCl di 1m
10 mM Tris-HCl pH 7.5
1 mM EDTA
1 mL di perline Super-paramagnetici lavati
A. 8. 20% soluzione di PEG/1m NaCl magnetica perlina (riferimento16)
30% PEG
NaCl di 1m
10 mM Tris-HCl pH 7.5
1 mM EDTA
1 mL di perline Super-paramagnetici lavati

Tabella 1: ndChIP-seq composizione di buffer.

Modifica dell'istone Concentrazione (µ g / µ l)
H3K4me3 0,125
H3K4me1 0.25
H3K27me3 0,125
H3K9me3 0,125
H3K36me3 0,125
H3K27ac 0,125

Tabella 2: Quantità di anticorpo necessaria per ndChIP-segg.

Reganet Volume (µ l)
Acqua ultra pura 478
1 M Tris-HCl pH 7.5 10
0.5 EDTA M 10
5m NaCl 2
Glicerolo 500
Volume totale 1.000

Tabella 3: Ricetta per MNase tampone di diluizione.

Reagente Volume (µ l)
Acqua ultra pura 13
20 mM DTT 1
MNase tampone 10x 4
20 U / µ l Mnase 2
Volume totale 20

Tabella 4: Ricetta per MNase Master Mix.

Reagente Volume (µ l)
Tampone di eluizione 30
Buffer G2 8
Proteasi 2
Volume totale 40

Tabella 5: Ricetta per DNA purificazione Master Mix.

Reagente Volume (µ l)
Acqua ultra pura 3.3
10 x endonucleasi di restrizione Buffer (es. NEBuffer) 5
25 mM ATP 2
dNTPs da 10 millimetri 2
T4 Polinucleotide chinasi (10 U / µ l) 1
T4 DNA polimerasi (3 U / µ l) 1.5
DNA polimerasi I, Large (Klenow) frammento (5 U / µ l) 0.2
Volume totale 15

Tabella 6: Ricetta per fine riparazione Master Mix.

Reagente Volume (µ l)
Acqua ultra pura 8
10 x endonucleasi di restrizione Buffer (es. NEBuffer) 5
10 millimetri dATP 1
Klenow (3' - 5' exo-) 1
Volume totale 15

Tabella 7: Ricetta per A-Tailing Master Mix.

Reagente Volume (µ l)
Acqua ultra pura 4.3
la legatura rapida buffer 5x 12
Ligasi del DNA T4 (2000 U / µ l) 6.7
Volume totale 23

Tabella 8: Ricetta per adattatore legatura Master Mix.

Reagente Volume (µ l)
Acqua ultra pura 7
25 uM primer PCR 1.0 2
HF buffer 5x 12
DMSO 1.5
DNA polimerasi 0,5
Volume totale 23

Tabella 9: Ricetta per PCR Master Mix.

Temprature (° C) Durata (s) Numero di cicli
98 60 1
98 30
65 15 10
72 15
72 300 1
4 tenere premuto tenere premuto

Tabella 10: PCR metodo run.

OLIGO Sequenza Modifica
PE_adapter 1 5'-/ 5Phos/GAT CGG AAG AGC GGT TCA GCA GGA ATG CCG AG -3 ' 5' modifica: fosforilazione
PE_adapter 2 5' - ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TC * T - 3' 3' modifica: * T è un legame fosforotioato

Supplemental tabella 1: Sequenze Oligo per generazione di adattatore PE.

Nome di primer Sequenza Indice IndexRevC (da utilizzare per la sequenza)
Iniettore di PCR inversa indicizzazione 1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGTGAT atcacg
PCR inversa indicizzazione iniettore 2 CAAGCAGAAGACGGCATACGAGATCTGATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGATC gatcag
PCR inversa indicizzazione primer 3 CAAGCAGAAGACGGCATACGAGATGGGGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGGGTT aacccc
PCR inversa indicizzazione primer 4 CAAGCAGAAGACGGCATACGAGATCTGGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGGGT acccag
PCR inversa indicizzazione primer 5 CAAGCAGAAGACGGCATACGAGATAGCGCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCGCT agcgct
PCR inversa indicizzazione primer 6 CAAGCAGAAGACGGCATACGAGATCTTTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTTTTG caaaag
PCR inversa indicizzazione primer 7 CAAGCAGAAGACGGCATACGAGATTGTTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGTTGG ccaaca
PCR inversa indicizzazione primer 8 CAAGCAGAAGACGGCATACGAGATAGCTAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCTAG ctagct
PCR inversa indicizzazione primer 9 CAAGCAGAAGACGGCATACGAGATAGCATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCATC gatgct
PCR inversa indicizzazione primer 10 CAAGCAGAAGACGGCATACGAGATCGATTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGATTA taatcg
PCR inversa indicizzazione primer 11 CAAGCAGAAGACGGCATACGAGATCATTCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CATTCA tgaatg
PCR inversa indicizzazione primer 12 CAAGCAGAAGACGGCATACGAGATGGAACTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGAACT agttcc
PCR inversa indicizzazione primer 13 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ACATCG cgatgt
PCR inversa indicizzazione primer 14 CAAGCAGAAGACGGCATACGAGATAAGCTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AAGCTA tagctt
PCR inversa indicizzazione primer 15 CAAGCAGAAGACGGCATACGAGATCAAGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CAAGTT aacttg
PCR inversa indicizzazione primer 16 CAAGCAGAAGACGGCATACGAGATGCCGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCCGGT accggc
PCR inversa indicizzazione primer 17 CAAGCAGAAGACGGCATACGAGATCGGCCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGGCCT aggccg
PCR inversa indicizzazione primer 18 CAAGCAGAAGACGGCATACGAGATTAGTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TAGTTG caacta
PCR inversa indicizzazione primer 19 CAAGCAGAAGACGGCATACGAGATGCGTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCGTGG ccacgc
PCR inversa indicizzazione primer 20 CAAGCAGAAGACGGCATACGAGATGTATAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GTATAG ctatac
PCR inversa indicizzazione primer 21 CAAGCAGAAGACGGCATACGAGATCCTTGCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CCTTGC gcaagg
PCR inversa indicizzazione primer 22 CAAGCAGAAGACGGCATACGAGATGCTGTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCTGTA tacagc
PCR inversa indicizzazione primer 23 CAAGCAGAAGACGGCATACGAGATATGGCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ATGGCA tgccat
PCR inversa indicizzazione primer 24 CAAGCAGAAGACGGCATACGAGATTGACATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGACAT atgtca

Supplemental tabella 2: PCR inversa indicizzazione sequenze dell'iniettore.

Primer Sequenza
ZNF333_genic_H3K9me3_F 5'-AGCCTTCAATCAGCCATCATCCCT-3'
ZNF333_genic_H3K9me3_R 5'-TCTGGTATGGGTTCGCAGATGTGT-3'
HOXA9-10_F 5'-ACTGAAGTAATGAAGGCAGTGTCGT-3'
HOXA9-10_R 5'-GCAGCAYCAGAACTGGTCGGTG-3'
GAPDH_genic_H3K36me3_F 5'-AGGCAACTAGGATGGTGTGG-3'
GAPDH_genic_H3K36me3_R 5'-TTGATTTTGGAGGGATCTCG-3'
GAPDH-F 5'-TACTAGCGGTTTTACGGGCG-3'
GAPDH-R 5'-TCGAACAGGAGGAGCAGAGAGCGA-3'
Modifica dell'istone Obiettivo positivo Obiettivo negativo
H3K4me3 GAPDH HOXA9-10
H3K4me1 GAPDH_genic ZNF333
H3K27me3 HOXA9-10 ZNF333
H3K27ac GAPDH ZNF333
H3K9me3 ZNF333 HOXA9-10
H3K36me3 GAPDH_genic ZNF333

Supplemental tabella 3: Elenco degli iniettori per i contrassegni dell'istone comunemente usati (H3K4me3, H3K4me1, H3K27me3, H3K27ac, H3K9me3 e H3K36me3).

Supplementare File 1: foglio di lavoro ndChIP-seq. Per favore clicca qui per scaricare questo file.

File supplementari di codice: qcQpcr_v1.2. Pacchetto software statistico R per l'analisi di arricchimento di qPCR di librerie native ingresso basse di ChIP-seq. Per favore clicca qui per scaricare questo file.

Discussion

Data la natura combinatoria di modificazione della cromatina e nucleosoma posizionamento nella regolazione trascrizionale, un metodo che consente misurazioni simultanee di queste caratteristiche rischia di fornire nuove intuizioni regolazione epigenetica. Il ndChIP-seq presentato qui è un protocollo di ChIP-seq nativo ottimizzato per attivare interrogazione simultanea della modifica dell'istone e densità nucleosoma in cellule primarie rare9,10. ndChIP-seq utilizza la digestione enzimatica della cromatina che, quando accoppiato al sequenziamento massivamente parallelo accoppiato-fine e un modello di distribuzione gaussiana mistura, consente per le modifiche dell'istone di indagine a livello di singolo nucleosoma e il deconvoluzione di epigenomic profili guidato da eterogeneità all'interno di una popolazione. Usando questo protocollo, precedentemente abbiamo segnalato una distribuzione unica di dimensioni frammento immuno-precipitato, determinato da accoppiato-fine leggere i confini, connessi con cromatina specifici stati definiti da ChromHMM10,24.

La qualità di una biblioteca di ndChIP-seq è dipende da molteplici fattori, come la specificità dell'anticorpo e sensibilità, condizioni ottimali di digestione MNase e qualità della cromatina. La specificità degli anticorpi utilizzati è cruciale nella produzione di successo ndChIP-seq biblioteca. Un anticorpo ideale Mostra alta affinità contro l'epitopo di interesse con poca reattività crociata con altri epitopi. È altrettanto importante scegliere biglie magnetiche con il più alta affinità per l'anticorpo di scelta.

MNase digestione è una reazione critica e sensibili di tempo e di concentrazione in questo protocollo. Pertanto, durante l'elaborazione di campioni multipli, è importante che ogni reazione viene incubato per un controvalore complessivo di tempo (Vedi punto 2.2). La qualità della cromatina è un altro fattore che condiziona significativamente l'esito della porta di cromatina Fragmented ndChIP-segg. per un profilo di digestione MNase Sub-ottimo e risultati nelle librerie con un basso rapporto segnale-rumore. Campioni primari con bassa vitalità cellulare o degradato della cromatina, come formalina tessuto di paraffina (FFPE) non sono consigliate per questo protocollo.

L'aggiunta di un PIC durante l'estrazione della cromatina riduce indesiderati (vale a dire, casuale) della cromatina frammentazione e conserva l'integrità di istoni. Come tale, PIC deve essere aggiunto al buffer di lisi e immunoprecipitazione buffer appena prima di utilizzare. Mentre selezione cellule tramite flusso cytometry, selezionare per cellule vitali e garantire le cellule vengono ordinate a un tasso di flusso debole per aumentare l'accuratezza della stima numero cellulare e attuabilità delle cellule. Evitare l'ordinamento celle direttamente nel tampone di lisi. Il buffer di guaina diluirà il buffer di lisi e impedisce l'efficace permeabilizzazione della membrana cellulare a MNase. Secondo un tipo di cellule o di un organismo, titolazione di MNase può essere richiesto per ottenere una digestione ottimale.

ndChIP-seq sulle cellule di mammiferi richiede una profondità minima di sequenziamento di 50 milioni accoppiato-letture (frammenti di 25 milioni) per 100 milioni accoppiato-letture (frammenti di 50 milioni) e i segni stretti per l'input e grandi marchi. L'algoritmo di distribuzione gaussiana miscela non eseguirà in modo ottimale sulle biblioteche che sono stati sequenziati fino ad una profondità significativamente di sotto di questa raccomandazione. ndChIP-seq non classificano promotori con separazione poco tra il valore di distribuzione ponderata per lunghezze di frammento di mono - e di-nucleosome in mono - o di-nucleosoma dominato promotori. Pertanto, questi promotori devono essere rimosso in analisi successive. Replicati biologici possono essere generati per aumentare la fiducia nel predetti distribuzioni e identificare tecniche variabilità nella costruzione di digestione e Biblioteca del MNase.

A differenza di precedenti iterazioni di protocolli nativi di ChIP-seq, ndChIP-seq fornisce i mezzi per studiare effetto combinatorio di modificazione di struttura e istone di cromatina utilizzando frammento dimensione post immunoprecipitazione per integrare densità nucleosoma, determinata dall'accessibilità di MNase, con misure di modifica dell'istone. Applicazione di ndChIP-seq per tessuti e cellule primarie fornirà nuove conoscenze sulla natura integrativa della regolazione epigenetica e permettere l'identificazione di marcatori epigenetici dovuto eterogeneità all'interno della popolazione.

Disclosures

Gli autori dichiarano di non avere nessun concorrenti interessi finanziari.

Acknowledgements

A.L. è stato sostenuto da una borsa di studio laurea canadese dall'istituti canadesi di ricerca sanitaria. Quest'opera è stata sostenuta da sovvenzioni dal genoma British Columbia e l'istituti canadesi di ricerca sanitaria (CIHR-120589) come parte dell'epigenetica canadese, ambiente e salute Research Consortium Initiative e dal programma di Terry Fox Research Institute Progetto Grant #TFF-122869 M.H. e un Istituto di ricerca di Terry Fox nuovo Investigator Award (Grant # 1039) di M.H.

Materials

Name Company Catalog Number Comments
1M Tris-HCl –pH 7.5 Thermo Scientific 15567-027
1M Tris-HCl –pH 8 Thermo Scientific 15568-025
0.5M EDTA Thermo Scientific AM9260G
5M NaCl Sigma 1001385276
Triton X-100 Sigma 1001412354
Sodium-Deoxycholate Sigma 1001437582
SDS Thermo Scientific 15525-017
Sodium-Bicarbonate Fisher Scientific S233-500
100% EtOH NA NA
V-bottom 96 well plate (AB 1400) Thermo Scientific AB-1400-L
Gilson P2 pipetman Mandel F144801
Gilson P10 pipetman Mandel F144802
Gilson P20 pipetman Mandel F123600
Gilson P100 pipetman Mandel F123615
Gilson P200 pipetman Mandel F123601
Gilson P1000 pipetman Mandel F123603
Micrococcal Nuclease  NEB M0247S
Thermo Mixer C (Heating block mixer) Eppendorf 5382000023
Multi 12-channel Pippet P20 Rainin 17013803
Multi 12-channel Pippet P200 Rainin 17013805
1.5 ml LoBind tube Eppendorf 22431021
0.5 ml LoBind tube Eppendorf 22431005
Plastic Plate Cover Edge Bio 48461
PCR cover Bio Rad MSD-1001
Aluminum Plate Cover Bio Rad MSF-1001
Elution buffer (EB buffer) Qiagen 19086
1M DTT Sigma 646563
Eppendorf 5810R centrifuge  Eppendorf 22625004
Ultrapure water Thermo Scientific 10977-015
Protein G dynabeads Thermo Scientific 10001D
Protein A dynabeads Thermo Scientific 10001D
Protease inhibitor Cocktail Calbiochem 539134
Rotating platform Mandel 1b109-12052010
Plate magnet Alpaqua 2523
Domed 12-cap strip Bio Rad TCS1201
Buffer G2 Qiagen 1014636
Protease Qiagen 19155
Tube Magnet (DynaMag-2) Thermo Scientific 12321D
Tube Magnet (DynaMag-2) LabCore 730-006
V shape Plastic reservoir Mandel S0100A
Vortex Mandel C1801
Mini Fuge Mettler Toledo XS2035
Analytical scale Mandel LB109-12052010
Quick Ligation Reaction Buffer, 5X NEB B6058S
DNA Polymerase I, Large (Klenow) Fragment NEB M0210S
Klenow Fragment (3'-5' exo) NEB M0212S
T4 DNA Polymerase NEB M0203S
T4 Polynucleotide Kinase NEB M0201S
Deoxynucleotide Solution mix, 10mM NEB N0447S
dATP Solution 10mM NEB N0440S
Quick T4 DNA Ligase NEB M0202T
Adenosine 5'-Triphosphate (ATP), 25mM NEB P0756S
DNA Polymerase Thermo Scientific F549L
NEBuffer 2 NEB B7002S
Hank's buffered salt solution Thermo Scientific 14025076
Fetal bovine serum  Thermo Scientific A3160702
phosphate buffer saline  Thermo Scientific 10010023
H3K4me3 Cell Signaling 9751S
H3K4me1 Diagenode C15410037
H3K27me3 Diagenode pAb-069-050
H3K36me3 Abcam ab9050
H3K9me3 Diagenode C15410056
SeraMag  super-paramagnetic beads

DOWNLOAD MATERIALS LIST

References

  1. Simpson, R. T. Nucleosome Positioning: Occurrence, Mechanisms, and Functional Consequences. Prog. Nucleic Acid Res. Mol. Biol. 40, Issue C 143-184 (1991).
  2. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundmamental particle of the eukaryotic chromosome. Cell. 98, 285-294 (1999).
  3. Schones, D. E., et al. Dynamic regulation of nucleosome positioning in the human genome. Cell. 132, (5), 887-898 (2008).
  4. Segal, E., et al. A genomic code for nucleosome positioning. Nature. 442, (7104), 772-778 (2006).
  5. Shiio, Y., Eisenman, R. N. Histone sumoylation is associated with transcriptional repression. PNAS. 100, (23), 13225-13230 (2003).
  6. Li, L., Lorzadeh, A., Hirst, M. Regulatory variation: An emerging vantage point for cancer biology. Wiley Interdiscip. Rev. Syst. Biol. Med. 6, (1), 37-59 (2014).
  7. Jiang, J., et al. Investigation of the acetylation mechanism by GCN5 histone acetyltransferase. PLoS ONE. 7, (5), (2012).
  8. Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12, (2), 198-209 (2002).
  9. Brind'Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M. M., Lorincz, M. C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 6, 6033 (2015).
  10. Lorzadeh, A., et al. Nucleosome Density ChIP-Seq Identifies Distinct Chromatin Modification Signatures Associated with MNase Accessibility. Cell Rep. 17, (8), 2112-2124 (2016).
  11. Noll, M., Kornberg, R. D. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109, (3), 393-404 (1977).
  12. Skene, P. J., Henikoff, S. A simple method for generating high-resolution maps of genome wide protein binding. eLife. 4, 09225 (2015).
  13. Brogaard, K., Xi, L., Wang, J. -P., Widom, J. A map of nucleosome positions in yeast at base-pair resolution. Nature. (2012).
  14. Cui, K., Zhao, K. Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods Mol. Biol. 833, 413-419 (2012).
  15. Mieczkowski, J., et al. MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat. Commun. 7, 11485 (2016).
  16. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). JOVE. (41), (2010).
  17. Rohland, N., Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, (5), 939-946 (2012).
  18. Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., Rudensky, A. Y. Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 445, (7130), 936-940 (2007).
  19. Krishnakumar, R., Gamble, M. J., Frizzell, K. M., Berrocal, J. G., Kininis, M., Kraus, W. L. Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes. Science. 319, (5864), 819-821 (2008).
  20. Mendenhall, E. M., et al. Locus-specific editing of histone modifications at endogenous enhancers. Nat. Biotechnol. 31, (12), 1133-1136 (2013).
  21. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  22. Reference Epigenome Standards - IHEC. Available from: http://ihec-epigenomes.org/research/reference-epigenome-standards/ (2017).
  23. Heinz, S., et al. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 38, (4), 576-589 (2010).
  24. Feng, J., Liu, T., Qin, B., Zhang, Y., Liu, X. S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 7, (9), 1728-1740 (2012).
  25. Fraley, C., Raftery, A. E. MCLUST: Software for Model-Based Cluster Analysis. J. Classif. 16, (2), 297-306 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics