Nucleosome yoğunluk analiz için kitaplıklarına sıralama yerli Kromatin Immunoprecipitation nesil

Genetics
 

Summary

Biz (ChIP-seq) metodolojisi sıralı veri kümeleri micrococcal nükleaz (MNase) erişilebilirlik entegre bir nucleosome yoğunluğu ChIP-seq analitik çerçeve için uygun üretimi için sıralama değiştirilmiş yerli Kromatin immunoprecipitation mevcut Histon değişiklik ölçümleri ile.

Cite this Article

Copy Citation | Download Citations

Lorzadeh, A., Lopez Gutierrez, R., Jackson, L., Moksa, M., Hirst, M. Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis. J. Vis. Exp. (130), e56085, doi:10.3791/56085 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Biz (ChIP-seq) deneysel protokol oluşturulmasını sağlayan bir Gauss karışım dağıtımı tabanlı analiz yöntemi ile (nucleosome yoğunluğu ChIP-seq; ndChIP-seq) uyumlu sıralama değiştirilmiş yerli Kromatin immunoprecipitation mevcut micrococcal nükleaz (MNase) erişilebilirlik Histon değişiklik genom çapında ile kombine ölçümleri. Nucleosome konum ve yerel yoğunluğu ve onların Histon alt birimleri, ardından değiştirilmesi yerel transkripsiyon Birleşik düzenleyen konserde hareket. Kombinatorik ölçümleri nucleosome erişilebilirlik ndChIP-seq tarafından oluşturulan Histon değişiklik ile bu özellikleri aynı anda sorgulama için sağlar. NdChIP-seq metodoloji Primer hücre tabanlı ChIP-seq protokolleri cross-linking için ulaşılmaz küçük sayılar için geçerlidir. Birlikte ele alındığında, ndChIP-seq nadir İlköğretim hücre popülasyonlarının içinde RNA transkripsiyonu düzenleyen paylaşılan mekanizmaları yeni görüşler elde etmek için yerel nucleosome yoğunluğu ile birlikte Histon değişiklik ölçüm sağlar.

Introduction

Ökaryotik genom 146 baz çifti tarafından DNA1,2sinirlari dört Histon proteinleri (örneğin, H2A, H2B, H3 ve H4) iki kopyası oluşur nucleosome yapıları tekrar üzerinden Kromatin içine paketlenmiştir. Kromatin remodeling kompleksleri gen organizatörü sınırları içindeki nucleosome konumunu kontrol etmek ve erişilebilirlik DNA transkripsiyon faktörleri ve RNA polimeraz makine3değiştirerek gen ekspresyonu yönetmelikte katılmak, 4.

Histon nucleosome içinde amino terminal kuyrukları asetilasyon, metilasyon, fosforilasyon, ubiquitylation, sumoylation, formylation ve belirli amino asitler5 prokollajen dahil olmak üzere çeşitli kovalent değişiklik için tabi olan , 6 , 7 , 8. pozisyonları ve bu değişiklikler derecelerde dikte Kromatin yapısı ve Denetim erişimi etkinleştirme transkripsiyon7izin moleküler komplekslerin etkisi Kromatin devlet. Her iki nucleosome yoğunluğu ve Histon değişikliği oynamak verilen bu bir rol gen transkripsiyonu yerel denetiminde, nucleosome yoğunluğu ve Histon değişiklik9eş zamanlı ölçüm sağlar yerel bir çip yaklaşım geliştirdiğimiz, 10.

Yerel ChIP-seq endonükleaz micrococci nükleaz (MNase) çekirdeği11,12,13 konumlandırma nucleosome eşlemek için kaldıraçlı bir özellik içinde yerel durumunda olduğu gibi Kromatin sindirmek için yararlanır , 14 , 15. nucleosome yoğunluğu ChIP-seq (ndChIP-seq) MNase MNase erişilebilirlik Histon değişiklik10ile birleştirmek ölçümler oluşturmak için Kromatin bölgeleri açmak için tercihli erişim özelliğinin avantajı alır. ndChIP-seq nadir Primer hücre, doku ve kültürlü hücreleri olarak Histon değişiklikleri profilleme için uygundur. Burada, sıralı veri kümeleri için yukarıda açıklanan analitik çerçeve çalışma10 parça boyutu yazı immunoprecipitation, eşleştirilmiş uç için sınırları, okuyun tarafından belirlenen entegre uygun nesil sağlar detaylı bir iletişim kuralı mevcut aynı anda MNase erişilebilirlik Histon değişiklik ölçümleri ile araştırmak. Daha önce bu protokolün uygulamaya 10.000 birincil insan kordon kanı CD34 türetilmiş+ hücreleri ve insan embriyonik kök hücreleri ortaya bunlar içinde Kromatin yapısı ve Histon değişiklikler arasındaki benzersiz ilişkileri hücre türleri10 . Aynı anda nucleosome erişilebilirlik ve Histon değişiklik ölçmek için onun yetenek göz önüne alındığında, ndChIP-seq açığa epigenomic özellikleri bir tek nucleosome düzeyde bir hücre nüfus ve türdeş olmayan imzalar içine çözme özelliği olan onların kurucu unsurları. Türdeş olmayan hücresel nüfus ndChIP seq tarafından keşfi soruşturma bivalent rehberleri, hem H3K4me3, etkin bir işareti ve H3K27me3, baskıcı bir işareti, mevcut10nerede örneğidir.

Protocol

Not: Bu iletişim kuralı için en küçük girişi tek IMMUNO-yağış (IP) tepki başına 10.000 hücre nedir. Sağlanan deneysel çalışma sayfasını yazdırmak ve deney planı için bir kılavuz olarak kullanmaktadır. İncubations oda sıcaklığında ~ 22 ° C'de olduğu varsayılır Bütün arabellek Tarifler Tablo 1' de sağlanmaktadır. Tüm arabellekleri 4 ° C'de depolanan ve buz üzerinde işlem sırasında aksi belirtilmediği sürece devam etti.

1. hücre hazırlık

  1. Kültürlü hücreleri
    1. Fosfat tampon salin (PBS) 1 mL hücrelerle yıkama ve doğru bir hemasitometre kullanarak hücre konsantrasyonu belirlemek. Bir milyondan fazla hücreler varsa, PBS hacmi artırın.
    2. Steril 1,5 mL tüp ve 500 x g 4 ° C'de 6 dk için aşağı spin içine eşdeğer 70.000-100,000 hücre ve hücre saymak, aliquot dayanarak Bir pipet kullanarak, yavaş yavaş kaldırmak ve süpernatant (hücre Pelet bozmadan) atmak ve Pelet buz gibi lizis arabellek + 1 proteaz inhibitörü kokteyl (PIC) 1000 hücre konsantrasyonu x resuspend / µL. Mix de 20-30 yukarı ve aşağı pipetting tarafından kez. Hücre kümeleri kesintiye önemlidir. Baloncuklar oluşturmak deneyin.
    3. Doğrudan gün 1'e (Bölüm 2) ndChIP-seq protokolünün devam etmek ya da flaş dondurma hücre Pelet sıvı azot ve-80 ° C'de store
  2. Sıralanmış hücreleri
    1. Hank tamponlu tuz solüsyonu (HBSS), veya PBS + % 2 fetal sığır serum (FBS) 350 µL ile 1,5 mL tüp içine 70.000-100,000 sıralanmış16 hücreleri toplamak.
    2. Spin aşağı her hücre aliquot 500 x g 4 ° C'de 6 dk de Bir pipet kullanarak, yavaş yavaş süpernatant (hücre Pelet bozmadan) kaldırın ve resuspend buz gibi lizis tampon + 1 x 1.000 hücrelerin son bir konsantrasyon PIC / µL. Mix de lizis arabellekte yukarı ve aşağı pipetting tarafından 20 - 30 kez. Hücre kümeleri tahrip edilmesini sağlamak. Baloncuklar oluşturmak deneyin.
    3. Doğrudan gün 1'e (Bölüm 2) ndChIP-seq protokolünün devam etmek ya da flaş dondurma hücre Pelet sıvı azot ve-80 ° C'de store

2. gün 1: ndChIP-seq

  1. Antikor-boncuk karmaşık hazırlanması
    1. 37 ° C su banyosu ve nedense odamızda buz kovası hazırlamak. Buz üzerinde çalışma, PIC x 1 x IP tampon/1 ve 1 x antikor (Ab) seyreltme arabellek hazırlamak ve buz üzerinde tutun. (Bkz: tartışma için seçim kriterleri) Protein A (veya G) manyetik boncuklar 4 ° C Muhafazası ve mix yumuşak nabız-vortexing tarafından çok iyi almak. Buz üstünde tutun.
      Not: Her zaman tam bir girdap tüp içinde oluşan vortexing durdurulur nabız-vortexing anlamına gelir.
    2. 24 µL Protein A (veya G), manyetik boncuklar IP tepki başına yeni bir 2 mL tüp içine aktarın. Boncuk hacmi kaydetmek ve tüp buz üzerinde tutun. Örnek, 7 IP için kullanmak için 7 x 24 µL 168 µL =.
    3. Tüp üzerinde tüp mıknatıs yerleştirmek ve açık gösteren boncuk ayırma olmak çözüm için bekleyin. Boncuk bozmadan, dikkatle bir pipet kullanarak süpernatant kaldırmak ve. Kapalı tüp mıknatıs tüp alıp buzluğa yerleştirin.
    4. Buz gibi IP arabelleği eşit bir birim (Yani, boncuk ilk cilt) + 1 x PIC karışımı ekleyin. Yukarı ve aşağı pipetting tarafından karıştırın. Değil girdap yapmak.
    5. IP arabellek + 1 x PIC + boncuk geri tüp mıknatıs üzerine yerleştirin ve açık gösteren boncuk ayırma olmak çözüm için bekleyin. Boncuk bozmadan, dikkatle bir pipet kullanarak süpernatant kaldırmak ve. Soğuk IP tampon + 1 X PIC yıkama iki kez daha 3 yıkar toplam için yineleyin.
    6. Son yıkama sonra buz gibi IP arabelleği eşit bir birim (Yani, boncuk ilk cilt) + 1 x PIC mix boncuk resuspend. Yukarı ve aşağı pipetting tarafından karıştırın. Değil girdap yapmak. Tüp buz üzerinde tutun.
    7. Buz üzerinde IP tampon + PIC 10 mL V şeklinde bir 25 mL rezervuar içine dökün. Bir çok kanallı pipet kullanarak ekleyin buz gibi IP arabelleği 130 µL + 1 x PIC karışımı temiz V-alt 96-iyi bireysel kuyu içine plaka. IP başına bir şey doldurun. Plaka olarak etiket "Ab-boncuk kompleksi".
    8. 12 µL yıkanmış Protein A (veya G), manyetik boncuklar her de içeren IP tampon + PIC ve yukarı ve aşağı pipetting tarafından karıştırın. Kalan yıkanmış boncuk buz üzerinde tutun.
    9. Doğrulanmış antikorlar onların soğuk hava deposu ve tezcan gerekirse buz üzerinde elde edilir. Buz üzerinde çalışan, 1 x Ab seyreltme arabelleği Tablo 2' de gösterilen konsantrasyonları ile antikor oranında seyreltin.
    10. Ab-boncuk karmaşık plaka her şey için uygun, seyreltilmiş antikor (Tablo 1) 1 µL ekleyin. Antikor anahtarı kuyuya kaydedin. Çok kanallı pipet kullanarak, her satır yukarı ve aşağı 20 kere pipetting karıştırın. İpuçları satırlar arasında değiştirin. Ab-boncuk karmaşık plaka çok iyi bir alüminyum plaka kapağı kapatın ve en az 2 h için dönen bir platform üzerinde 4 ° C'de kuluçkaya.
      Not: Bu kuluçka adım 2.4 başlamak için hazır kadar devam edebilirsiniz.
  2. Hücre lizis ve Kromatin sindirim
    1. Buz üzerinde çalışma, hazırlamak lizis arabellek x 1 + 1 x PIC ve 1 mL MNase ben seyreltme tampon (Tablo 3) ve buz üzerinde tutun.
    2. Hücre topakları onların-80 ° C depolama (veya taze hazırlanmış Eğer buz) alın. Her hücre Pelet bir 10 s sonra buz için transfer için 37 ° C su banyosunda çözülme.
    3. Her hücre Pelet hemen buz gibi 1 lizis tampon + 1 x PIC 10.000 hücre/20 µL ve mix 10 kez pipetting tarafından son bir konsantrasyon için yukarı ve aşağı, kabarcıklar oluşturmadan x ekleyin. Örneğin, 70.000 hücreler için son 140 µL birimdir.
    4. Buz, aliquot 20 µL/kuyu içine bir 96-şey plaka elde edilen lysates üzerinde çalışıyor. Plastik bir mühür ile plaka kapak ve 20 dk. etiket plaka "MNase sindirim" buz üzerinde kuluçkaya ve wells bir şablon anahtar için kayıt. Kromatin sindirim tepki tam bir zamanlaması sağlamak için örnekleri 2'den fazla satır içeren bir zaman sindirim için devam etmeyin.
    5. Sadece 20 dk lizis tamamlanmadan önce MNase seyreltik ben enzim MNase ile ben seyreltme, tampon 20 U/µL, son bir konsantrasyon ve buz üzerinde tutun.
    6. Buz üzerinde çalışma, MNase hazırlamak ben sindirim master mix Tablo 4 ve aliquot 20 µL Mix örnekleri artı 5 µL ölü cilt her satır başına göre 96-şey rezervuar plaka bir satır ve buz üzerinde tutun. İki satır için birim olmalıdır: (20 µL x 2) + 5 µL 45 µL =.
    7. Kuluçka lysates bitirdikten sonra MNase sindirim plaka buz kaldırın. Bir çok kanallı pipet kullanarak ekleyin MNase 20 µL ben sindirim master karışımı örnekleri her satır içine ve mix 10 kat yukarı ve aşağı pipetting. İpuçları satırlar arasında değiştirin. Tam olarak 5 min için oda sıcaklığında kuluçkaya.
    8. 5 dk sonra reaksiyon durdurmak, örnekleri her satır 250 µM ethylenediaminetetraacetic asit (EDTA) 6 µL eklemek için bir çok kanallı pipet kullanın ve yukarı ve aşağı mix bir kaç kez. İpuçları satırlar arasında değiştirin. EDTA eklenmesinden sonra pipet ayarı 20 µL ve mix 10 kat yukarı ve aşağı sindirim tepki tam durdurmak sağlamak için pipetting tarafından geçin. İpuçları satırlar arasında değiştirin.
    9. Bir çok kanallı pipet kullanarak sindirilmiş MNase örnekleri, her satır için de aşağı yukarı 10 kez pipetting tarafından 6 µL 10 x lizis arabellek ve karışımı ekleyin. Bir plastik mühür ile kapak ve 15 dakika buz üzerinde kuluçkaya.
  3. Giriş ayrılık ve Ön Temizleme
    1. Buz, aynı Pelet/şablon steril, tek bir hücre için tüm wells buz, 1,5 mL tüp (şablon kimliği ile önceden etiketli) ve karışımı önceden soğutulmuş havuzu üzerinde 15 dk kuluçka iyice takip ama yavaş yavaş deterjan köpük önlemek için bir pipet kullanarak.
    2. Her hücre Pelet/şablonu için yeni bir içine sindirilmiş Kromatin steril, 0.5 mL tüp (şablon kimliği ile önceden etiketli) ve mağaza 4 ° C'de 8 µL gecede aktarın. Bu giriş denetimi olarak görev yapacak.
    3. 48 µL aliquots, sindirilmiş Kromatin kalan hacmi yeni bir 96-şey plaka dağıtın. Hücre Pelet/Şablon 1 kuyu A01-A06 gider, hücre Pelet/Şablon 2 kuyu A07-A12, vbgider. Wells bir şablon anahtar için kayıt. Plaka "Öncesi takas" etiket.
    4. Bir çok kanallı pipet kullanarak, IP arabellek x 1 + 1 PIC x 120 µL ve yıkanmış Protein A (veya G) manyetik boncuklar 12 µL 2.3.3 adımından öncesi takas plaka her kuyunun içine ekleyin. Her satır aşağı yukarı 10 kez pipetting karıştırın. İpuçları satırlar arasında değiştirin. Plaka, çok iyi bir alüminyum plaka kapağı kapatın ve en az 2 h 4 ° C'de dönen bir platform üzerinde kuluçkaya.
  4. Immunoprecipitation tepki
    1. Bu adımı başlamadan önce 10 için centrifuging tarafından her iki tabak en az 2 h. hızlı spin için Ab-boncuk karmaşık plaka (Adım 2.1.10) ve öncesi takas plaka (Adım 2.3.4) inkübe emin olun 200 x g s.
    2. Ab-boncuk karmaşık plaka (Adım 2.1.10) bir tabak mıknatıs yerleştirmek ve bekleyin 15 s netlik eriyik. Dikkatle kaldırmak ve boncuk bozmadan bir pipet kullanarak süpernatant. Plaka plaka mıknatıs kaldırın ve buz üzerinde tutun.
    3. Ön Temizleme tepki plaka (Kimden adım 2.3.4) bir tabak mıknatıs yerleştirmek ve bekleyin 15 s ayırmak boncuk ve çözüm açık hale gelir. Boncuk bozmadan, dikkatli bir şekilde karşılık gelen kuyu karmaşık plaka buz ve karışımı yavaşça 15 kez yukarı ve aşağı pipetting tarafından tutulan Ab-boncuk yapımı için bir pipet kullanarak süpernatant aktarın. İyi bir alüminyum ile plaka kapak plaka ve kuluçkaya mühür (12-18 h) dönen bir platform üzerinde 4 ° C'de gecede. Plaka "IP reaksiyonu" yeniden etiketleyin.

3. gün 2: ndCHIP-seq

  1. Yıkama ve elüsyon
    1. Isıtma Mikser 65 ° C'ye ayarla Buzda, düşük tuz yıkama tampon ve yüksek tuz yıkama tampon hazırlayın. Hızlı spin IP tepki plaka için 10 adım 2.4.3 200 x g s.
    2. IP tepki plaka üzerinde bir plaka mıknatıs yerleştirmek ve bekleyin 15 s netlik eriyik. Bir çok kanallı pipet boncuk bozmadan kullanarak, dikkatle kaldırmak ve süpernatant. Plaka mıknatıs Tabağını alıp buza yerleştirin.
    3. IP tepki plaka örneklerinde her satır için buz gibi düşük tuz, 150 µL yıkama arabellek ve karışımı yavaş yavaş 10 kat yukarı ve aşağı tamamen resuspend boncuk için ekleyin.
    4. IP tepki plaka plaka mıknatıs geri üzerine yerleştirin, boncuk ayırmak bekleyin ve çok kanallı pipet kullanarak, boncuk bozmadan kaldırmak ve süpernatant atın. Plaka geri Buza koyun ve 3.1.3 ve 3.1.4 toplamda 2 yıkama arasındaki adımları yineleyin.
    5. Buza, yüksek tuz 150 µL yıkama arabellek ve karışımı yavaşça 10 kat yukarı ve aşağı tamamen boncuk resuspend için pipetting tarafından IP tepki plaka örneklerinde her satırı ekleyin.
    6. IP tepki plaka plaka mıknatıs geri üzerine yerleştirin, boncuk ayırmak bekleyin ve çok kanallı pipet kullanarak, boncuk bozmadan kaldırmak ve süpernatant atın. IP tepki plaka Buza koyun ve yanında yeni bir 96-şey plaka önceden chill.
    7. IP tepki plaka örneklerinde her satır için yüksek tuz 150 µL yıkama arabellek ve karışımı yavaşça 10 kat yukarı ve aşağı tamamen boncuk resuspend için pipetting tarafından ekleyin. Resuspension sonra her satırı örnekleri yeni, önceden soğutulmuş, 96-da plaka karşılık gelen satırı aktarın. Plaka "IP reaksiyonu" etiket. Eski plaka atmak.
    8. Yeni IP tepki plaka plaka mıknatıs yerleştirmek ve ayırmak boncuk için bekleyin. Bir çok kanallı pipet boncuk bozmadan kullanarak, dikkatle kaldırmak ve süpernatant. Plaka oda sıcaklığında tutmak.
    9. Her satıra IP tepki plaka örneklerinin 30 µL çip elüsyon arabelleği (EB) ve yavaş yavaş yukarı ve aşağı pipetting tarafından 10 kez karıştırın. Kabarcık oluşumunu önlemek emin olun.
    10. PCR kapak ile de plaka mühür ve bir Isıtma karıştırıcı 65 ° c karıştırma 1.350 rpm hızına sahip 1,5 saat için kuluçkaya.
    11. IP tepki plaka 200 x g 4 ° C'de 1 dk. için de aşağı 1,5 saat kuluçka sonra spin Isıtma Mikser ile 50 ° c ayarını değiştirin
    12. Spin sonra IP tepki plaka üzerinde bir plaka mıknatıs yerleştirmek ve temizlemek çözüm için bekleyin. Bir çok kanallı pipet kullanarak, boncuklar, bozmadan dikkatle 30 µL süpernatant ile yeni bir 96-şey plaka aktarın. Taze ipuçları her satır için kullanın. Plaka "IP reaksiyonu" etiket ve oda sıcaklığında saklayın.
  2. Protein sindirimi
    1. % 30 PEG/1 M NaCl manyetik boncuk17 (arabellek kompozisyon tablo) Çözüm 4 ° C buzdolabından almak ve en az 30 dk kritik için oda sıcaklığında saklayın: boncuk çözüm tam olarak devam etmeden önce oda sıcaklığına ulaştığından emin olmak.
    2. Giriş denetimi örnekleri 4 ° C depolama (Adım 2.3.2) ve hızlı spin almak. Bir pipet kullanarak birim ölçü ve önceden seçilen giriş wells (boş wells) için giriş kontrol örnekleri son hacmi 30 µL. Transfer için ultrasaf su IP tepki plaka (Adım 3.1.12) her giriş denetimine ekleyin. İyi örnek anahtar için kayıt.
    3. Buzda, Tablo 5 ve aliquot eşit hacim 96-şey rezervuar plaka bir satır gösterildiği gibi Protein sindirimi Master Mix hazırlayın.
    4. Bir çok kanallı pipet kullanarak, IP tepki plaka örneklerinde her satır için 40 µL Protein sindirimi Master mix ve yavaş yavaş 10 kat yukarı ve aşağı karıştırın. PCR kapak ile de plaka mühür, 200 x g 1 dk. için de aşağı spin ve bir Isıtma karıştırıcı 50 ° C'de 30 min 650 rpm ayarlamak için kuluçkaya. Plaka kuluçka iken, taze % 70 etanol (alkol) hazırlamak ve oda sıcaklığında saklayın.
    5. 30 dk kuluçka tamamlandıktan sonra IP tepki plaka 200 x g 1 dakika, 4 ° c de spin Plaka oda sıcaklığında tutmak.
      Not: Toplam hacim şimdi ~ 70 µL/iyi olması gerekir.
  3. Boncuk temizlik % 30 PEG/1 M NaCl manyetik boncuk solution'ı kullanma
    1. PEG/1 M NaCl manyetik oda sıcaklığında %30 boncuk çözüm temiz 96-şey rezervuar plaka bir satır aliquot (örnek başına 75 µL # satır x).
    2. Bir çok kanallı pipet kullanarak oda sıcaklığında çalışma 70 µL (1:1 oran) % 30 PEG/1 M NaCl manyetik boncuk çözüm örnekleri IP tepki plaka her satırı için ve 10 kat yukarı ve aşağı pipetting tarafından karıştırın. İpuçları satırlar arasında değiştirin. Plaka 15 dakika oda sıcaklığında kuluçkaya.
    3. Plaka plaka mıknatıs yerleştirmek ve boncuk ayırmak izin vermek 5 min için kuluçkaya.
    4. Bir pipet boncuk bozmadan kullanarak, dikkatle kaldırmak ve süpernatant. Boncuk tutun.
    5. IP tepki plaka hala plaka mıknatıs üzerinde olmakla birlikte, oda sıcaklığında %70 150 µL eklemek örnekleri, her satır için bir çok kanallı pipet kullanarak alkol ve 30 için kuluçkaya s. Sonra 30 s, bir çok kanallı pipet kullanarak kaldırmak ve süpernatant atın. Bu bir kez daha 2 yıkama toplam için tekrarlayın.
    6. 3 dk. görsel olarak incelemek için tüm alkol buharlaşıp emin olmak için plaka ikinci alkol yıkama sonra 'kuru' plaka plaka mıknatıs üzerinde kuluçkaya. Eğer değilse, 1 dk. daha düşük verim boncuk sonuçlarında aşırı kurutma plaka kuluçkaya.
    7. Plaka mıknatıs ve çok kanallı pipet kullanarak kapalı plaka almak 35 µL EB (Tablo reçetesi) ekleyin. De aşağı yukarı 10 kez pipetting tarafından karıştırın. İpuçları satırlar arasında değiştirin. Elute için 3 dakika için oda sıcaklığında kuluçkaya.
    8. Kuluçka sonra IP tepki plaka plaka mıknatıs geri üzerine yerleştirin ve 2 min için kuluçkaya. Boncuk ayrı olmalıdır ve çözüm açık olacak.
    9. Bir çok kanallı pipet kullanarak, boncuklar, rahatsız etmeden dikkatle süpernatant yeni bir 96-şey plaka karşılık gelen kuyu aktarın.
    10. Bir alüminyum plaka kapak ile plaka mühür, "IPED + giriş DNA" etiket ve stok gecede 4 ° C'de veya -20 ° c için uzun süreli (> 48 h) depolama.

4. gün 3: Kütüphane İnşaat

  1. Son onarım ve fosforilasyon
    1. Son onarım/fosforilasyon reaksiyon için girişi IPED nedir + giriş plaka adım 3.3.10. Çözdürme sonra spin 200 x g 4 ° C'de 1 dk. için de aşağı plaka ve buz üzerinde tutun.
    2. Tüm reaktifler (enzimler) hariç son onarım/fosforilasyon reaksiyonu (Tablo 6) için gerekli ve oda sıcaklığında erimek, sonra hemen buz transfer-20 ° C dondurucudan almak.
    3. Buz üzerinde çalışma, steril, 1.5 mL microcentrifuge tüp içinde son onarım/fosforilasyon Master Mix ayarlamak için Tablo 6 izleyin. Enzim olmayan bileşenlerin yanı sıra sonra de darbe-vortexing tarafından mix ve tüp geri Buza koyun.
    4. İlgili enzimler soğutulmuş tüp serin rafa tezgah için onların soğuk depolama ve taşıma almak. Her enzim tarafından flicking tüp, hızlı spin karıştırın ve geri soğutulmuş tüp serin rafa yerleştirin. Enzim pipetting zaman, yavaş yavaş bir doğru ses aktarımı sağlamak için Aspire edin. Eklenmesinden sonra ucu yukarı ve aşağı pipetting tarafından ana karışımda yıkayın.
    5. Bir kez enzimler eklenir, yavaşça buza geri darbe-master mix 5 kere sonra hızlı spin tüm bileşenleri eşit dağılımı temin ve hemen tüp yerleştirmek için girdap.
    6. Buzda aliquot son onarım/fosforilasyon Master Mix yeni bir 96-şey rezervuar plaka bir satır içine uygun bir hacmi; bölünmemeli olabilmesi için: (15 µL # satır x) + 5 µL ölü cilt. İki satır için bir örnek hesaplama: (15 µL x 2) + 5 µL 35 µL/iyi =.
    7. Bir çok kanallı pipet kullanarak, son onarım/fosforilasyon Master Mix 15 µL örnekleri her satırı için ve yukarı ve aşağı pipetting tarafından 10 kez karıştırın. İpuçları satırlar arasında değiştirin. Plastik bir kapak ile plaka mühür, 200 x g 4 ° C'de 1 dk. için de aşağı spin ve 30 dk için oda sıcaklığında kuluçkaya.
  2. Boncuk temizlik sonra son onarım ve fosforilasyon
    1. 4 ° C buzdolabı, % 20 PEG/1 M NaCl manyetik boncuk çözüm ve % 30 PEG/1 M NaCl çözüm almak ve en az 30 dakika oda sıcaklığında kuluçkaya.
      Not: % 30 PEG/1 M NaCl çözüm DOES değil manyetik boncuklar içerir.
    2. Her iki çözüm de oda sıcaklığına ulaştıktan sonra her örnek için 80 µL %30 PEG/1 M NaCl ve % 20 PEG/1 M NaCl manyetik boncuk çözümleri 1:2 karışımı hazırlayın. 24 örnekleri için bir örnek: 24 = 1,920 x 80 µL µL (640 µL % 30 PEG/1 M NaCl ve % 20 PEG/1 M NaCl manyetik boncuk çözümleri 1.288 µL).
    3. Aliquot boncuk çözüm mix, eşit hacim, 96-şey rezervuar plaka bir satır ve oda sıcaklığında saklayın. Aliquot EB arabellek (örnek başına 40 µL # satır x) bir temiz 96-şey rezervuar plaka bir satır içine. İki satır için bir örnek: x 2 = 80 40 µL µL/iyi.
    4. Bir çok kanallı pipet kullanarak, hazırlanan boncuk Mix 75 µL 4.2.2 örnekleri her satır adım adım 4.1.7 ve yukarı ve aşağı 10 kat karışımı ekleyin. İpuçları satırlar arasında değiştirin. 15 dk. devam boncuk temizlik yordamı ile oda sıcaklığında adımları 3.3.3-3.3.10 içinde özetlenen kuluçkaya. Bir plastik mühür, hızlı spin ile plaka kapak ve Buza koyun. 4.3 adıma geçin.
  3. A-takip tepki
    1. A-takip reaksiyonu (Tablo 7) için gerekli tüm reaktifler (enzimler) hariç-20 ° C-dondurucu almak, onları oda sıcaklığında çözülmeye sonra hemen buz aktarmak.
    2. Buz üzerinde çalışma, A-takip Master Mix steril, 1.5 mL microcentrifuge tüp içinde ayarlamak için Tablo 7 izleyin. Adımları 4.1.4-4.1.6 belirtildiği gibi genel enzimatik demlemek kurulum yönergelerini uygulayın.
    3. Bir çok kanallı pipet kullanarak, A-takip Master Mix 15 µL örnekleri her satırı için ve yukarı ve aşağı pipetting tarafından 10 kez karıştırın. İpuçları satırlar arasında değiştirin. PCR kapak ile plaka mühür, 200 x g 4 ° C'de 1 dk. için de aşağı spin ve bir thermocycler 30 dk 37 ° C'de kuluçkaya. Kuluçka sonra spin 200 x g 1 dk. için de aşağı plaka ve oda sıcaklığında saklayın.
  4. Boncuk Temizlik-up A-takip sonra
    1. 4.2. adımda açıklanan adımları uygulayın. Etiket "A-kuyruk + BC", hızlı spin, plastik bir mühür ile plaka kapak ve Buza koyun. 4.5 adıma geçin.
  5. Adaptör ligasyonu
    1. Bağdaştırıcı ligasyonu reaksiyon (Tablo 8) için gerekli tüm reaktifler (enzimler) hariç-20 ° C-dondurucu almak, onları oda sıcaklığında çözülmeye sonra hemen buz aktarmak.
    2. 10 µM PE bağdaştırıcısı (ek tablo 1) hisse senedi çözüm almak ve seyreltik 0,5 µM EB kullanarak. İyi darbe vortexing tarafından karıştırın. Gerekli 3 µL birimdir örnekleri sayısı x. Buzda aliquot 0.5 µM PE adaptörü, eşit hacim, bir temiz 96-şey rezervuar tabak 12 kuyu çalışma. Buz üstünde tutun.
    3. Buz üzerinde çalışma, bağdaştırıcı ligasyonu Master Mix steril, 1.5 mL microcentrifuge tüp içinde ayarlamak için Tablo 8 izleyin. Adımları 4.1.4-4.1.6 belirtildiği gibi genel enzimatik demlemek kurulum yönergelerini uygulayın. 5 X hızlı tüp ligasyonu arabellek tam olarak çözülmüş ve kullanmadan önce çok iyi karışık olduğundan emin olun.
    4. Buzda aliquot bağdaştırıcısı ligasyonu Master Mix yeni bir 96-şey rezervuar plaka bir satır içine uygun bir hacmi. Örneğin, iki satırları hesaplaması: (23 µL x 2) + 5 µL 51 µL/iyi =. Plaka buz üzerinde tutun.
    5. Bir çok kanallı pipet kullanarak ekleyin 0.5 µM 2 µL adım 4.4.1 ve mix örnekleri her satır sonu (PE) eşleştirilmiş bağdaştırıcısına. İpuçları satırlar arasında değiştirin.
    6. Bir çok kanallı pipet kullanarak, bağdaştırıcı ligasyonu Master Mix 23 µL örnekleri her satırı için ve yukarı ve aşağı pipetting tarafından 15 kere karıştırın. İpuçları satırlar arasında değiştirin. Metal bir kapak, etiket "Ligasyonu", 200 x g 4 ° C'de 1 dk. için aşağı spin ile plaka mühür ve oda sıcaklığında gecede kuluçkaya.
  6. 4. gün: Boncuk temizlik #1 sonra bağdaştırıcı ligasyonu
    1. 4 ° C buzdolabı, % 20 PEG/1 M NaCl manyetik boncuk çözüm almak ve en az 30 dakika oda sıcaklığında kuluçkaya. Çözüm sıcaklığına süre taze %70 hazırlamak alkol.
    2. Aliquot % 20 PEG/1 M NaCl manyetik boncuk çözüm, örnek, bir satır bir 96-şey rezervuar içine başına 55 µL plaka ve oda sıcaklığında saklayın. İki satır için bir örnek: 2 = 110 x 55 µL µL/iyi.
    3. Aliquot EB arabellek, örnek, bir satır bir temiz 96-şey rezervuar plaka içine başına 50 µL. İki satır için bir örnek: 2 = 100 x 50 µL µL/iyi.
    4. Bir çok kanallı pipet kullanarak, 48 µL % 20 PEG/1 M NaCl manyetik boncuk çözüm ligasyonu plaka örneklerinde her satır içine adım 4.5.6 ve aşağı yukarı 10 kez karıştırın. İpuçları satırlar arasında değiştirin. 15 dk. devam boncuk temizlik yordamı ile oda sıcaklığında adımları 3.3.3-3.3.7 içinde özetlenen kuluçkaya.
    5. Plaka mıknatıs ve çok kanallı pipet kullanarak kapalı plaka almak 45 µL EB (Tablo reçetesi) ekleyin. De aşağı yukarı 10 kez pipetting tarafından karıştırın. İpuçları satırlar arasında değiştirin. Elute için 3 dakika için oda sıcaklığında için kuluçkaya.
    6. Kuluçka sonra IP tepki plaka plaka mıknatıs geri üzerine yerleştirin ve bir çok kanallı pipet boncuk bozmadan kullanarak 2 dakika süreyle kuluçkaya, dikkatle süpernatant yeni bir 96-şey plaka karşılık gelen kuyu transfer. Plaka etiket "Ligasyonu + 1 M.Ö.".
    7. Her şey için 10 x PCR yüksek sadakat arabelleği 5 µL ve de yukarı ve aşağı pipetting karıştırın. İpuçları satırlar arasında değiştirin. Bir plastik mühür, hızlı spin ile plaka kapak ve oda sıcaklığında saklayın.
  7. Boncuk temizlik #2 bağdaştırıcısı ligasyonu sonra
    1. Boncuk temizlik bölümünde 4,6 aşağıdaki değişikliklerle açıklandığı gibi gerçekleştirmek: 60 µL % 20 PEG/1 M NaCl manyetik boncuk çözüm ligasyonu + M.Ö. 1 plaka (Adım 4.6.7) etkin her kuyuya ekleyin ve EB arabelleği 35 µL kullanarak boncuk elute. Plaka etiket "Ligasyonu + M.Ö. 2" ve buz üzerinde tutun.
  8. PCR güçlendirme
    1. -20 ° C dondurucudan PCR reaksiyon (Tablo 9) için gerekli reaktifler (enzimler dışında) almak, onları oda sıcaklığında çözülmeye sonra hemen buza koy.
    2. Buz üzerinde çalışma, steril, 1.5 mL microcentrifuge tüp içinde PCR Master Mix ayarlamak için Tablo 9 izleyin. Genel demlemek kurulum adımları 4.1.4-4.1.5 içinde özetlenen yönergelere bakın. Buzda aliquot PCR Master Mix yeni bir 96-şey rezervuar plaka bir satır içine uygun bir hacmi. Buz üstünde tutun. Örnek hesaplamalar için 4.5.4 adıma bakın.
    3. Buz üzerinde bir çok kanallı pipet kullanarak çalışma her benzersiz 12.5 µM PCR dizin oluşturma astar (ek tablo 2) tüp ligasyonu her kuyuya + M.Ö. 2 plaka (Adım 4.7.1) ters 2 µL ve yukarı ve aşağı yavaş yavaş karıştırın. İpuçları satırlar arasında değiştirin. Plaka buz üzerinde tutun.
    4. Buz üzerinde çalışan bir çok kanallı pipet kullanarak ekleyin 23 µL PCR ana karışımı örnekleri her satır içine adım 4.8.3 ve mix 10 kat yukarı ve aşağı pipetting. PCR kapak ile plaka mühür, 200 x g 1 dk. için de aşağı spin ve bir thermocycler kuluçkaya (PCR bisiklet koşullarını için bkz: Tablo 10 ).
  9. Boncuk temizlik PCR güçlendirme sonra
    1. PCR güçlendirme sonra plaka 200 x g 1 dakika, 4 ° c de spin Boncuk temizlik bölümünde 4,6 aşağıdaki değişikliklerle açıklandığı gibi gerçekleştirmek: 51 µL % 20 PEG/1 M NaCl manyetik boncuk çözüm her PCR reaksiyon ekleyin ve EB arabelleği 25 µL kullanarak boncuk elute. Bir alüminyum kapaklı plaka mühür ve örnekleri-20 ° C'de 1 dk. deposu için spin de 200 x g aşağı
    2. Oluşturulmuş kitaplıklar doğrulamak için DNA miktar Floresans tabanlı tahlil kullanarak gerçekleştirmek, bir çip tabanlı Kapiler Elektroforez Analyzer'ı (yüksek hassasiyet tahlil) nihai ürün görselleştirmek ve zenginleştirme çalıştırmak kantitatif PCR (qPCR) (bkz: Temsilcisi Results, ndChIP-seq Kütüphane kalite qPCR tarafından doğrulama).

Representative Results

Kromatin sindirim profilleri
MNase sindirim duruma getirilmesi bu protokolü başarısı için önemlidir. Bu çok önemlidir tek nucleosome parçası boyutları tarafından egemen bir sindirime profil oluşturmak için süre değil aşırı sindirilir, daha yüksek sipariş nucleosome parçaları kurtarma için izin vermek için. Bir ideal sindirim profil parçaları daha küçük ve tek oluşturarlar daha büyük temsil eden küçük bir kısmı ile tek nucleosome parçaları bir çoğunluğu oluşmaktadır. Şekil 1 bir ideal, aşırı sindirilir ve altında sindirilmiş boyutu dağıtım profilleri gösterilmektedir. Kromatin alt-optimal hazım da (Şekil 2) IP malzemeden üretilen sıralama kitaplığı profilde belirgin olacaktır.

NdChIP-seq Kütüphane kalite qPCR tarafından doğrulama
qPCR çip18,19,20kalitesinin değerlendirilmesi için köklü bir yöntemdir. Ne zaman ndChIP-seq 10.000 üzerinde performans hücreleri nükleik asit verim IP 1 olacak sonra ng. Bu nedenle, hedef bölgelerde göreceli zenginlik arka plan üzerinde değerlendirmek için kütüphane inşaat sonrası qPCR gerçekleştirmek için esastır. Bir arka plan tahmin sağlamak için MNase sindirilmiş Kromatin (giriş) inşa kitaplıklar oluşturulur. Her IP kitaplık için astar iki kümesi ( SupplementalTablo 3 astar için yaygın olarak kullanılan Histon işaretleri listesi için bkz:) ihtiyaç vardır. Bir astar küme sürekli faiz (olumlu hedef) Histon değişiklik ile ilişkili bir genomik bölge ve faiz (negatif hedef) Histon değişiklik ile işaretlenmemiş başka bir bölge için özel olmalıdır. ChIP-seq Kütüphane kalitesini zenginleştirme giriş kütüphane ile ilgili pas olarak değerlendirilecektir. Kat zenginleştirme hesaplanan hedef genomik bölgesinin üstel amplifikasyon varsayar aşağıdaki denklemi kullanarak: 2Ctgiriş-CtIP. Bizim özel R istatistiksel yazılım paketi yapılan, qcQpcr_v1.2, düşük giriş yerel ChIP-seq kitaplıkları (Ek kod dosyaları) qPCR zenginleştirme analizi için uygun. Şekil 3 qPCR sonuç başarılı ve başarısız ChIP-seq kitaplıkları için temsil eder. Kaliteli ndChIP seq kitaplıkları için en az beklenen kat zenginleştirme değeri 16 H3K4me3 ve 7 için geniş işaretleri, örneğin H3K27me3 gibi dar işaretleri için vardır.

Modelleme MNase erişilebilirlik
Hesaplamalı ChIP-seq karmaşık ve deneysel her ayarın benzersiz analizidir. Uluslararası insan Epigenomic Konsorsiyumu (IHEC) ve ansiklopedi, arama DNA öğeleri (kodlama) tarafından kurulan kurallar bir dizi ChIP-seq kitaplıkları21kalitesini değerlendirmek için kullanılabilir. Sıralama derinlik kütüphanelerin algılaması ve çözümlemesi zenginleştirilmiş bölgeleri20etkilediğini unutmayın önemlidir. Tepeler sayısı artış tespit ve bir plato okuma derinlik arttıkça yaklaşımlar. Biz 50 milyon eşleştirilmiş okuma (25 milyon parçaları) IHEC önerileri doğrultusunda dar işaretleri (örneğin, H3K4me3) sıralı için ndChIP-seq kitaplıklar tavsiye ve 100 milyon eşleştirilmiş-(50 milyon parçaları) geniş işaretleri ( defa okundu Örneğin, H3K27me3) ve giriş22. Bu sıralama derinlikleri doygunluk23,24ulaşmadan ChIP-seq tepe seslenmek, MACS2 ve HOMER, gibi yeterli sıra hizalamaları yaygın olarak kullanarak en önemli dorukları algılanması için kullanılan sağlar. Yüksek kaliteli memeli ndChIP-seq kitaplığa bir PCR yinelenen oranına sahip < % > 90 (yinelenen okuma dahil) % 10 ve başvuru genom hizalama oranı. Başarılı ndChIP-seq kitaplıkları zenginleştirilmiş hizalanmış okuma tespit MACS222 içinde tepeler önemli bir kısmını > % 40 () ile yüksek oranda ilişkili çoğaltır içerir ve muayene hizalanmış okur bir genom tarayıcı üzerinde görsel olarak ortaya çıkarmak giriş kütüphane (şekil 4) göre tespit enrichments. Buna ek olarak, ndChIP-seq nucleosome yoğunluğu bir Gauss karışım dağıtım algoritma kullanarak değerlendirmek için kullanılabilir (w1 * n(x; μ 1,σ1) + w2 * n(x; μ2, σ2) = 1) MACS2 zenginleştirilmiş modeli nucleosome yoğunluk bölgelerine MNase erişilebilir sınırlarıyla tanımlandığı şekilde tespit. Bu modelde, w1 mono-nucleosome dağıtım ağırlık ve w2 di-nucleosome dağıtım ağırlık temsil eder. W1 w2' den büyük olduğu yerde, egemenlik, mono-nucleosome parçacıkları ve ahlak bozukluğu çok yönlü vardır. Bu analiz böylece parçası boyutları tanımlanabilir kitaplıkları bir eşleştirilmiş-son moda sıralı gerekir. Gauss karışım dağıtım algoritma uygulaması için istatistiksel olarak anlamlı zenginleştirilmiş bölgeleri ilk tanımlanır. Biz MACS2 ile en yüksek arama girişi dar işaretleri ve 0.01 geniş işaretleri için q değeri kesim için bir denetim olarak ve varsayılan ayarlarla kullanarak öneririz. Gauss karışım dağıtım algoritma istihdam istatistik paketleri bir dizi yaygın olarak kullanılan istatistiksel yazılım paketleri mevcuttur. Belirlenen ortalama parça boyutu kullanan eşleştirilmiş uç okuma sınırları IPED örnekleri tarafından dağıtımları MACS2 itibariyle zenginleştirilmiş rehberleri tespit ve Gauss karışım dağıtım algoritma R istatistik paketi kullanarak her organizatörü uygulanabilir Ağırlıklı bir dağıtım hesaplamak için Mclust sürüm 3.025 . Bu uygulamada, çünkü bu eşiğin altına elde edilen ağırlık tahminlerine güvenilmez haline 30'dan az hizalanmış parçaları içeren Organizatör ortadan kaldırarak öneririz. Kaliteli ndChIP seq kitaplığa ortalama değerlerle mono-, di-nucleosome parça uzunlukları karşılık gelen iki ana bileşenden oluşur bir Gauss karışım dağıtım oluşturur.

Figure 1
Resim 1 : MNase sindirim Kütüphane nesil önce değerlendirilmesi. Kapiler Elektroforez çip tabanlı çözümleyici profilleri en uygun bir MNase(a)sindirmek, altında sindirmek-(B) ve (C) Kromatin aşırı sindirilir. Biyolojik çoğaltır mavi, kırmızı ve yeşil izleri gösterilir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 : MNase sindirim Kütüphane nesile değerlendirilmesi. (A)Post Kütüphane inşaat profilleri en iyi şekilde sindirilir giriş (biyolojik çoğaltır; kırmızı, yeşil, siyah) ve IP (biyolojik çoğaltır; mavi, mor, mavi) ve (B) alt-optimal girdi (biyolojik çoğaltır; kırmızı, yeşil, mavi) ve IP ( biyolojik çoğaltır; Mavi, mor, turuncu) kütüphaneleri. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3 : Post kantitatif PCR ndChIP seq kitaplıkları kalitesini değerlendirmek için kullanılan kitaplık inşaat. Kat zenginleştirme giriş kitaplıkları ile ilgili H3K4me3 IP kütüphanelerin 2 olarak hesaplanan(giriş - Ct Ct IP) qcQpcr_v1.2 kullanarak pozitif ve negatif hedefleri için. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4 : 10.000 birincil CD34 inşa temsilcisi ndChIP-seq Kütüphane+ kordon kanı hücreleri. Pearson korelasyon H3K4me3 sinyal 3 Biyolojik çoğaltır,(a)çoğaltılır 1 ve 2, (B) arasında (+/-2 Kb TDH) rehberleri hesaplanabilir (okuma başına milyon eşlenen okuma) çoğaltma 1 ve 3, (C) çoğaltılır 2 ve 3. (D) UCSC tarayıcı görünümü HOXA gen kümesi çapraz bağlı ChIP-seq'in IP, IP başına 10.000 hücrelerden başarılı ndChIP seq ve başarısız ndChIP-seq IP başına 10.000 hücrelerden başına 1 milyon hücre oluşturulan. (kırmızı: H3K27me3, yeşil: H3K4me3 ve siyah: giriş). MACS2 içinde eşlenen okur kısmını (E) H3K4me3 (siyah) ve H3K27me3 (gri) zenginleştirilmiş bölgelerinde tespit. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Arabellek oluşturma
A.1. Immunoprecipitation arabellek (IP)
20 mM Tris-HCl pH 7.5
2 mM EDTA
150 mM NaCl
%0.1 Triton X-100
%0,1 Deoxycholate
10 mM sodyum bütrat
A.2. düşük tuz yıkama arabellek
20 mM Tris-HCl pH 8.0
2 mM EDTA
150 mM NaCl
% 1 Triton X-100
%0.1 SDS
A.3. yüksek tuz yıkama arabellek
20 mM Tris-HCl pH 8.0
2 mM EDTA
500 mM NaCl
% 1 Triton X-100
%0.1 SDS
A.4. ChIP elüsyon arabellek
100 mM NaHCO3
% 1 SDS
A.5. 1 lizis arabellek – 1 mL x
% 0.1 Triton
%0,1 Deoxycholate
10 mM sodyum bütrat
A.6. Ab seyreltme arabellek
%0,05 (w/v) Azid
% 0.05 geniş spektrumlu Antimikrobiyal (örneğin ProClin 300)
PBS içinde
A.7. % 30 PEG / 1M NaCl manyetik boncuk çözüm (başvuru16)
% 30 PEG
1 M NaCl
10 mM Tris HCl pH 7.5
1 mM EDTA
yıkanmış süper paramagnetic boncuk 1 mL
A.8. % 20 PEG / 1M NaCl manyetik boncuk çözüm (başvuru16)
% 30 PEG
1 M NaCl
10 mM Tris HCl pH 7.5
1 mM EDTA
yıkanmış süper paramagnetic boncuk 1 mL

Tablo 1: ndChIP-seq arabellek oluşturma.

Histon değişiklik Konsantrasyonu (µg/µL)
H3K4me3 0,125
H3K4me1 0,25
H3K27me3 0,125
H3K9me3 0,125
H3K36me3 0,125
H3K27ac 0,125

Tablo 2: ndChIP-devamı için gerekli antikor miktarı

Reganet Birim (µL)
Ultra saf su 478
1 M Tris-HCl pH 7.5 10
0,5 M EDTA 10
5 M NaCl 2
Gliserol 500
Toplam hacim 1000

Tablo 3: Tarifi MNase seyreltme arabelleği için.

Reaktif Birim (µL)
Ultra saf su 13
20 mM DTT 1
MNase arabellek x 10 4
20 U/µl Mnase 2
Toplam hacim 20

Tablo 4: MNase Master Mix tarifini.

Reaktif Birim (µL)
Elüsyon arabellek 30
Arabellek G2 8
Proteaz 2
Toplam hacim 40

Tablo 5: DNA arıtma Master Mix tarifini.

Reaktif Birim (µL)
Ultra saf su 3.3
Kısıtlama endonükleaz arabellek (örneğin NEBuffer) x 10 5
25 mM ATP 2
10 mM dNTPs 2
T4 Polinükleotit kinaz (10 U/µl) 1
T4 DNA polimeraz (3 U/µl) 1.5
DNA polimeraz ben büyük (Klenow) parça (5 U/µl) 0,2
Toplam hacim 15

Tablo 6: Son onarım Master Mix tarifini.

Reaktif Birim (µL)
Ultra saf su 8
Kısıtlama endonükleaz arabellek (örneğin NEBuffer) x 10 5
10 mM dATP 1
Klenow (3' - 5' exo-) 1
Toplam hacim 15

Tablo 7: A-takip Master Mix tarifini.

Reaktif Birim (µL)
Ultra saf su 4.3
5 x hızlı tüp ligasyonu arabellek 12
T4 DNA ligaz (2000 U/µl) 6,7
Toplam hacim 23

Tablo 8: Bağdaştırıcı ligasyonu Master Mix tarifini.

Reaktif Birim (µL)
Ultra saf su 7
25 uM PCR astar 1.0 2
HF arabellek x 5 12
DMSO 1.5
DNA polimeraz 0,5
Toplam hacim 23

Tablo 9: Tarifi PCR Master Mix için.

Sıcaklık (° C) Süre (s) Döngü sayısı
98 60 1
98 30
65 15 10
72 15
72 300 1
4 basılı tutun basılı tutun

Tablo 10: PCR yöntemi çalıştırın.

Oligo Sıra Değişiklik
PE_adapter 1 5'-/ 5Phos/GAT CGG AAG AGC GGT TCA GCA GGA ATG MOLDOVA'da AG -3 ' 5' değişiklik: fosforilasyon
PE_adapter 2 5' - ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TC * T - 3' 3' değişiklik: * T phosphorothioate bağ olduğunu

Ek tablo 1: PE bağdaştırıcısının üretimi Oligo serileri.

Astar adı Sıra Dizin IndexRevC (sıralama için kullanılacak)
PCR ters dizin oluşturma astar 1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGTGAT atcacg
PCR ters dizin oluşturma astar 2 CAAGCAGAAGACGGCATACGAGATCTGATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGATC gatcag
PCR ters dizin oluşturma astar 3 CAAGCAGAAGACGGCATACGAGATGGGGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGGGTT aacccc
PCR ters dizin oluşturma astar 4 CAAGCAGAAGACGGCATACGAGATCTGGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGGGT acccag
PCR ters dizin oluşturma astar 5 CAAGCAGAAGACGGCATACGAGATAGCGCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCGCT agcgct
PCR ters dizin oluşturma astar 6 CAAGCAGAAGACGGCATACGAGATCTTTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTTTTG caaaag
PCR ters dizin oluşturma astar 7 CAAGCAGAAGACGGCATACGAGATTGTTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGTTGG ccaaca
PCR ters dizin oluşturma astar 8 CAAGCAGAAGACGGCATACGAGATAGCTAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCTAG ctagct
PCR ters dizin oluşturma astar 9 CAAGCAGAAGACGGCATACGAGATAGCATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCATC gatgct
PCR ters dizin oluşturma astar 10 CAAGCAGAAGACGGCATACGAGATCGATTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGATTA taatcg
PCR ters dizin oluşturma astar 11 CAAGCAGAAGACGGCATACGAGATCATTCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CATTCA tgaatg
PCR ters dizin oluşturma astar 12 CAAGCAGAAGACGGCATACGAGATGGAACTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGAACT agttcc
PCR ters dizin oluşturma astar 13 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ACATCG cgatgt
PCR ters dizin oluşturma astar 14 CAAGCAGAAGACGGCATACGAGATAAGCTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AAGCTA tagctt
PCR ters dizin oluşturma astar 15 CAAGCAGAAGACGGCATACGAGATCAAGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CAAGTT aacttg
PCR ters dizin oluşturma astar 16 CAAGCAGAAGACGGCATACGAGATGCCGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCCGGT accggc
PCR ters dizin oluşturma astar 17 CAAGCAGAAGACGGCATACGAGATCGGCCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGGCCT aggccg
PCR ters dizin oluşturma astar 18 CAAGCAGAAGACGGCATACGAGATTAGTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TAGTTG caacta
PCR ters dizin oluşturma astar 19 CAAGCAGAAGACGGCATACGAGATGCGTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCGTGG ccacgc
PCR ters dizin oluşturma astar 20 CAAGCAGAAGACGGCATACGAGATGTATAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GTATAG ctatac
PCR ters dizin oluşturma astar 21 CAAGCAGAAGACGGCATACGAGATCCTTGCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CCTTGC gcaagg
PCR ters dizin oluşturma astar 22 CAAGCAGAAGACGGCATACGAGATGCTGTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCTGTA tacagc
PCR ters dizin oluşturma astar 23 CAAGCAGAAGACGGCATACGAGATATGGCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ATGGCA tgccat
PCR ters dizin oluşturma astar 24 CAAGCAGAAGACGGCATACGAGATTGACATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGACAT atgtca

Ek tablo 2: PCR ters astar dizileri dizin oluşturma.

Astar Sıra
ZNF333_genic_H3K9me3_F 5'-AGCCTTCAATCAGCCATCATCCCT-3'
ZNF333_genic_H3K9me3_R 5'-TCTGGTATGGGTTCGCAGATGTGT-3'
HOXA9-10_F 5'-ACTGAAGTAATGAAGGCAGTGTCGT-3'
HOXA9-10_R 5'-GCAGCAYCAGAACTGGTCGGTG-3'
GAPDH_genic_H3K36me3_F 5'-AGGCAACTAGGATGGTGTGG-3'
GAPDH_genic_H3K36me3_R 5'-TTGATTTTGGAGGGATCTCG-3'
GAPDH-F 5'-TACTAGCGGTTTTACGGGCG-3'
GAPDH-R 5'-TCGAACAGGAGGAGCAGAGAGCGA-3'
Histon değişiklik Olumlu hedef Negatif hedef
H3K4me3 GAPDH HOXA9-10
H3K4me1 GAPDH_genic ZNF333
H3K27me3 HOXA9-10 ZNF333
H3K27ac GAPDH ZNF333
H3K9me3 ZNF333 HOXA9-10
H3K36me3 GAPDH_genic ZNF333

Ek tablo 3: Astar için yaygın olarak kullanılan Histon işaretleri (H3K4me3, H3K4me1, H3K27me3, H3K27ac, H3K9me3 ve H3K36me3) listesi.

Ek dosya 1: ndChIP-seq çalışma. Bu dosyayı indirmek için buraya tıklayınız.

Ek kod dosyaları: qcQpcr_v1.2. Düşük giriş yerel ChIP-seq kütüphaneler qPCR zenginleştirme analizi için R istatistiksel yazılım paketi. Bu dosyayı indirmek için buraya tıklayınız.

Discussion

Kromatin modifiye ve transkripsiyon yönetmelikte konumlandırma nucleosome Kombinatorik doğası göz önüne alındığında, bu özelliklerin simultane ölçümleri sağlayan bir yöntem epigenetik yönetmelik yeni görüşler sağlamak olasıdır. Burada sunulan ndChIP seq Histon değişiklik ve nadir Primer hücre9,10nucleosome dansitesi eşzamanlı sorgu sağlamak için en iyi duruma getirilmiş bir yerel ChIP-seq protokoldür. ndChIP-seq kullanır Kromatin Enzimatik sindirim, soruşturma Histon değişiklikler tek nucleosome düzeyinde için eşleştirilmiş uç kitlesel paralel sıralama ve Gauss karışım dağıtım modeli birleştiğinde sağlar ve deconvolution epigenomic profilleri heterojen bir nüfus içinde tarafından tahrik. Bu iletişim kuralını kullanan, daha önce IMMUNO çöktürülmüş parçası boyutları, eşleştirilmiş uç sınırları, ChromHMM10,24tarafından tanımlanan belirli Kromatin Birleşik Devletleri ile ilişkili okumak tarafından belirlenen benzersiz bir dağıtım bildirdin.

NdChIP-seq kitaplığa kalitesini antikor özgüllük ve duyarlılık, optimal MNase sindirim koşullar ve Kromatin kalitesini gibi birden fazla faktöre bağlıdır. Başarılı ndChIP-seq Kütüphane üretiminde kullanılan antikor özgüllük önemlidir. İdeal bir antikor diğer epitopları ile küçük çapraz reaktivite ile ilgi epitope karşı yüksek afinite gösterir. Seçim antikor için en yüksek benzeşimli manyetik boncuklar seçmek aynı derecede önemlidir.

MNase sindirim bu protokolündeki kritik ve zaman ve konsantrasyon duyarlı bir tepkidir. Bu nedenle, birden fazla örnekleri işlerken her reaksiyon zaman eşit miktarda için inkübe önemli (bkz. Adım 2.2). Kromatin kalitesini önemli ölçüde ndChIP-devamı parçalanmış Kromatin ile potansiyel müşteriler alt-optimal MNase sindirim profil ve kitaplıkları sonuçlarında düşük sinyal gürültü oranı, sonucunu etkiler başka bir faktördür. Düşük birincil numune canlılığı hücre veya parafin gömülü (FFPE) doku formalin sabit tavsiye edilmez bu iletişim kuralı için gibi Kromatin, bozulmuş.

Bir PIC ek Kromatin ayıklama sırasında azaltır istenmeyen (Yani, rasgele) Kromatin parçalanma ve korur bütünlüğünü Histon kuyrukları. Bu nedenle, PIC lizis tampon ve immunoprecipitation tampon sadece önceki için kullanmak için eklenmesi gerekir. Akış Sitometresi ile seçme hücreleri için hücrelerin seçin ve olun iken hücreleri hücre canlılık ve hücre sayı tahmin doğruluğu artırmak için düşük akış hızı sıralanır. Hücre lizis arabelleğine doğrudan sıralama kaçının. Kılıf arabellek lizis arabellek sulandırmak ve hücre zarının etkili permeabilization MNase için engeller. Hücreleri veya organizma türüne bağlı olarak, MNase titrasyon en iyi sindirim almak için gerekli.

ndChIP-seq memeli hücreleri üzerinde dar işaretleri ve 100 milyon eşleştirilmiş okuma (50 milyon parçaları) için geniş işaretleri ve giriş için en az sıralama derinlik 50 milyon eşleştirilmiş okur (25 milyon parçaları) gerektirir. Gauss karışım dağıtım algoritma bir derinlik önemli ölçüde bu öneri aşağıda sıralı kütüphaneler çalışmayacaktır. ndChIP-seq rehberleri ile mono ve di nucleosome parçası uzunlukta parçalara mono veya di hakim nucleosome rehberleri ağırlıklı dağıtım değeri arasında küçük bir ayrım sınıflandırmak değil. Bu nedenle, bu Organizatör daha sonraki analiz kaldırılması gerekir. Biyolojik çoğaltır öngörülen dağıtımları güven artırmak ve MNase sindirim ve Kütüphane inşaat teknik değişkenliği tanımlamak için oluşturulabilir.

Önceki tekrarlamalar yerli ChIP-seq iletişim kurallarının ndChIP seq parçası boyutu yazı immunoprecipitation nucleosome yoğunluğu entegre kullanarak Kromatin yapısı ve Histon değişikliği Kombinatorik etkisini araştırmak için araçlar sağlar, Histon değişiklik ölçümleri kullanarak MNase erişilebilirliği belirler. NdChIP-seq uygulama Primer hücre ve dokulara epigenetik yönetmelik bütünleştirici niteliği yeni anlayışlar sağlamak ve heterojenlik nüfus içinde nedeniyle epigenetik imzalar tanımlanmasına izin.

Disclosures

Yazarlar onlar rakip hiçbir mali çıkarları var bildirin.

Acknowledgements

Al Kanada yüksek lisans burs Kanada Sağlık Araştırma enstitüleri tarafından desteklenmiştir. Bu eser genom British Columbia ve Kanada Enstitüleri Sağlık Araştırma (CIHR-120589) Kanadalı epigenetik, çevre ve Sağlık Araştırma Konsorsiyumu girişiminin bir parçası olarak gelen hibe ve Terry Fox Araştırma Enstitüsü Program tarafından desteklenmiştir Proje Grant #TFF-122869 M.H. ve bir Terry Fox Araştırma Enstitüsü yeni Araştırmacı Ödülü (Grant # 1039) M.H. için

Materials

Name Company Catalog Number Comments
1M Tris-HCl –pH 7.5 Thermo Scientific 15567-027
1M Tris-HCl –pH 8 Thermo Scientific 15568-025
0.5M EDTA Thermo Scientific AM9260G
5M NaCl Sigma 1001385276
Triton X-100 Sigma 1001412354
Sodium-Deoxycholate Sigma 1001437582
SDS Thermo Scientific 15525-017
Sodium-Bicarbonate Fisher Scientific S233-500
100% EtOH NA NA
V-bottom 96 well plate (AB 1400) Thermo Scientific AB-1400-L
Gilson P2 pipetman Mandel F144801
Gilson P10 pipetman Mandel F144802
Gilson P20 pipetman Mandel F123600
Gilson P100 pipetman Mandel F123615
Gilson P200 pipetman Mandel F123601
Gilson P1000 pipetman Mandel F123603
Micrococcal Nuclease  NEB M0247S
Thermo Mixer C (Heating block mixer) Eppendorf 5382000023
Multi 12-channel Pippet P20 Rainin 17013803
Multi 12-channel Pippet P200 Rainin 17013805
1.5 ml LoBind tube Eppendorf 22431021
0.5 ml LoBind tube Eppendorf 22431005
Plastic Plate Cover Edge Bio 48461
PCR cover Bio Rad MSD-1001
Aluminum Plate Cover Bio Rad MSF-1001
Elution buffer (EB buffer) Qiagen 19086
1M DTT Sigma 646563
Eppendorf 5810R centrifuge  Eppendorf 22625004
Ultrapure water Thermo Scientific 10977-015
Protein G dynabeads Thermo Scientific 10001D
Protein A dynabeads Thermo Scientific 10001D
Protease inhibitor Cocktail Calbiochem 539134
Rotating platform Mandel 1b109-12052010
Plate magnet Alpaqua 2523
Domed 12-cap strip Bio Rad TCS1201
Buffer G2 Qiagen 1014636
Protease Qiagen 19155
Tube Magnet (DynaMag-2) Thermo Scientific 12321D
Tube Magnet (DynaMag-2) LabCore 730-006
V shape Plastic reservoir Mandel S0100A
Vortex Mandel C1801
Mini Fuge Mettler Toledo XS2035
Analytical scale Mandel LB109-12052010
Quick Ligation Reaction Buffer, 5X NEB B6058S
DNA Polymerase I, Large (Klenow) Fragment NEB M0210S
Klenow Fragment (3'-5' exo) NEB M0212S
T4 DNA Polymerase NEB M0203S
T4 Polynucleotide Kinase NEB M0201S
Deoxynucleotide Solution mix, 10mM NEB N0447S
dATP Solution 10mM NEB N0440S
Quick T4 DNA Ligase NEB M0202T
Adenosine 5'-Triphosphate (ATP), 25mM NEB P0756S
DNA Polymerase Thermo Scientific F549L
NEBuffer 2 NEB B7002S
Hank's buffered salt solution Thermo Scientific 14025076
Fetal bovine serum  Thermo Scientific A3160702
phosphate buffer saline  Thermo Scientific 10010023
H3K4me3 Cell Signaling 9751S
H3K4me1 Diagenode C15410037
H3K27me3 Diagenode pAb-069-050
H3K36me3 Abcam ab9050
H3K9me3 Diagenode C15410056
SeraMag  super-paramagnetic beads

DOWNLOAD MATERIALS LIST

References

  1. Simpson, R. T. Nucleosome Positioning: Occurrence, Mechanisms, and Functional Consequences. Prog. Nucleic Acid Res. Mol. Biol. 40, Issue C 143-184 (1991).
  2. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundmamental particle of the eukaryotic chromosome. Cell. 98, 285-294 (1999).
  3. Schones, D. E., et al. Dynamic regulation of nucleosome positioning in the human genome. Cell. 132, (5), 887-898 (2008).
  4. Segal, E., et al. A genomic code for nucleosome positioning. Nature. 442, (7104), 772-778 (2006).
  5. Shiio, Y., Eisenman, R. N. Histone sumoylation is associated with transcriptional repression. PNAS. 100, (23), 13225-13230 (2003).
  6. Li, L., Lorzadeh, A., Hirst, M. Regulatory variation: An emerging vantage point for cancer biology. Wiley Interdiscip. Rev. Syst. Biol. Med. 6, (1), 37-59 (2014).
  7. Jiang, J., et al. Investigation of the acetylation mechanism by GCN5 histone acetyltransferase. PLoS ONE. 7, (5), (2012).
  8. Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12, (2), 198-209 (2002).
  9. Brind'Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M. M., Lorincz, M. C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 6, 6033 (2015).
  10. Lorzadeh, A., et al. Nucleosome Density ChIP-Seq Identifies Distinct Chromatin Modification Signatures Associated with MNase Accessibility. Cell Rep. 17, (8), 2112-2124 (2016).
  11. Noll, M., Kornberg, R. D. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109, (3), 393-404 (1977).
  12. Skene, P. J., Henikoff, S. A simple method for generating high-resolution maps of genome wide protein binding. eLife. 4, 09225 (2015).
  13. Brogaard, K., Xi, L., Wang, J. -P., Widom, J. A map of nucleosome positions in yeast at base-pair resolution. Nature. (2012).
  14. Cui, K., Zhao, K. Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods Mol. Biol. 833, 413-419 (2012).
  15. Mieczkowski, J., et al. MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat. Commun. 7, 11485 (2016).
  16. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). JOVE. (41), (2010).
  17. Rohland, N., Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, (5), 939-946 (2012).
  18. Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., Rudensky, A. Y. Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 445, (7130), 936-940 (2007).
  19. Krishnakumar, R., Gamble, M. J., Frizzell, K. M., Berrocal, J. G., Kininis, M., Kraus, W. L. Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes. Science. 319, (5864), 819-821 (2008).
  20. Mendenhall, E. M., et al. Locus-specific editing of histone modifications at endogenous enhancers. Nat. Biotechnol. 31, (12), 1133-1136 (2013).
  21. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  22. Reference Epigenome Standards - IHEC. Available from: http://ihec-epigenomes.org/research/reference-epigenome-standards/ (2017).
  23. Heinz, S., et al. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 38, (4), 576-589 (2010).
  24. Feng, J., Liu, T., Qin, B., Zhang, Y., Liu, X. S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 7, (9), 1728-1740 (2012).
  25. Fraley, C., Raftery, A. E. MCLUST: Software for Model-Based Cluster Analysis. J. Classif. 16, (2), 297-306 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics