Geração de imunoprecipitação da cromatina nativa sequenciamento de bibliotecas para análise da densidade nucleossoma

Genetics
 

Summary

Apresentamos uma imunoprecipitação da cromatina nativa modificada sequenciamento (ChIP-seq) metodologia para a geração de conjuntos de dados sequência apropriadas para um quadro analítico de nucleossoma densidade ChIP-seq integrando acessibilidade nuclease micrococcal (MNase) com medidas de modificação de histona.

Cite this Article

Copy Citation | Download Citations

Lorzadeh, A., Lopez Gutierrez, R., Jackson, L., Moksa, M., Hirst, M. Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis. J. Vis. Exp. (130), e56085, doi:10.3791/56085 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Apresentamos uma imunoprecipitação da cromatina nativa modificada sequenciamento (ChIP-seq) protocolo experimental compatível com uma mistura gaussiano distribuição baseada análise metodologia (densidade nucleossoma ChIP-seq; ndChIP-seq) que permite a geração de medições combinadas de acessibilidade nuclease micrococcal (MNase), com modificações do histone todo o genoma. Posição do nucleossoma e densidade local e a modificação pós-traducional de suas subunidades de histona, agir em conjunto para regular a transcrição local Estados. Medições combinatórias de acessibilidade nucleossoma com modificações do histone gerada pelo ndChIP-seq permite o interrogatório simultâneo desses recursos. A metodologia de ndChIP-seq é aplicável a um número pequeno de células primárias inacessíveis para cross-linking protocolos baseados em ChIP-seq. Tomados em conjunto, ndChIP-seq permite a medição da modificação do histone em combinação com densidade nucleossoma locais para obter novos insights compartilhados mecanismos que regulam a transcrição do RNA dentro das populações raras célula primária.

Introduction

O genoma eucariótico é empacotado em cromatina através de repetir estruturas nucleossoma que consistem em duas cópias de quatro proteínas histonas (por exemplo, H2A, H2B, H3 e H4) circunscritas por 146 pares de bases de DNA1,2. Complexos de remodelação de cromatina controlam nucleossoma posição dentro dos limites de promotor do gene e participarem na regulação da expressão gênica, alterando a acessibilidade do DNA para fatores de transcrição e o RNA polimerase máquinas3, 4.

Aminoácidas terminais caudas das histonas dentro nucleossoma são submetidas a várias modificações covalentes, incluindo acetilação, metilação, fosforilação, ubiquitylation, sumoylation, formilação e hidroxilação dos aminoácidos específicos5 , 6 , 7 , 8. posições e graus destas modificações ditam um estado de cromatina que influenciam a cromatina estrutura e controle de acesso dos complexos moleculares que permitem a ativação da transcrição7. Dado que ambos modificação de densidade e histona nucleossoma desempenham um papel no controle local da transcrição do gene, desenvolvemos uma abordagem de ChIP nativa que permite a medição simultânea de densidade nucleossoma e histona modificação9, 10.

ChIP-seq nativo aproveita a nuclease micrococci de endonuclease (MNase) para digerir a cromatina intacta em seu estado nativo dentro do núcleo11,12, uma propriedade que tem sido aproveitada para mapear nucleossoma posicionamento13 , 14 , 15. densidade nucleossoma ChIP-seq (ndChIP-seq) aproveita-se da propriedade de acesso preferencial de MNase para abrir regiões da cromatina para gerar medições que combinam MNase acessibilidade com histona modificação10. ndChIP-seq é adequado para a caracterização das modificações do histone em culturas de células, tecidos e raras células primárias. Aqui, apresentamos um protocolo detalhado que permite a geração de conjuntos de dados sequência apropriadas para um quadro analítico descrito anteriormente trabalho10 que integra o fragmento tamanho post imunoprecipitação, determinada pelo emparelhado-ler os limites, a fim ao mesmo tempo investiga MNase acessibilidade com medições de modificação de histona. Anteriormente, a aplicação do presente protocolo para 10.000 sangue de cordão umbilical humano primário derivado CD34+ células e células estaminais embrionárias humanas revelou únicas relações entre modificações de estrutura e histonas cromatina dentro destes tipos10 de célula . Dada a sua capacidade de medir simultaneamente acessibilidade nucleossoma e modificação de histona, ndChIP-seq é capaz de revelar características de epigenomic em uma população de células em um nível único nucleossoma e resolvendo assinaturas heterogêneas em sua elementos constitutivos. Um exemplo da exploração das populações celulares heterogêneas por ndChIP-seq é investigação de promotores bivalentes, onde tanto H3K4me3, uma marca ativa e H3K27me3, uma marca de repressiva, são presentes10.

Protocol

Nota: A entrada mínima para este protocolo é de 10.000 células por reação única imuno-precipitação (IP). Imprima a planilha fornecida experimental e utilizar como uma diretriz para planejar o experimento. Incubação à temperatura ambiente é assumidas como ~ 22 ° c. Todas as receitas do amortecedor são fornecidas na tabela 1. Todos os buffers devem ser armazenados a 4 ° C e mantidos no gelo durante o procedimento, salvo indicação em contrário.

1. preparação da pilha

  1. Células cultivadas
    1. Lavar as células com 1 mL de solução salina tampão de fosfato (PBS) e determinar com precisão a concentração de células usando um hemocytometer. Se houver mais de 1 milhão de células, aumento do volume de PBS.
    2. Com base na contagem de células, alíquota equivalente de 70.000-100.000 células em um tubo estéril de 1,5 mL e spin-down a 500 x g, durante 6 min a 4 ° C. Utilizando uma pipeta, remova lentamente e descartar o sobrenadante (sem perturbar o centrifugado) e resuspenda o pellet em lise gelada + 1 x inibidor da protease cocktail (PIC) a uma concentração de 1.000 células / µ l. Misture bem pipetando acima e abaixo de 20-30 vezes. É fundamental que aglomerados de células são rompidos. Não tente criar bolhas.
    3. Vá direto ao dia 1 (seção 2) do protocolo ndChIP-seq ou flash congelar o centrifugado em nitrogênio líquido e loja a-80 ° C.
  2. Células classificadas
    1. Colete 70.000-100.000 classificada16 células em um tubo de 1,5 mL com 350 µ l de solução salina tamponada (HBSS), de Hank ou PBS + 2% de soro fetal bovino (FBS).
    2. Spin para baixo cada célula alíquota a 500 x g, durante 6 min a 4 ° C. Utilizando uma pipeta, remover o sobrenadante (sem perturbar o centrifugado) lentamente e Resuspenda em lise gelada + 1 x PIC para uma concentração final de 1.000 células / µ l. Misture bem em tampão de Lise pipetando para cima e para baixo 20 - 30 vezes. Certifique-se de que os grupos de células são rompidos. Não tente criar bolhas.
    3. Vá direto ao dia 1 (seção 2) do protocolo ndChIP-seq, ou flash congelar o centrifugado em nitrogênio líquido e loja a-80 ° C.

2. dia 1: ndChIP-seq

  1. Preparação do complexo anticorpo-grânulo
    1. Prepare um banho de água de 37 ° C e um balde de gelo. Trabalhando no gelo, preparar o tampão de x IP 1/1 x PIC e anticorpo (Ab) tampão de diluição 1x e mantê-los no gelo. Recupere A de proteína (ou G) grânulos magnéticos (veja a discussão de critérios de seleção) do armazenamento de 4 ° C e mistura muito bem suave pulso-num Vortex. Mantê-lo no gelo.
      Nota: Num pulso-Vortex significa num Vortex é interrompido toda vez que um vórtice completo é formado no tubo.
    2. Transferência 24 grânulos de magnético µ l de proteína A (ou G) por reação de IP em um novo tubo de 2 mL. Registrar o volume dos grânulos e mantenha o tubo no gelo. Exemplo, por 7 IPs, uso µ l 24 x 7 = 168 µ l.
    3. Colocar o tubo sobre o íman em forma de tubo e esperar a solução tornar-se clara indicando separação do grânulo. Sem perturbar os grânulos, cuidadosamente, remover o sobrenadante com uma pipeta e descarte. Pegue o tubo fora o íman em forma de tubo e colocá-lo no gelo.
    4. Adicione um volume igual (ou seja, volume inicial de grânulos) do buffer IP gelada + 1 x PIC misturar. Misture pipetando para cima e para baixo. Fazer não o vórtice.
    5. Coloque o IP reserva + 1 x PIC + grânulos de volta para o íman em forma de tubo e esperar que a solução se tornar clara separação de grânulo indicando. Sem perturbar os grânulos, cuidadosamente, remover o sobrenadante com uma pipeta e descarte. Repita buffer a frio IP + 1 X lavagem PIC duas vezes mais para um total de 3 lavagens.
    6. Após a lavagem final, resuspenda as contas em um volume igual (ou seja, volume inicial de grânulos) do buffer IP gelada + 1 x PIC misturar. Misture pipetando para cima e para baixo. Fazer não o vórtice. Mantenha o tubo no gelo.
    7. No gelo, despeje 10 mL de tampão IP + PIC em um reservatório em forma de V de 25 mL. Usando uma pipeta multicanal, adicionar 130 µ l de tampão IP gelada + 1 x mistura PIC em poços individuais de um poço-96 V-fundo limpo placa. Encha um poço por IP. Rotular a placa como "complexo de Ab-pérola".
    8. Adicionar 12 esferas magnéticas de µ l da A de proteína lavada (ou G) em cada bem contendo tampão IP + PIC e misturar pipetando para cima e para baixo. Manter as restantes contas lavadas no gelo.
    9. Obter validados os anticorpos de seu armazenamento frio e degelo no gelo, se necessário. Trabalhando no gelo, dilua os anticorpos com tampão de diluição 1x Ab para as concentrações mostradas na tabela 2.
    10. A cada poço da placa complexo Ab-grânulo, adicione 1 µ l do anticorpo adequado, diluído (tabela 1). Registro do poço para a chave de anticorpo. Usando a pipeta multicanal, misture cada linha pipetando subir e descer 20 vezes. Trocar dicas entre linhas. A Ab-grânulo complexa a placa do selo muito bem com uma tampa da placa de alumínio e incubar a 4 ° C em uma plataforma giratória pelo menos 2 h.
      Nota: Esta incubação possa prosseguir até estar pronto para começar a etapa 2.4.
  2. Digestão de Lise e cromatina celular
    1. Trabalhando no gelo, preparar o tampão de Lise 1x + 1 x PIC e 1 mL de MNase eu diluição buffer (tabela 3) e mantê-los no gelo.
    2. Recupere as pelotas de cela de seu armazenamento-80 ° C (ou de gelo, se preparados na hora). Descongele cada pellet de células em um banho de água de 37 ° C para um 10 s, então a transferência para o gelo.
    3. Para cada centrifugado imediatamente adicione gelada 1 x lise + 1 x PIC para uma concentração final de 10.000 células/20 µ l e misture 10 vezes pipetando cima e para baixo, sem criar bolhas. Por exemplo, para 70.000 células o volume final é 140 µ l.
    4. Trabalhando no gelo, alíquota 20 µ l/poço dos lysates resultantes em uma placa de 96 poços. Cubra o prato com um selo plástico e incubar no gelo por 20 min. rótulo a placa "MNase digestão" e gravar os poços para uma chave do modelo. Para assegurar um sincronismo exato da reação de digestão da cromatina, não proceda à digestão com mais de 2 linhas de amostras de cada vez.
    5. Pouco antes da lise de 20 min é completa, diluir o MNase eu enzima com MNase eu diluição do buffer, para uma concentração final de 20 U / µ l e mantê-lo no gelo.
    6. Trabalhando no gelo, preparar a MNase eu digestão mestre mistura de acordo com a tabela 4 e alíquota 20 µ l da mistura por cada linha de amostras mais volume morto de 5 µ l em uma linha de uma placa de 96 poços reservatório e mantê-lo no gelo. Para duas linhas, o volume deve ser: (20 µ l x 2) + 5 µ l = 45 µ l.
    7. Depois os lysates terminar incubando, retire a placa de digestão MNase de gelo. Usando uma pipeta multicanal, adicionar 20 µ l de MNase eu digestão mestre mistura em cada linha de amostras e misture 10 vezes pipetando para cima e para baixo. Trocar dicas entre linhas. Incube a temperatura ambiente por exatamente 5 min.
    8. Depois de 5 min, para parar a reação, use uma pipeta multicanal para adicionar 6 µ l de ácido etilenodiaminotetracético de 250 µM (EDTA) para cada linha de amostras e misture para cima e para baixo... algumas vezes. Trocar dicas entre linhas. Após adição de EDTA, mude a configuração da pipeta para 20 µ l e misture 10 vezes pipetando para cima e para baixo para garantir uma parada completa da reação de digestão. Trocar dicas entre linhas.
    9. Usando uma pipeta multicanal, a cada linha das amostras MNase digerido, adicione 6 µ l de 10x Lise e mistura bem pipetando acima e para baixo 10 vezes. Cubra com um selo plástico e incubar no gelo por 15 min.
  3. Pre-esclarecimento e separação de entrada
    1. Após a incubação de 15 min, trabalhando no gelo, piscina, todos os poços para a mesma célula da pelota/modelo em uma estéril, pré-refrigerados no gelo, tubo de 1,5 mL (pre-rotulado com o modelo de identificação) e misture completamente, mas lentamente, usando uma pipeta para evitar a formação de espuma detergente.
    2. Para cada célula da pelota/modelo, transferi 8 µ l da cromatina digerida em um novo estéril, tubo de 0,5 mL (pre-rotulado com o modelo de identificação) e loja a 4 ° C durante a noite. Isto servirá como o controle de entrada.
    3. Distribua o volume restante da cromatina digerido em 48 alíquotas µ l, em uma nova placa de 96 poços. Célula da pelota/modelo 1 entra em poços A01-A06, célula da pelota/modelo 2 entra em poços A07-A12, etc. Grave os poços para uma chave do modelo. Rotule a placa "Pre-esclarecimento".
    4. Usando uma pipeta multicanal, adicione 120 µ l de tampão de IP 1x + 1 x PIC e 12 µ l de grânulos magnéticos lavados de proteína A (ou G) em cada poço da placa de Pre-esclarecimento da etapa 2.3.3. Misture cada linha pipetando acima e para baixo 10 vezes. Trocar dicas entre linhas. A placa do selo muito bem com uma tampa da placa de alumínio e incubar em uma plataforma giratória em 4 ° C por um período mínimo de 2 h.
  4. Reação de imunoprecipitação
    1. Antes de iniciar esta etapa certifique-se que a Ab-grânulo complexo (etapa 2.1.10) e a Pre-esclarecimento chapa (etapa 2.3.4) tem incubados pelo menos 2 h. rápido girar ambas as placas por centrifugação de 10 s a 200 x g.
    2. Coloque a placa de complexo de Ab-grânulo (da etapa 2.1.10) sobre um íman em forma de placa e esperar 15 s para a solução tornar-se clara. Retire cuidadosamente e descartar o sobrenadante com uma pipeta sem perturbar os grânulos. Remover a placa de ímã a placa e mantê-lo no gelo.
    3. Coloque a placa de reação de Pre-esclarecimento (da etapa 2.3.4) sobre um íman em forma de placa e esperar 15 s para os grânulos separar e para a solução tornar-se clara. Sem perturbar os grânulos, transferi cuidadosamente o sobrenadante com uma pipeta para os poços correspondentes de Ab-esfera complexa placa mantida em gelo e misture suavemente 15 vezes por pipetagem para cima e para baixo. Selo, a placa de alumínio com tampa da placa e incubar durante a noite (12-18 h) a 4 ° C em uma plataforma giratória. Novo rótulo da placa "Reação de IP".

3. dia 2: ndCHIP-seq

  1. Lavagens e eluição
    1. Definir o misturador de aquecimento a 65 ° C. No gelo, prepare um tampão de lavagem de baixo teor de sal e o tampão de lavagem de elevado-sal. Rápido girar a placa de reação de IP da etapa 2.4.3 para 10 s a 200 x g.
    2. Coloque a placa de reação de IP sobre um íman em forma de placa e esperar 15 s para a solução tornar-se clara. Usando uma pipeta multicanal, sem perturbar os grânulos, cuidadosamente remover e descartar o sobrenadante. Pegue a placa de ímã a placa e colocá-lo no gelo.
    3. Para cada linha de amostras da placa de reação de IP, adicione 150 µ l de sal gelada lavar buffer e misture lentamente 10 vezes para cima e para baixo completamente Resuspenda os grânulos.
    4. Coloque a placa de reação de IP sobre o íman em forma de placa, esperar os grânulos separar e usando uma pipeta multicanal, sem perturbar os grânulos remover e descartar o sobrenadante. Coloque a placa de volta no gelo e repita as etapas 3.1.3 e 3.1.4 para um total de 2 lavagens.
    5. No gelo, para cada linha de amostras da placa de reação de IP, adicione 150 µ l de sal alto lavar buffer e misture lentamente 10 vezes pipetando para cima e para baixo completamente Resuspenda os grânulos.
    6. Coloque a placa de reação de IP sobre o íman em forma de placa, esperar os grânulos separar e usando uma pipeta multicanal, sem perturbar os grânulos remover e descartar o sobrenadante. Coloque a placa de reação de IP no gelo e pre-frio uma nova placa de 96 poços ao lado.
    7. Para cada linha de amostras da placa de reação de IP, adicione 150 µ l de sal alto lavar buffer e misture lentamente 10 vezes pipetando para cima e para baixo completamente Resuspenda os grânulos. Após ressuspensão, transferi cada linha das amostras para a linha correspondente da placa de novo, pre-refrigerada, 96 poços. Rotule a placa "Reação de IP". Descarte a placa velha.
    8. Coloque a placa de reação de IP nova sobre o ímã de placa e esperar que os grânulos separar. Usando uma pipeta multicanal, sem perturbar os grânulos, cuidadosamente remover e descartar o sobrenadante. Manter a placa na temperatura de quarto.
    9. Para cada linha de amostras da placa de reação de IP, adicionar 30 µ l de tampão de eluição do ChIP (EB) e misture lentamente 10 vezes pipetando para cima e para baixo. Certifique-se de evitar a formação de bolhas.
    10. Selar a placa bem com uma tampa PCR e incubá-los em um misturador de aquecimento a 65 ° C por 1,5 h com uma velocidade de mistura de 1.350 rpm.
    11. Após a incubação de 1,5 h, spin para baixo a placa de reação de IP a 200 x g por 1 min a 4 ° C. Altere a configuração do mixer de aquecimento para 50 ° C.
    12. Após a rodada, coloque a placa de reação de IP sobre um íman em forma de placa e esperar que a solução para limpar. Usando uma pipeta multicanal, sem perturbar os grânulos, transferi com cuidado 30 µ l do sobrenadante para uma nova placa de 96 poços. Use dicas frescas para cada linha. Rotular a placa "Reação de IP" e mantê-lo em temperatura ambiente.
  2. Digestão de proteínas
    1. Recuperar 30% PEG/1 M NaCl solução de17 (tabela de composição de tampão) magnética do grânulo do frigorífico a 4 ° C e mantê-lo em temperatura ambiente pelo menos 30 min. crítica: garantir que a solução do grânulo totalmente atinja a temperatura ambiente antes de prosseguir.
    2. Recupere amostras de controlo de entrada de armazenamento de 4 ° C (etapa 2.3.2) e volta rápida. Medir o volume usando uma pipeta e adicionar água ultrapura para cada controle de entrada para um volume final de 30 µ l. transferir as amostras de controle de entrada para os pré-selecionados entrados poços (poços vazios) da placa de reação (etapa 3.1.12) de IP. O poço para o exemplo de chave de registro.
    3. No gelo, prepare a proteína digestão Master Mix, conforme mostrado na tabela 5 e alíquota igual volume em uma linha de uma placa de 96 poços reservatório.
    4. Usando uma pipeta multicanal, a cada linha de amostras da placa de reação de IP, adicionar 40 µ l do Master de digestão de proteínas Mix e misture lentamente 10 vezes acima e para baixo. Selar a placa bem com uma tampa PCR, spin para baixo a 200 x g por 1 min e incubar em um misturador de aquecimento a 50 ° C por 30 min, defina a 650 rpm. Enquanto a placa está incubando, preparar fresco 70% de etanol (EtOH) e mantê-lo em temperatura ambiente.
    5. Após a incubação 30 min é completa, girar a placa de reação de IP a 200 x g por 1 min, 4 ° C. Manter a placa na temperatura de quarto.
      Nota: O volume total deve ser agora ~ 70 µ l/poço.
  3. Grânulo de limpar usando solução de esferas magnéticas de PEG/1 M NaCl 30%
    1. Alíquota a temperatura 30% de PEG/1 M NaCl magnética do grânulo solução em uma linha de uma placa de 96 poços limpo reservatório (75 µ l por amostra x n º de linhas).
    2. Trabalhando em temperatura ambiente, utilizando uma pipeta multicanal, adicione 70 µ l (proporção de 1:1) da solução magnética do grânulo PEG/1 M NaCl 30% para cada linha de amostras da placa de reação de IP e misture 10 vezes pipetando para cima e para baixo. Trocar dicas entre linhas. Incube a placa durante 15 minutos à temperatura ambiente.
    3. Colocar a placa sobre o ímã de placa e incubar durante 5 min permitir que os grânulos separar.
    4. Utilizando uma pipeta, sem perturbar os grânulos, cuidadosamente remover e descartar o sobrenadante. Manter as contas.
    5. Enquanto a placa de reação de IP é ainda sobre o ímã de placa, usando uma pipeta multicanal, a cada linha de amostras, adicionar 150 µ l de temperatura 70% EtOH e incube por 30 s. Após 30 s, com uma pipeta multicanal, remover e descartar o sobrenadante. Repita essa etapa mais uma vez, para um total de 2 lavagens.
    6. Após a segunda lavagem de EtOH, incube a placa 'seca' sobre o ímã da placa por 3 min. Inspecione visualmente a placa para certificar-se de que todos o EtOH é evaporado. Se não, incubar a placa por 1 min. ressecamento dos resultados de grânulos em um rendimento mais baixo.
    7. Pegue a placa de ímã a placa e com uma pipeta multicanal, adicione 35 µ l EB (Tabela de materiais). Misture bem pipetando acima e para baixo 10 vezes. Trocar dicas entre linhas. Incube a temperatura ambiente por 3 min eluir.
    8. Após a incubação, colocar a placa de reação de IP sobre o íman em forma de placa e incubar por 2 min. Devem separar as contas e a solução se tornará clara.
    9. Usando uma pipeta multicanal, sem perturbar os grânulos, transferi com cuidado o sobrenadante para os poços correspondentes de uma nova placa de 96 poços.
    10. A placa com uma tampa da placa de alumínio do selo, etiqueta "IPed + entrada de DNA" e armazenar a 4 ° C durante a noite, ou a-20 ° C para longo prazo (> 48 h) armazenamento.

4. dia 3: Construção de biblioteca

  1. Fosforilação e reparação final
    1. A entrada para a reação final reparação/fosforilação é o IPed + entrada placa da etapa 3.3.10. Após o descongelamento, girar a placa para baixo a 200 x g por 1 min a 4 ° C e mantê-lo no gelo.
    2. Recupere-se do congelador-20 ° C todos os reagentes (exceto enzimas) necessário para a reação final reparação/fosforilação (tabela 6) e descongelação-los à temperatura ambiente, em seguida, transferir imediatamente para o gelo.
    3. Trabalhando no gelo, siga a tabela 6 para configurar o mestre de reparação/fosforilação final Mix em um tubo estéril, de microcentrifuga de 1,5 mL. Após a adição de todos os componentes não-enzimática, misture bem por pulso-utilização do Vortex e coloque o tubo de volta no gelo.
    4. Recupere as enzimas relevantes de seu armazenamento frio e transporte para o banco em um rack de cool tubo refrigerados. Misture cada enzima por agredir o tubo, girar rápido e coloque-o no refrigerados suporte legal. Quando Pipetar a enzima, Aspire lentamente para garantir uma transferência de volume exato. Após a adição, lave a ponta no mix mestre pipetando para cima e para baixo.
    5. Uma vez que as enzimas são adicionadas, suavemente, pulso-vórtice o mestre misturar 5 vezes para assegurar uma distribuição uniforme de todos os componentes, em seguida, volta rápida e imediatamente coloque o tubo de volta no gelo.
    6. No gelo, alíquota um volume adequado da mistura final reparação/fosforilação mestre em uma linha de uma nova placa de 96 poços reservatório; volume a ser aliquotadas: (15 µ l x n º de linhas) + 5 µ l volume morto. Um cálculo de exemplo para duas linhas: (15 µ l x 2) + 5 µ l = 35 µ l/poço.
    7. Usando uma pipeta multicanal, adicionar 15 µ l da mistura final reparação/fosforilação mestre para cada linha de amostras e misture 10 vezes pipetando para cima e para baixo. Trocar dicas entre linhas. A placa com uma tampa plástica do selo, spin para baixo a 200 x g por 1 min a 4 ° C e incubar a temperatura ambiente por 30 min.
  2. Grânulo limpar após reparação final e fosforilação
    1. Na geladeira de 4 ° C, recuperar a solução de magnética do grânulo de PEG/1 M NaCl 20% e 30% solução de PEG/1 M NaCl e incubar a temperatura ambiente pelo menos 30 min.
      Nota: A solução de PEG/1 M NaCl 30% que não contêm grânulos magnéticos.
    2. Depois de ambas as soluções atingirem a temperatura, para cada amostra prepare 80 µ l de mistura 1:2, de 30% de PEG/1 M NaCl e soluções de magnética do grânulo de PEG/1 M NaCl 20%. Um exemplo para 24 amostras: 80 µ l x 24 = 1.920 µ l (640 µ l de 30% PEG/1 M NaCl e 1.288 µ l das soluções de esferas magnéticas de PEG/1 M NaCl 20%).
    3. Alíquota da solução do grânulo misturar, volume igual, em uma linha de uma placa de 96 poços reservatório e mantê-lo em temperatura ambiente. Alíquota tampão EB (40 µ l por amostra x n º de linhas) em uma linha de uma placa de 96 poços limpo reservatório. Um exemplo para duas linhas: 40 µ l x 2 = 80 µ l/poço.
    4. Usando uma pipeta multicanal, adicione 75 µ l da mistura do grânulo preparada no passo 4.2.2 para cada linha de amostras da etapa 4.1.7 e misturar acima e para baixo 10 vezes. Trocar dicas entre linhas. Incube a temperatura ambiente por 15 min. Continue com o procedimento de limpeza do grânulo, conforme descrito em etapas 3.3.3-3.3.10. Cubra o prato com um selo plástico, volta rápida e colocá-lo no gelo. Siga para o passo 4.3.
  3. Rejeito-A reação
    1. Recuperar do congelador-20 ° C todos os reagentes (exceto enzimas) necessário para a reação de A-Tailing (tabela 7), descongelá-los à temperatura ambiente, em seguida, transferir imediatamente para o gelo.
    2. Trabalhando no gelo, siga a tabela 7 para configurar o A-Tailing Master Mix em um tubo estéril, de microcentrifuga de 1,5 mL. Siga as instruções de instalação de fermentação enzimática geral conforme descrito em etapas 4.1.4-4.1.6.
    3. Usando uma pipeta multicanal, adicionar 15 µ l do Mix Master A-Tailing para cada linha de amostras e misture 10 vezes pipetando para cima e para baixo. Trocar dicas entre linhas. A placa com uma tampa PCR do selo, spin para baixo a 200 x g por 1 min a 4 ° C e incubar em um thermocycler a 37 ° C por 30 min. Após a incubação, girar a placa para baixo a 200 x g por 1 min e mantê-lo em temperatura ambiente.
  4. Grânulo limpar após A-Tailing
    1. Execute as etapas descritas na etapa 4.2. Cubra o prato com um selo plástico, volta rápida do rótulo "-cauda + BC," e colocá-lo no gelo. Prossiga para a etapa 4.5.
  5. Ligadura de adaptador
    1. Recuperar do congelador-20 ° C todos os reagentes (exceto enzimas) necessário para a reação de ligadura do adaptador (tabela 8), descongelá-los à temperatura ambiente, em seguida, transferir imediatamente para o gelo.
    2. Recuperar a 10 µM PE adaptador (quadro suplementar 1) solução e diluir a 0,5 µM usando EB. Misture bem por num Vortex de pulso. O volume exigido é de 3 µ l x n º de amostras. Trabalhando no gelo, alíquota do adaptador de 0,5 µM PE, volume igual, em 12 poços de uma placa de 96 poços limpo reservatório. Mantê-lo no gelo.
    3. Trabalhando no gelo, siga a tabela 8 para configurar o adaptador da ligadura Master Mix em um tubo estéril, de microcentrifuga de 1,5 mL. Siga as instruções de instalação de fermentação enzimática geral conforme descrito em etapas 4.1.4-4.1.6. Certifique-se que o 5 X rápida da ligadura Buffer é totalmente descongelado e muito bem misturado antes do uso.
    4. No gelo, alíquota um volume adequado do adaptador da ligadura Master Mix em uma linha de uma nova placa de 96 poços reservatório. Por exemplo, o cálculo para duas linhas: (23 µ l x 2) + 5 µ l = 51 µ l/poço. Manter a placa no gelo.
    5. Usando uma pipeta multicanal, adicionar 2 µ l a 0,5 µm adaptador emparelhado final (PE) em cada linha de amostras da etapa 4.4.1 e mistura. Trocar dicas entre linhas.
    6. Usando uma pipeta multicanal, adicionar 23 µ l do Mix adaptador ligadura mestre para cada linha de amostras e misturar 15 vezes pipetando para cima e para baixo. Trocar dicas entre linhas. Selar a placa com uma tampa de metal, rótulo "Ligadura", spin-down a 200 x g por 1 min a 4 ° C e incubar à temperatura ambiente durante a noite.
  6. Dia 4: Grânulo limpar #1 após ligadura do adaptador
    1. Na geladeira de 4 ° C, recuperar a solução de esferas magnéticas de PEG/1 M NaCl 20% e incubar a temperatura ambiente pelo menos 30 min. Enquanto a solução é desenroscada preparar fresco 70% EtOH.
    2. Alíquota da solução de magnética do grânulo de PEG/1 M NaCl 20%, 55 µ l, por exemplo, em uma linha de um reservatório de 96 poços da placa e mantê-lo em temperatura ambiente. Um exemplo para duas linhas: 55 µ l x 2 = 110 µ l/poço.
    3. Alíquota tampão EB, 50 µ l, por exemplo, em uma linha de uma placa de 96 poços limpo reservatório. Um exemplo para duas linhas: 50 µ l x 2 = 100 µ l/poço.
    4. Usando uma pipeta multicanal, adicionar 48 µ l da solução de esferas magnéticas de PEG/1 M NaCl 20% em cada linha das amostras da placa da ligadura da etapa 4.5.6 e misturar acima e para baixo 10 vezes. Trocar dicas entre linhas. Incube a temperatura ambiente por 15 min. Continue com o procedimento de limpeza do grânulo, conforme descrito em etapas 3.3.3-3.3.7.
    5. Pegue a placa de ímã a placa e com uma pipeta multicanal, adicione µ l 45 EB (Tabela de materiais). Misture bem pipetando acima e para baixo 10 vezes. Trocar dicas entre linhas. Incube durante a temperatura ambiente por 3 min eluir.
    6. Após a incubação, coloque o prato de reação de IP sobre o íman em forma de placa e incubar por 2 min. com uma pipeta multicanal, sem perturbar os grânulos, transferir com cuidado o sobrenadante para os poços correspondentes de uma nova placa de 96 poços. Rotule a placa "Ligadura + 1 A.C.".
    7. A cada poço Adicione 5 µ l de tampão de alta fidelidade 10 x PCR e misture bem pipetando para cima e para baixo. Trocar dicas entre linhas. Cubra o prato com um selo plástico, volta rápida e mantê-lo em temperatura ambiente.
  7. Grânulo limpar #2 após ligadura do adaptador
    1. Executar limpeza do grânulo, conforme descrito na seção 4.6, com as seguintes alterações: Adicionar 60 µ l de solução de magnética do grânulo de PEG/1 M NaCl 20% a cada poço ativo na ligadura + placa de 13:00 (etapa 4.6.7) e eluir de grânulos usando 35 µ l de tampão EB. Rotular a placa "Ligadura + 2 A.C." e mantê-lo no gelo.
  8. Amplificação por PCR
    1. Recuperar do congelador a-20 ° C todos os reagentes (exceto enzimas) necessários para a reação de PCR (tabela 9), descongelá-los à temperatura ambiente, em seguida, imediatamente, coloque-os em gelo.
    2. Trabalhando no gelo, siga a tabela 9 para configurar o PCR Master Mix em um tubo estéril, de microcentrifuga de 1,5 mL. Siga as instruções de instalação de fermentação geral conforme descrito em etapas 4.1.4-4.1.5. No gelo, um volume adequado do PCR Master Mix em uma linha de uma nova placa de 96 poços reservatório de alíquota. Mantê-lo no gelo. Consulte a etapa 4.5.4 para cálculos de amostra.
    3. Trabalhando no gelo, usando uma pipeta multicanal, adicionar 2 µ l de cada único 12,5 µM PCR reverso de indexação da primeira demão (Supplemental tabela 2) em cada poço na ligadura + placa 2 A.C. (etapa 4.7.1) e misture lentamente acima e para baixo. Trocar dicas entre linhas. Manter a placa no gelo.
    4. Trabalho no gelo, usando uma pipeta multicanal, adicionar 23 µ l do mix mestre PCR em cada linha de amostras da etapa 4.8.3 e mistura 10 vezes pipetando para cima e para baixo. A placa com uma tampa PCR do selo, girá-lo para baixo a 200 x g por 1 min e incubar em um thermocycler (ver tabela 10 para ciclismo condições do PCR).
  9. Grânulo limpar após amplificação por PCR
    1. Após a amplificação por PCR girar a placa a 200 x g por 1 min, 4 ° C. Executar o grânulo limpeza conforme descrito na seção 4.6, com as seguintes alterações: Adicionar 51 µ l de solução de magnética do grânulo de PEG/1 M NaCl 20% para cada reação de PCR e eluir de grânulos usando 25 µ l de tampão EB. A placa com uma tampa de alumínio do selo e spin para baixo a 200 x g por 1 min. loja as amostras a-20 ° C.
    2. Para validar construídas bibliotecas, realizar a quantificação de DNA usando um ensaio baseado em fluorescência, Visualizar o produto final usando um analisador de chip baseada em eletroforese capilar (teste de alta sensibilidade) e executar o enriquecimento PCR quantitativo (qPCR) (ver Resultados de representante, validação de qualidade de biblioteca ndChIP-seq por qPCR).

Representative Results

Perfis de digestão da cromatina
Otimização da digestão MNase é essencial para o sucesso do presente protocolo. É crucial para gerar um perfil de digestão dominado por tamanhos de fragmento único nucleossoma, enquanto não over digerido, para permitir a recuperação de fragmentos de nucleossoma de ordem superiores. Um perfil ideal de digestão consiste de uma maioria de fragmentos nucleossoma único com uma pequena fração que representa fragmentos menores e maiores do que os nucleossomas único. A Figura 1 mostra exemplos de um tamanho ideal, excesso digerido e digerido sob perfis de distribuição. Observe que sub-ótimo digestão da cromatina também será evidente no perfil da biblioteca de sequenciamento, gerado a partir do material IP (Figura 2).

Validação da qualidade de biblioteca ndChIP-seq por qPCR
qPCR é um método bem estabelecido para avaliação da qualidade do ChIP18,19,20. Quando executando ndChIP-seq em 10.000 células o rendimento do ácido nucleico após IP será abaixo de 1 ng. Portanto, é essencial para executar qPCR após a construção da biblioteca para avaliar o enriquecimento relativo de regiões-alvo sobre o plano de fundo. Para fornecer uma estimativa do fundo, bibliotecas, construídas a partir da cromatina MNase digerido (entrada) são geradas. Para cada biblioteca IP, dois conjuntos de primers são necessários (ver suplementartabela 3 para obter uma lista dos primers para marcas de histona comumente usados). Um conjunto de primeira demão deve ser específico para uma região genômica consistentemente associado com a modificação do histone de interesse (alvo positivo) e uma outra região que não está marcada com a modificação do histone de interesse (alvo negativo). Como dobrar o enriquecimento com relação a entrada biblioteca será avaliada a qualidade da biblioteca de ChIP-seq. Enriquecimento de dobra pode ser calculado usando a seguinte equação que assume uma amplificação exponencial da região genômica alvo: 2Ctentrada-CtIP. Nosso costume feito pacote de software estatístico R, qcQpcr_v1.2, é adequado para análise de enriquecimento qPCR de baixa entradas bibliotecas nativas de ChIP-seq (Arquivos de código suplementar). A Figura 3 representa um resultado de qPCR para bibliotecas de ChIP-seq bem-sucedidas e malsucedidas. O valor de enriquecimento mínimo esperado dobra para bibliotecas de ndChIP-seq de boa qualidade são 16 por Marcos estreitos, tais como H3K4me3 e 7 para grandes marcas, por exemplo, H3K27me3.

Modelagem MNase acessibilidade
Análise computacional de ChIP-seq é complexo e único para cada configuração experimental. Um conjunto de diretrizes estabelecidas pela International Consortium de Epigenomic humano (IHEC) e o livre de DNA elementos (ENCODE) pode ser usado para avaliar a qualidade do ChIP-seq bibliotecas21. É importante observar que a profundidade de sequenciamento de bibliotecas impacta a detecção e resolução de regiões enriquecido20. O número de picos detectados aumento e aproxima-se um platô com o aumento da profundidade de leitura. Nós recomendamos ndChIP-seq bibliotecas a ser sequenciado em conformidade com as recomendações do IHEC de 50 milhões emparelhado-leituras (fragmentos de 25 milhões) para estreitas marcas (por exemplo, H3K4me3) e 100 milhões emparelhado-leituras (fragmentos de 50 milhões) para grandes marcas ( por exemplo,, H3K27me3) e22de entrada. Estas profundidades de sequenciamento fornecem suficiente alinhamentos de sequência para a deteção dos picos mais significativos usando amplamente usado ChIP-seq chamadores de pico, como MACS2 e Homero, sem atingir a saturação23,24. Uma biblioteca de mamíferos ndChIP-seq de alta qualidade tem uma taxa de PCR duplicada de < referência e 10% taxa de alinhamento do genoma de > 90% (incluindo leituras duplicadas). Bibliotecas de sucesso ndChIP-seq irão conter repetições altamente correlacionadas com uma parcela significativa (> 40%) dos picos de leituras alinhadas dentro MACS222 identificadas enriquecidos e inspeção de leituras alinhadas em um navegador de genoma deve revelar visualmente detectáveis avanços em relação à biblioteca de entrada (Figura 4). Além disso, ndChIP-seq pode ser utilizada para avaliar a densidade nucleossoma, utilizando um algoritmo de distribuição gaussiana mistura (w1 * n(x; Μ 1,σ1) + w2 * n(x; μ2, σ2) = 1) na MACS2 identificada regiões enriquecidas à densidade do nucleossoma modelo conforme definido por limites acessíveis MNase. Neste modelo, w1 representa a distribuição de mono-nucleossoma peso e w2 representa o peso de distribuição di-nucleossoma. Onde w1 é maior do que w2, há predominância de fragmentos de mono-nucleossoma e vice-versa. Esta análise requer que bibliotecas ser sequenciados de forma emparelhado-fim para que o fragmento tamanhos podem ser definidos. Para aplicar o algoritmo de distribuição gaussiana mistura, regiões enriquecidas estatisticamente significantes primeiro são identificadas. Sugerimos a vocação do pico, com MACS2, usando a entrada como um controle e com as configurações padrão para marcas estreitas e um limite de valor q de 0,01 para grandes marcas. Um número de pacotes estatísticos, empregando um algoritmo de distribuição gaussiana mistura está disponível a partir de pacotes de software estatísticos amplamente utilizado. Utilizando o tamanho médio do fragmento, determinado por limites de leitura emparelhada-fim das amostras IPed, distribuições no MACS2 identificaram promotores enriquecidos, e um algoritmo de distribuição gaussiana de mistura pode ser aplicado a cada promotor usando o pacote R-estatística Mclust versão 3.025 para calcular uma distribuição ponderada. Nesta aplicação, recomendamos eliminar promotores contendo menos de 30 fragmentos alinhados porque abaixo deste limiar, o peso resultante estimativas tornar-se confiável. Uma biblioteca de ndChIP-seq de boa qualidade gera uma distribuição gaussiana mistura que consistem em dois componentes principais com valores médios correspondentes a mono-, comprimentos de fragmento de di-nucleossoma.

Figure 1
Figura 1 : Avaliação da digestão MNase antes geração biblioteca. Perfis de analisador chip baseada em eletroforese capilar de um ideal MNase digerido (A), sob-digerido (B) e digerido over (C) da cromatina. Réplicas biológicas são mostradas como traços de azuis, vermelhos e verdes. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : Avaliação da digestão MNase após a geração de biblioteca. (A) postar perfis de construção de biblioteca de entrada otimamente digerida (réplicas biológicas; vermelho, verde, preto) e IP (réplicas biológicas; ciano, roxo, azul) e (B) entrada sub-ótimo (réplicas biológicas; vermelho, verde, azul) e IP ( réplicas biológicas; bibliotecas de ciano, roxas, laranja). Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : Pós construção biblioteca PCR quantitativo pode ser usado para avaliar a qualidade das bibliotecas ndChIP-seq. Enriquecimento de dobra das bibliotecas H3K4me3 IP com respeito a bibliotecas de entrada é calculado como 2(Ct de entrada - Ct de IP) para alvos positivos e negativos, usando qcQpcr_v1.2. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4 : NdChIP-seq representante biblioteca construída a partir de 10.000 primárias CD34+ cabo glóbulos. Correlação de Pearson do sinal de H3K4me3 (leituras por milhão leituras mapeadas) calculado em promotores (TSS + /-2Kb) entre 3 réplicas biológicas, replicar (A) 1 e 2, (B) replicar 1 e 3, replicar (C) 2 e 3. (D) UCSC exibição de navegador do cluster do gene HOXA de reticulado ChIP-seq gerados a partir de 1 milhão de células por IP, ndChIP-seq bem sucedida de 10.000 células por IP e ndChIP-seq malsucedido de 10.000 células por IP. (vermelho: H3K27me3, verde: H3K4me3 e preto: entrada). (E) fração de leituras mapeadas dentro MACS2 identificadas regiões enriquecidas de H3K4me3 (preto) e H3K27me3 (cinza). Clique aqui para ver uma versão maior desta figura.

Composição do tampão
A. 1. amortecedor da imunoprecipitação (IP)
pH de 20 mM Tris-HCl 7.5
2 mM EDTA
150 mM NaCl
0,1% Triton X-100
0,1% Deoxycholate do
Butirato de sódio de 10 mM
A. 2. Low sal tampão de lavagem
pH de 20 mM Tris-HCl 8.0
2 mM EDTA
150 mM NaCl
1% Triton X-100
0,1% SDS
A. 3. o tampão de lavagem de sal elevado
pH de 20 mM Tris-HCl 8.0
2 mM EDTA
500 mM NaCl
1% Triton X-100
0,1% SDS
Tampão de eluição do ChIP a. 4.
100 mM NaHCO3
1% SDS
A. 5. 1 x tampão de Lise – 1 mL
0,1% Triton
0,1% Deoxycholate do
Butirato de sódio de 10 mM
Tampão de diluição de Ab 6.
0,05% (p/v) de azida
0,05% amplo espectro antimicrobiano (por exemplo, ProClin 300)
em PBS
A. 7. 30% PEG / 1M NaCl solução magnética do grânulo (referência16)
PEG-30%
1 M NaCl
10 mM Tris HCl pH 7.5
1 mM EDTA
1 mL de lavado super paramagnéticos grânulos
8. 20% PEG / 1M NaCl solução magnética do grânulo (referência16)
PEG-30%
1 M NaCl
10 mM Tris HCl pH 7.5
1 mM EDTA
1 mL de lavado super paramagnéticos grânulos

Tabela 1: composição de tampão de ndChIP-seq.

Modificação de histona Concentração (µ g / µ l)
H3K4me3 0,125
H3K4me1 0.25
H3K27me3 0,125
H3K9me3 0,125
H3K36me3 0,125
H3K27ac 0,125

Tabela 2: Quantidade de anticorpo necessária para ndChIP-Seq

Reganet Volume (µ l)
Água ultra pura 478
1 M Tris-HCl pH 7.5 10
0.5 EDTA DE M 10
NaCl 5 M 2
Glicerol 500
Volume total 1.000

Tabela 3: Receita de tampão de diluição de MNase.

Reagente Volume (µ l)
Água ultra pura 13
20 mM DTT 1
10x Buffer MNase 4
20 Mnase U / µ l 2
Volume total 20

Tabela 4: Receita para MNase Master Mix.

Reagente Volume (µ l)
Tampão de eluição 30
Tampão G2 8
Protease 2
Volume total 40

Tabela 5: Receita para mistura de mestre de purificação de DNA.

Reagente Volume (µ l)
Água ultra pura 3.3
10x Buffer Endonuclease de restrição (por exemplo, NEBuffer) 5
ATP de 25 mM 2
dNTPs 10 mM 2
T4 Quinase de polinucleotido (10 U / µ l) 1
T4 DNA polimerase (3 U / µ l) 1.5
DNA polimerase I, o grande (Klenow) fragmento (5 U / µ l) 0.2
Volume total 15

Tabela 6: Receita para mestre de reparação final Mix.

Reagente Volume (µ l)
Água ultra pura 8
10x Buffer Endonuclease de restrição (por exemplo, NEBuffer) 5
10 mM dATP 1
Klenow (3' - 5' exo-) 1
Volume total 15

Tabela 7: Receita para A-Tailing Master Mix.

Reagente Volume (µ l)
Água ultra pura 4.3
5 x tampão de ligação rápida 12
T4 DNA ligase (2000 U / µ l) 6.7
Volume total 23

Tabela 8: Receita para adaptador ligadura Master Mix.

Reagente Volume (µ l)
Água ultra pura 7
25 hum primer PCR 1.0 2
5 x tampão HF 12
DMSO 1.5
DNA polimerase 0,5
Volume total 23

Tabela 9: Receita para PCR Master Mix.

Temprature (° C) Duração (s) Número de ciclos
98 60 1
98 30
65 15 10
72 15
72 300 1
4 Segure Segure

Quadro 10: PCR executar método.

Oligo Sequência de Modificação
PE_adapter 1 5'-5Phos/GAT CGG AAG AGC GGT TCA GCA GGA ATG CCG AG -3 ' 5' modificação: fosforilação
PE_adapter 2 5' - ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TC * T - 3' 3' modificação: * T é um laço phosphorothioate

Suplementar tabela 1: Oligo sequências para geração de adaptador de PE.

Nome da primeira demão Sequência de Índice IndexRevC (a ser usado para sequenciamento)
Cartilha de indexação reversa de PCR 1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGTGAT atcacg
Cartilha de indexação reversa de PCR 2 CAAGCAGAAGACGGCATACGAGATCTGATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGATC gatcag
Cartilha de indexação reversa de PCR 3 CAAGCAGAAGACGGCATACGAGATGGGGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGGGTT aacccc
Cartilha de indexação reversa de PCR 4 CAAGCAGAAGACGGCATACGAGATCTGGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGGGT acccag
Cartilha de indexação reversa de PCR 5 CAAGCAGAAGACGGCATACGAGATAGCGCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCGCT agcgct
Cartilha de indexação reversa de PCR 6 CAAGCAGAAGACGGCATACGAGATCTTTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTTTTG caaaag
Cartilha de indexação reversa de PCR 7 CAAGCAGAAGACGGCATACGAGATTGTTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGTTGG ccaaca
Cartilha de indexação reversa de PCR 8 CAAGCAGAAGACGGCATACGAGATAGCTAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCTAG ctagct
Cartilha de indexação reversa de PCR 9 CAAGCAGAAGACGGCATACGAGATAGCATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCATC gatgct
Cartilha de indexação reversa de PCR 10 CAAGCAGAAGACGGCATACGAGATCGATTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGATTA taatcg
Cartilha de indexação reversa de PCR 11 CAAGCAGAAGACGGCATACGAGATCATTCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CATTCA tgaatg
Cartilha de indexação reversa de PCR 12 CAAGCAGAAGACGGCATACGAGATGGAACTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGAACT agttcc
Cartilha de indexação reversa de PCR 13 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ACATCG cgatgt
Cartilha de indexação reversa de PCR 14 CAAGCAGAAGACGGCATACGAGATAAGCTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AAGCTA tagctt
Cartilha de indexação reversa de PCR 15 CAAGCAGAAGACGGCATACGAGATCAAGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CAAGTT aacttg
Cartilha de indexação reversa de PCR 16 CAAGCAGAAGACGGCATACGAGATGCCGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCCGGT accggc
Cartilha de indexação reversa de PCR 17 CAAGCAGAAGACGGCATACGAGATCGGCCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGGCCT aggccg
Cartilha de indexação reversa de PCR 18 CAAGCAGAAGACGGCATACGAGATTAGTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TAGTTG caacta
Cartilha de indexação reversa de PCR 19 CAAGCAGAAGACGGCATACGAGATGCGTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCGTGG ccacgc
Cartilha de indexação reversa de PCR 20 CAAGCAGAAGACGGCATACGAGATGTATAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GTATAG ctatac
Cartilha de indexação reversa de PCR 21 CAAGCAGAAGACGGCATACGAGATCCTTGCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CCTTGC gcaagg
Cartilha de indexação reversa de PCR 22 CAAGCAGAAGACGGCATACGAGATGCTGTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCTGTA tacagc
Cartilha de indexação reversa de PCR 23 CAAGCAGAAGACGGCATACGAGATATGGCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ATGGCA tgccat
Cartilha de indexação reversa de PCR 24 CAAGCAGAAGACGGCATACGAGATTGACATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGACAT atgtca

Suplementar tabela 2: PCR reversa indexação sequências da primeira demão.

Primeiras demão Sequência de
ZNF333_genic_H3K9me3_F 5'-AGCCTTCAATCAGCCATCATCCCT-3'
ZNF333_genic_H3K9me3_R 5'-TCTGGTATGGGTTCGCAGATGTGT-3'
HOXA9-10_F 5'-ACTGAAGTAATGAAGGCAGTGTCGT-3'
HOXA9-10_R 5'-GCAGCAYCAGAACTGGTCGGTG-3'
GAPDH_genic_H3K36me3_F 5'-AGGCAACTAGGATGGTGTGG-3'
GAPDH_genic_H3K36me3_R 5'-TTGATTTTGGAGGGATCTCG-3'
GAPDH-F 5'-TACTAGCGGTTTTACGGGCG-3'
GAPDH-R 5'-TCGAACAGGAGGAGCAGAGAGCGA-3'
Modificação de histona Alvo positivo Alvo negativo
H3K4me3 GAPDH HOXA9-10
H3K4me1 GAPDH_genic ZNF333
H3K27me3 HOXA9-10 ZNF333
H3K27ac GAPDH ZNF333
H3K9me3 ZNF333 HOXA9-10
H3K36me3 GAPDH_genic ZNF333

Suplementar tabela 3: Uma lista de primers para marcas de histona comumente utilizados (H3K4me3, H3K4me1, H3K27me3, H3K27ac, H3K9me3 e H3K36me3).

Arquivo suplementar 1: planilha de ndChIP-seq. Clique aqui para baixar este arquivo.

Arquivos de código suplementar: qcQpcr_v1.2. Pacote de software estatístico R para análise de enriquecimento qPCR de baixas bibliotecas nativas entradas de ChIP-seq. Clique aqui para baixar este arquivo.

Discussion

Dada a natureza combinatória de modificação da cromatina e nucleossoma posicionamento no Regulamento transcriptional, um método que permite medições simultâneas desses recursos é susceptível de fornecer novos insights sobre regulamento epigenético. O ndChIP-seq apresentado aqui é um protocolo de ChIP-seq nativo otimizado para habilitar o interrogatório simultâneo das modificações de histona e densidade nucleossoma em raras células primárias9,10. ndChIP-seq utiliza digestão enzimática da cromatina que, quando acoplado ao sequenciamento maciçamente paralelo emparelhado-final e um modelo de distribuição gaussiana mistura, permite para as modificações do histone de investigação a nível único nucleossoma e o deconvolução de perfis epigenomic impulsionada pela heterogeneidade dentro de uma população. Usando este protocolo, anteriormente informamos uma única distribuição de tamanhos de fragmento imuno-precipitado, determinado pelo emparelhado-fim ler limites, associados com Estados de cromatina específico definidos pelo ChromHMM10,24.

A qualidade de uma biblioteca ndChIP-seq depende de vários fatores, tais como a especificidade do anticorpo e sensibilidade, condições ideais de digestão de MNase e qualidade da cromatina. A especificidade dos anticorpos usados é crucial na produção de biblioteca ndChIP-seq bem sucedida. Um anticorpo ideal mostra afinidade elevada contra o epítopo de interesse com pouca reactividade cruzada com os outros resumos. É igualmente importante escolher grânulos magnéticos com a mais alta afinidade para o anticorpo de escolha.

MNase digestão é uma reação crítica e tempo de concentração-sensível - e neste protocolo. Portanto, ao processar várias amostras, é importante que cada reação é incubada por uma quantidade equivalente de tempo (Veja o passo 2.2). A qualidade da cromatina é outro fator que afeta significativamente o resultado da ndChIP-Seq fragmentado cromatina leva um perfil de digestão MNase sub-ótimo e resultados nas bibliotecas com um baixo sinal à relação de ruído. Amostras primárias com baixa viabilidade celular ou degradados da cromatina, tais como tecido de (FFPE) parafina fixada em formol não são recomendados para este protocolo.

A adição de um PIC durante a extração de cromatina reduz indesejada (ou seja, aleatórios) cromatina fragmentação e preserva integridade de caudas de histona. Como tal, precisa ter ser adicionado a Lise e amortecedor da imunoprecipitação antes de usar. Enquanto selecionando células através da citometria de fluxo, selecione para células viáveis e certifique-se de células são classificadas em uma baixa taxa de fluxo para aumentar a precisão da estimativa de número de célula e a viabilidade das células. Evite a classificação de células diretamente em Lise. O buffer de bainha diluirá a Lise e impede a efetiva permeabilização da membrana celular para MNase. Dependendo de um tipo de células ou organismo, titulação de MNase pode ser necessária para obter a melhor digestão.

ndChIP-seq em células de mamíferos requer uma profundidade mínima de sequenciamento de 50 milhões emparelhado-leituras (fragmentos de 25 milhões) para marcas estreitas e 100 milhões emparelhado-leituras (fragmentos de 50 milhões) para entrada e grandes marcas. O algoritmo de distribuição gaussiana mistura não executará otimamente em bibliotecas que têm sido sequenciadas a uma profundidade significativamente abaixo esta recomendação. ndChIP-seq não classificará os promotores com pouca separação entre o valor de distribuição ponderada para comprimentos de fragmento de mono - e di-nucleossoma em mono - ou di-nucleossoma dominado promotores. Portanto, esses promotores devem ser removidos na análise subsequente. Réplicas biológicas podem ser geradas para aumentar a confiança nas distribuições previstas e identificar a variabilidade técnica na construção MNase digestão e biblioteca.

Ao contrário de iterações anteriores dos protocolos de ChIP-seq nativos, ndChIP-seq fornece os meios para investigar o efeito combinatório de modificação de estrutura e histonas cromatina utilizando imunoprecipitação de post de tamanho de fragmento para integrar a densidade nucleossoma, determinado pela acessibilidade de MNase, com medidas de modificação de histona. Aplicação de ndChIP-seq de células primárias e tecidos fornecerá novos insights sobre a natureza Integrativa do Regulamento epigenética e permitir a identificação de assinaturas epigenéticas devido à heterogeneidade da população.

Disclosures

Os autores declaram que eles têm não tem interesses financeiro concorrente.

Acknowledgements

A.L. foi apoiado por uma bolsa de estudos de pós-graduação canadense dos institutos canadenses de pesquisa em saúde. Este trabalho foi apoiado por concessões do genoma British Columbia e o canadense institutos de pesquisa em saúde (CIHR-120589) como parte da epigenética canadense, ambiente e iniciativa de consórcio de pesquisa de saúde e pelo programa de Instituto de pesquisa de Terry Fox Projeto Grant #TFF-122869 M.H. e Instituto de pesquisa do Terry Fox novo investigador prêmio (Grant # 1039) para M.H.

Materials

Name Company Catalog Number Comments
1M Tris-HCl –pH 7.5 Thermo Scientific 15567-027
1M Tris-HCl –pH 8 Thermo Scientific 15568-025
0.5M EDTA Thermo Scientific AM9260G
5M NaCl Sigma 1001385276
Triton X-100 Sigma 1001412354
Sodium-Deoxycholate Sigma 1001437582
SDS Thermo Scientific 15525-017
Sodium-Bicarbonate Fisher Scientific S233-500
100% EtOH NA NA
V-bottom 96 well plate (AB 1400) Thermo Scientific AB-1400-L
Gilson P2 pipetman Mandel F144801
Gilson P10 pipetman Mandel F144802
Gilson P20 pipetman Mandel F123600
Gilson P100 pipetman Mandel F123615
Gilson P200 pipetman Mandel F123601
Gilson P1000 pipetman Mandel F123603
Micrococcal Nuclease  NEB M0247S
Thermo Mixer C (Heating block mixer) Eppendorf 5382000023
Multi 12-channel Pippet P20 Rainin 17013803
Multi 12-channel Pippet P200 Rainin 17013805
1.5 ml LoBind tube Eppendorf 22431021
0.5 ml LoBind tube Eppendorf 22431005
Plastic Plate Cover Edge Bio 48461
PCR cover Bio Rad MSD-1001
Aluminum Plate Cover Bio Rad MSF-1001
Elution buffer (EB buffer) Qiagen 19086
1M DTT Sigma 646563
Eppendorf 5810R centrifuge  Eppendorf 22625004
Ultrapure water Thermo Scientific 10977-015
Protein G dynabeads Thermo Scientific 10001D
Protein A dynabeads Thermo Scientific 10001D
Protease inhibitor Cocktail Calbiochem 539134
Rotating platform Mandel 1b109-12052010
Plate magnet Alpaqua 2523
Domed 12-cap strip Bio Rad TCS1201
Buffer G2 Qiagen 1014636
Protease Qiagen 19155
Tube Magnet (DynaMag-2) Thermo Scientific 12321D
Tube Magnet (DynaMag-2) LabCore 730-006
V shape Plastic reservoir Mandel S0100A
Vortex Mandel C1801
Mini Fuge Mettler Toledo XS2035
Analytical scale Mandel LB109-12052010
Quick Ligation Reaction Buffer, 5X NEB B6058S
DNA Polymerase I, Large (Klenow) Fragment NEB M0210S
Klenow Fragment (3'-5' exo) NEB M0212S
T4 DNA Polymerase NEB M0203S
T4 Polynucleotide Kinase NEB M0201S
Deoxynucleotide Solution mix, 10mM NEB N0447S
dATP Solution 10mM NEB N0440S
Quick T4 DNA Ligase NEB M0202T
Adenosine 5'-Triphosphate (ATP), 25mM NEB P0756S
DNA Polymerase Thermo Scientific F549L
NEBuffer 2 NEB B7002S
Hank's buffered salt solution Thermo Scientific 14025076
Fetal bovine serum  Thermo Scientific A3160702
phosphate buffer saline  Thermo Scientific 10010023
H3K4me3 Cell Signaling 9751S
H3K4me1 Diagenode C15410037
H3K27me3 Diagenode pAb-069-050
H3K36me3 Abcam ab9050
H3K9me3 Diagenode C15410056
SeraMag  super-paramagnetic beads

DOWNLOAD MATERIALS LIST

References

  1. Simpson, R. T. Nucleosome Positioning: Occurrence, Mechanisms, and Functional Consequences. Prog. Nucleic Acid Res. Mol. Biol. 40, Issue C 143-184 (1991).
  2. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundmamental particle of the eukaryotic chromosome. Cell. 98, 285-294 (1999).
  3. Schones, D. E., et al. Dynamic regulation of nucleosome positioning in the human genome. Cell. 132, (5), 887-898 (2008).
  4. Segal, E., et al. A genomic code for nucleosome positioning. Nature. 442, (7104), 772-778 (2006).
  5. Shiio, Y., Eisenman, R. N. Histone sumoylation is associated with transcriptional repression. PNAS. 100, (23), 13225-13230 (2003).
  6. Li, L., Lorzadeh, A., Hirst, M. Regulatory variation: An emerging vantage point for cancer biology. Wiley Interdiscip. Rev. Syst. Biol. Med. 6, (1), 37-59 (2014).
  7. Jiang, J., et al. Investigation of the acetylation mechanism by GCN5 histone acetyltransferase. PLoS ONE. 7, (5), (2012).
  8. Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12, (2), 198-209 (2002).
  9. Brind'Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M. M., Lorincz, M. C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 6, 6033 (2015).
  10. Lorzadeh, A., et al. Nucleosome Density ChIP-Seq Identifies Distinct Chromatin Modification Signatures Associated with MNase Accessibility. Cell Rep. 17, (8), 2112-2124 (2016).
  11. Noll, M., Kornberg, R. D. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109, (3), 393-404 (1977).
  12. Skene, P. J., Henikoff, S. A simple method for generating high-resolution maps of genome wide protein binding. eLife. 4, 09225 (2015).
  13. Brogaard, K., Xi, L., Wang, J. -P., Widom, J. A map of nucleosome positions in yeast at base-pair resolution. Nature. (2012).
  14. Cui, K., Zhao, K. Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods Mol. Biol. 833, 413-419 (2012).
  15. Mieczkowski, J., et al. MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat. Commun. 7, 11485 (2016).
  16. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). JOVE. (41), (2010).
  17. Rohland, N., Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, (5), 939-946 (2012).
  18. Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., Rudensky, A. Y. Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 445, (7130), 936-940 (2007).
  19. Krishnakumar, R., Gamble, M. J., Frizzell, K. M., Berrocal, J. G., Kininis, M., Kraus, W. L. Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes. Science. 319, (5864), 819-821 (2008).
  20. Mendenhall, E. M., et al. Locus-specific editing of histone modifications at endogenous enhancers. Nat. Biotechnol. 31, (12), 1133-1136 (2013).
  21. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  22. Reference Epigenome Standards - IHEC. Available from: http://ihec-epigenomes.org/research/reference-epigenome-standards/ (2017).
  23. Heinz, S., et al. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 38, (4), 576-589 (2010).
  24. Feng, J., Liu, T., Qin, B., Zhang, Y., Liu, X. S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 7, (9), 1728-1740 (2012).
  25. Fraley, C., Raftery, A. E. MCLUST: Software for Model-Based Cluster Analysis. J. Classif. 16, (2), 297-306 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics