देशी क्रोमेटिन Immunoprecipitation प्रयोग Murine ब्रेन ट्यूमर Neurospheres

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Epigenetic तंत्र अक्सर तंत्रिकाबंधार्बुद में बदल रहे हैं । क्रोमेटिन immunoprecipitation तंत्रिकाबंधार्बुद में आनुवंशिक परिवर्तन के परिणाम है कि citrullinated संशोधनों जो क्रोमेटिन संरचना और जीन प्रतिलेखन को विनियमित में परिवर्तन से परिणाम का अध्ययन किया जा सकता है । यह प्रोटोकॉल murine ब्रेन ट्यूमर neurospheres पर नेटिव क्रोमेटिन immunoprecipitation का वर्णन करता है ।

Cite this Article

Copy Citation | Download Citations

Mendez, F. M., Núñez, F. J., Zorrilla-Veloz, R. I., Lowenstein, P. R., Castro, M. G. Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres. J. Vis. Exp. (131), e57016, doi:10.3791/57016 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Epigenetic संशोधन तंत्रिकाबंधार्बुद के विकास और प्रगति में शामिल हो सकते हैं । oncogenes और ट्यूमर दमन के प्रवर्तकों और विनियामक क्षेत्रों के मिथाइल और acetylation में परिवर्तन जीन अभिव्यक्ति में परिवर्तन करने के लिए नेतृत्व कर सकते हैं और ब्रेन ट्यूमर के रोगजनन में एक महत्वपूर्ण भूमिका निभाते हैं । देशी क्रोमेटिन immunoprecipitation (चिप) एक लोकप्रिय तकनीक है कि संशोधनों या अंय प्रोटीन का पता लगाने की अनुमति देता है कसकर डीएनए के लिए बाध्य । पार से जुड़े चिप के विपरीत, देशी चिप में, कोशिकाओं को डीएनए के लिए covalently लिंक प्रोटीन formaldehyde के साथ इलाज नहीं कर रहे हैं । यह लाभप्रद है क्योंकि कभी crosslinking प्रोटीन है कि केवल क्षणिक डीएनए के साथ बातचीत और जीन विनियमन में कार्यात्मक महत्व नहीं है ठीक हो सकता है । इसके अलावा, एंटीबॉडी आम तौर पर फिक्स्ड पेप्टाइड्स के खिलाफ उठाया जाता है । इसलिए, एंटीबॉडी विशिष्टता देशी चिप में वृद्धि हुई है । हालांकि, यह ध्यान में रखना महत्वपूर्ण है कि देशी चिप केवल histones या अंय प्रोटीन है कि डीएनए को कसकर बांध अध्ययन करने के लिए लागू है । यह प्रोटोकॉल murine ब्रेन ट्यूमर neurospheres पर नेटिव क्रोमेटिन immunoprecipitation का वर्णन करता है ।

Introduction

Epigenetic घटनाओं ग्लियोमास में लगातार कर रहे है और संभावना ट्यूमर रोगजनन में एक महत्वपूर्ण भूमिका निभाते हैं । दरअसल, बाल चिकित्सा उच्च ग्रेड तंत्रिकाबंधार्बुद में, जीन में उत्परिवर्तनों citrullinated वेरिएंट एच 3.3 और एच 3.1 एन्कोडिंग अक्सर1होते हैं । उत्परिवर्तनों citrullinated संशोधनों को प्रभावित और प्रमुख epigenetic है पछले2,3. वयस्क स्पेक्ट्रम के लिए किशोर में, isocitrate डिहाइड्रोजनेज जीन 1/2 में आवर्तक उत्परिवर्तनों (IDH1/2), एक उत्परिवर्तन है कि α-किलो पर निर्भर citrullinated और डीएनए de-methylasaes रोकता है, और ऐसे क्रोमेटिन और ATRX के रूप में अंय DAXX नियामकों में आनुवंशिक परिवर्तन हो सकता है 4. इसलिए, यह महत्वपूर्ण महत्व का अध्ययन करने के लिए कैसे उत्परिवर्तनों कि प्रभावित epigenetic नियामकों क्रोमेटिन संरचना और विनियामक citrullinated संशोधनों, जो बारी में बदल, ट्यूमर ' कोशिकाओं transcriptome के एक नाटकीय प्रभाव है ।

क्रोमेटिन immunoprecipitation (चिप) एक शक्तिशाली जीनोम5,6,7में epigenetic संशोधनों के प्रभाव का मूल्यांकन करने के लिए प्रयोग किया जाता उपकरण है । देशी चिप में, क्रोमेटिन micrococcal nuclease (MNase), immunoprecipitated एक एंटीबॉडी ब्याज के प्रोटीन के खिलाफ उठाया का उपयोग कर के साथ पचा रहा है, और फिर डीएनए immunoprecipitated क्रोमेटिन परिसर से शुद्ध है6। कोशिकाओं प्रक्रिया के दौरान तय नहीं कर रहे है तो यह तकनीक केवल प्रोटीन है कि डीएनए के साथ कसकर बातचीत6के अध्ययन के लिए लागू है । पार से जोड़ने एड्स एंटीबॉडी विशिष्टता के अभाव के बाद से एंटीबॉडी आम तौर पर फिक्स्ड पेप्टाइड या प्रोटीन के खिलाफ7उठाया जाता है । इसके अलावा, के बाद से वहां कोई पार से जोड़ने कदम है, यह क्षणिक प्रोटीन-डीएनए बातचीत है कि गैर विशिष्ट है और नहीं विनियामक7,8फिक्सिंग की संभावना कम कर देता है । चिप एक विशिष्ट जीनोमिक क्षेत्र में citrullinated संशोधनों के संवर्धन की पहचान करने के लिए इस्तेमाल किया जा सकता है । यहां, हम विस्तार neurospheres में देशी चिप (एन एस) तंत्रिकाबंधार्बुद के आनुवंशिक रूप से इंजीनियर माउस मॉडल से उत्पंन प्रदर्शन के लिए एक प्रोटोकॉल ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

यहां वर्णित सभी तरीकों को मिशिगन विश्वविद्यालय के संस्थागत पशु देखभाल और उपयोग समिति (IACUC) द्वारा अनुमोदित किया गया है ।

1. मस्तिष्क ट्यूमर एन एस और संवर्धन स्थितियों की पीढ़ी ।

  1. Dulbecco के संशोधित ईगल मध्यम/F12B27 अनुपूरक (1x), N2 अनुपूरक (1x), और रोगाणुरोधी एजेंट के साथ तंत्रिका स्टेम सेल माध्यम (एनएससी) तैयार करें । पूरक एनएससी मध्यम मानव संयोजक endothelial वृद्धि कारक (EGF) और बुनियादी fibroblast वृद्धि कारक (FGF) के साथ प्रयोग के दिन पर एक अंतिम एकाग्रता 20 एनजी/
  2. नींद ब्यूटी transposon प्रणाली का उपयोग कर माउस में मस्तिष्क ट्यूमर प्रेरित जिसमें plasmids एन्कोडिंग oncogenes या shRNA लक्ष्यीकरण ट्यूमर दमन नवजात के पार्श्व निलय में इंजेक्शन है सहज मस्तिष्क ट्यूमर उत्पन्न करने के लिए9. एक बड़े ट्यूमर है, जो bioluminescence इमेजिंग के साथ की पुष्टि की है के साथ एक माउस का चयन करें ।
    नोट: स्लीपिंग ब्यूटी Transposon सिस्टम और प्लाज्मिड के इस्तेमाल के बारे में अधिक विस्तृत जानकारी Calinescu एट अल में पाया जा सकता है । 9.
    1. चूहों की छवि के लिए, एक 26 गेज सुई का उपयोग कर 30 मिलीग्राम/एमएल luciferin समाधान intraperitoneally के १०० µ एल इंजेक्षन ।
    2. luciferin के इंजेक्शन के बाद 5 मिनट, ऑक्सीजन के साथ एक संज्ञाहरण चैंबर का उपयोग कर पशु anesthetize/isoflurane प्रवाह 2% isoflurane के लिए सेट ।
    3. जब जानवरों anesthetized रहे हैं (आमतौर पर 2-3 मिनट), ऑक्सीजन isoflurane के साथ bioluminescence चैंबर में जानवरों की जगह 2% isoflurane के लिए सेट. अगर जानवरों के लिए संज्ञाहरण के तहत किया जाएगा से अधिक 5 मिनट, सूखापन को रोकने के लिए एक नेत्र मरहम का उपयोग करते हुए संज्ञाहरण के तहत ।
    4. छवि निंनलिखित मापदंडों के साथ vivo ऑप्टिकल इमेजिंग प्रणाली में एक का उपयोग कर चूहों: स्वचालित एक्सपोजर, बड़ी बिन्नी, और एपर्चर f = 1 । यह एक बड़ा ट्यूमर पर विचार करने के लिए पैरामीटर एक bioluminescence है > 106 फोटॉनों/s/
  3. Euthanize एक बंद कक्ष में isoflurane सांस लेना संवेदनाहारी की अधिक मात्रा के साथ माउस, पैर की अंगुली चुटकी द्वारा जांच है कि पशु anesthetized है, और माउस decapitate ।
  4. मस्तिष्क निकालने और यह टुकड़े के रूप में Calinescu एट अल में पहले वर्णित है. 9.
  5. ब्रेन को 10 सेमी पेट्री डिश में लगाएं । यदि ट्यूमर प्रेरित एक फ्लोरोसेंट प्रोटीन व्यक्त करता है, एक फ्लोरोसेंट विदारक माइक्रोस्कोप उपयुक्त फ्लोरोसेंट चैनल और 0.3 x वृद्धि करने के लिए सेट का उपयोग करें, अंयथा ऊतक रंग और बनावट में मतभेदों के द्वारा ट्यूमर द्रव्यमान की पहचान । सामान्य मस्तिष्क से ट्यूमर के ऊतकों को अलग करने के लिए स्केलपेल और संदंश का प्रयोग करें ।
  6. पेट्री डिश में छोटे टुकड़ों में ट्यूमर कीमा । एनएससी मीडियम के ३०० µ l के साथ एक १.५ एमएल ट्यूब में विच्छेदित ट्यूमर रखें ।
  7. एक डिस्पोजेबल प्लास्टिक की गोली खल कि एक शंकु microcentrifuge ट्यूब की दीवारों को धीरे ट्यूमर homogenize के लिए फिट बैठता है का प्रयोग करें । सेल टुकड़ी के 1 मिलीलीटर मध्यम जोड़ें और ३७ डिग्री सेल्सियस पर 5 मिनट के लिए नमूना मशीन ।
    नोट: एक मूसल का उपयोग कुछ कोशिकाओं को मार सकता है । यदि पाठक कोशिका व्यवहार्यता को अधिकतम करना चाहता है, एक खल का उपयोग लोप हो सकता है ।
  8. एक ७० µm सेल छलनी के माध्यम से १.७ कदम से सेल निलंबन दर्रा और एनएससी मध्यम के 25 मिलीलीटर के साथ छलनी धोने ।
  9. कमरे के तापमान पर 5 मिनट के लिए ३०० x g पर निलंबन केंद्रापसारक, supernatant और पुन: एनएससी मध्यम के 6 मिलीलीटर में गोली निलंबित ।
  10. प्लेट एक टी में १.९ कदम से ट्यूमर सेल निलंबन-25 संस्कृति कुप्पी और संस्कृति यह ३७ डिग्री सेल्सियस में एक ऊतक संस्कृति मशीन में ९५% हवा और 5% सह के साथ एक वातावरण के साथ2। आमतौर पर 3 दिनों के बाद, वहाँ कुछ मृत कोशिकाओं का एक मिश्रण होगा, पालन कोशिकाओं और कुछ कोशिकाओं एनएस बनाने जो मध्यम में फ्लोट.
  11. एक 15 मिलीलीटर शंकु ट्यूब में सेल निलंबन स्थानांतरण, केवल कोशिकाओं है कि एक micropipette का उपयोग कर नीचे करने के लिए सिंक और एक टी-७५ ऊतक संस्कृति कुप्पी पर फिर से उन्हें थाली इकट्ठा ।
  12. अपेक्षाकृत उच्च घनत्व पर कोशिकाओं को बनाए रखने (एक टी 25 में 1-3 X 106 कोशिकाओं) । जब वे धाराप्रवाह है कोशिकाओं बीतने ।
    नोट: प्रवाह क्षेत्रों आकार द्वारा निर्धारित किया जाता है । बड़े क्षेत्रों के काले केंद्रों का मतलब है कि केंद्र में मृत कोशिकाओं रहे है और संकेत मिलता है कि कोशिकाओं को तुरंत पारित किया जाना चाहिए ।
  13. वृद्धि कारकों जोड़ें (EGF और बुनियादी-FGF; 20 हर तीन दिन एनजी/ जब कोशिकाएं धाराप्रवाह न हों और मध्यम प्रकाश नारंगी हो जाता है तो मध्यम बदलें ।
  14. माध्यम बदलने के लिए, पुराने माध्यम को इकट्ठा करने और 5 मिनट के लिए कमरे के तापमान पर ३०० x g पर यह केंद्रापसारक और फिर से एनएससी माध्यम में सेल गोली निलंबित १.१ चरण में निर्दिष्ट एकाग्रता पर EGF और FGF के साथ पूरक ।
    नोट: यदि क्षेत्रों के मध्य में उच्च प्रवाह के लिए कर रहे हैं, लेकिन तैयार नहीं है (क्षेत्र आकार एक व्यास < १०० µm के साथ छोटा है), तो गोली दो कुप्पी में विभाजित किया जा सकता है ।
  15. कोशिकाओं को पारित करने के लिए, कमरे के तापमान पर 5 मिनट के लिए ३०० x g पर कोशिकाओं के केंद्रापसारक, supernatant और सेल टुकड़ी मध्यम में ३७ डिग्री सेल्सियस पर 5 मिनट के लिए कोशिकाओं की मशीन ।
    1. संतुलित नमक समाधान के 5 मिलीलीटर जोड़ें टुकड़ी मध्यम पतला और यह ३०० x जी पर कमरे के तापमान पर 5 मिनट के लिए केंद्रापसारक ।
    2. supernatant, एनएससी मध्यम के 18 मिलीलीटर में सेल गोली reसस्पेंड और निलंबन समान रूप से तीन टी 25 कुप्पी में विभाजित ।
  16. कक्षों की aliquots फ़्रीज़ करने के लिए, चरण १.१५ में कक्षों को अलग, और 10% dimethyl sulfoxide के साथ ९०% भ्रूण गोजातीय सीरम के 1 मिलीलीटर aliquots में कक्षों को फ़्रीज़ करें. धीमे 10 मिनट के लिए बर्फ पर कोशिकाओं रखकर कोशिकाओं को शांत है, तो कोशिकाओं को रखने के लिए-20 ° c 30 मिनट के लिए, और-८० ° c 1 दिन के लिए. अगले दिन, कोशिकाओं को एक तरल नाइट्रोजन भंडारण कंटेनर के लिए स्थानांतरण ।

2. देशी चिप

  1. क्रोमेटिन तयारी
    1. प्राप्त एनएस, संस्कृति एन एस में एक टी में ७५ के शेयर बनाने के बाद ३७ डिग्री सेल्सियस में एनएससी मध्यम से एक ऊतक संस्कृति मशीन में एक वातावरण के साथ ९५% हवा और 5% सह के साथ 15 मिलीलीटर में एनएस जब तक एन एस धाराप्रवाह हो । एक धाराप्रवाह टी ७५ प्लेट 3-5 एक्स 106 कोशिकाओं उपज जाएगा ।
    2. जब कोशिकाओं को धाराप्रवाह हो जाते हैं, 5 मिनट के लिए ३०० x g में एनएस, supernatant और सेल पृथक्करण मध्यम के 1 मिलीलीटर जोड़ सकते हैं । 5 मिनट के लिए ३७ ° c में कोशिकाओं की मशीन । मध्यम के 5 मिलीलीटर जोड़ें और एक hemocytometer10का उपयोग कर कोशिकाओं की गिनती ।
      नोट: 1 x 106 कोशिकाओं प्रति immunoprecipitation (आईपी) प्रतिक्रिया की जरूरत है । ध्यान दें कि एक पूर्व प्रतिरक्षा सीरम या आईजीजी नियंत्रण भी शामिल किया जाना चाहिए11.
    3. 5 मिनट के लिए ३०० एक्स जी में एक १.५ मिलीलीटर microcentrifuge ट्यूब में एन एस के केंद्रापसारक, supernatant और पुन: एक संतुलित नमक समाधान के 1 मिलीलीटर के साथ एनएस गोली निलंबित और कम प्रोटीन बाध्यकारी १.५ मिलीलीटर microcentrifuge ट्यूबों के लिए निलंबन स्थानांतरण ।
    4. 5 मिनट के लिए ३०० x g पर एनएस केंद्रापसारक, supernatant और फिर से µ के पाचन बफर (५० mm Tris-एचसीएल, पीएच ८.०, 1 मिमी CaCl2, ०.२% पॉलीथीन ग्लाइकोल octylphenyl ईथर) के प्रति 1 x 106 कोशिकाओं को छेड़ने के साथ पूरक में सेल गोली निलंबित एक उच्च एकाग्रता (1:100) में अवरोधक कॉकटेल । तुरंत प्लास्टिक के ऊपर और नीचे के झुरमुट को रोकने और किसी भी बुलबुले बनाने से बचने के लिए ।
    5. MNase ५०% ग्लिसरॉल में 1 मिलीग्राम/एमएल समाधान (१.१५ इकाइयों/µ एल, पर संग्रहित-20 ° c) है कि "1x" शेयर के रूप में भेजा जाएगा बनाने के लिए reसस्पेंड । ५०% ग्लिसरॉल के साथ एक दूसरे 1:9 कमजोर पड़ने से एक "0.1 x" शेयर बनाओ (उदा., ९०० µ l के "1x" MNase और १०० µ l के ५०% ग्लिसरॉल) और यह दुकान-20 ° c.
    6. "0.1 x" MNase और पाचन बफर के १४५ µ एल के 5 µ एल मिश्रण । सभी समय बर्फ पर एंजाइम रखें । 1 x 106 कोशिकाओं प्रति पाचन बफर में पतला MNase के 5 µ एल जोड़ें । झटका ट्यूब मिश्रण करने के लिए और ठीक 12 मिनट के लिए ३७ डिग्री सेल्सियस ब्लॉक में ट्यूब जगह है । एक समय में एक नमूने की प्रक्रिया 12 मिनट की एक सटीक मशीन समय सुनिश्चित करने के लिए ।
    7. 1 x 106 कोशिकाओं प्रति 10x MNase स्टॉप बफर (११० mm Tris-एचसीएल, पीएच ८.०, ५५ mm EDTA) के 10 µ एल जोड़ें । नमूने इस बिंदु के बाद से बर्फ पर रखा जाना चाहिए ।
    8. जोड़ें ११० µ l "2x RIPA बफर" (२८० mM NaCl, १.८% पॉलीथीन ग्लाइकोल octylphenyl ईथर, ०.२% सोडियम dodecyl सल्फेट (एसडीएस), ०.२% न-deoxycholate, 5 मिमी ईथीलीन ग्लाइकोल-बीआईएस (β-aminoethyl ईथर)-n, n, n ', N'-tetraacetic एसिड (EGTA); 4 डिग्री सेल्सियस पर संग्रहित) के साथ पूरक 1 x 106 कक्षों के प्रति उच्च एकाग्रता (1:100) पर चिढ़ाना अवरोधक कॉकटेल । मिश्रण करने के लिए ट्यूब झटका ।
    9. एक microfuge में 15 मिनट के लिए ट्यूबों 4 डिग्री सेल्सियस और १७०० एक्स जी पर एक नया नियमित १.५ मिलीलीटर microcentrifuge ट्यूबों के लिए supernatant हस्तांतरण (कम प्रोटीन बाध्यकारी microcentrifuge ट्यूबों अब आवश्यक नहीं हैं) और उंहें बर्फ पर दुकान । गोली छोड़ें ।
  2. Immunoprecipitation (IP)
    1. मिश्रण एक 1:1 अनुपात में प्रोटीन ए और प्रोटीन जी चुंबकीय मोती । हर आईपी के लिए, मोती के 25 µ एल तैयार करते हैं ।
    2. RIPA बफर के 1 मिलीलीटर (10 मिमी Tris पीएच ८.० जोड़कर मोती धो, 1 मिमी EDTA, १४० मिमी NaCl, 1% पॉलीथीन ग्लाइकोल octylphenyl ईथर, ०.१% एसडीएस, ०.१% ना-deoxycholate; 4 डिग्री सेल्सियस पर संग्रहित) कम एकाग्रता (1:1000) में छेड़ने अवरोधकों के साथ पूरक ।
    3. एक चुंबक का प्रयोग करें मोतियों की अनुमति के लिए धोने के समाधान और खिचड़ी भाषा धोने समाधान से अलग (लगभग 1 मिनट) । दो बार धो चरण निष्पादित करें ।
    4. पुन: निलंबित मूल RIPA बफर का उपयोग करने की मात्रा के लिए मोतियों की आवाज छेड़ने वाले अवरोधकों (1:1000) के साथ पूरक ।
    5. यदि आवश्यक हो, क्रोमेटिन RIPA बफर का उपयोग कर चिढ़ा अवरोधकों के साथ पूरक (1:1000) इतना है कि प्रत्येक आईपी 100-200 µ एल का एक खंड है आरक्षित इनपुट के लिए क्रोमेटिन के आईपी प्रति इस्तेमाल की मात्रा का 10% ।
      नोट: उदाहरण के लिए, यदि २०० µ एल प्रति IP उपयोग किया जाता है, 20 µ l पतला क्रोमेटिन के इनपुट के लिए आरक्षित किया जाना चाहिए । कुल चार आईपीएस के लिए, कुल क्रोमेटिन मात्रा ८२० µ के लिए पतला होना चाहिए l
    6. इनपुट तैयार करें । जोड़ें १०० µ एल ते बफर (10 मिमी Tris-एचसीएल पीएच ८.०, 1 मिमी EDTA) proteinase K के साथ पूरक (०.५ mg/एमएल) इनपुट करने के लिए और 1 ज के लिए ५५ ° c पर इनपुट मशीन ।
      नोट: चरण 2.2.6-2.2.7 चरण 2.3.4 और 2.4.1 के साथ किया जा सकता है ।
    7. निर्माता के निर्देशों का पालन करते हुए एक पीसीआर शुद्धिकरण किट का प्रयोग कर इनपुट को शुद्ध करें और किट में दिए गए रेफरेंस बफर के ५० µ l में elute ।
    8. एक microvolume spectrophotometer का उपयोग कर इनपुट की एकाग्रता को मापने और एक नोटबुक में परिणाम रिकॉर्ड. किट से रेफरेंस बफर के साथ रिक्त ।
      नोट: माउस neurospheres में, हम प्रत्येक आईपी के लिए डीएनए के लगभग 6 µ जी का इस्तेमाल किया ।
    9. एक 1% जेल पर इनपुट चलाने या मानक सेटिंग्स का उपयोग कर एक डीएनए के विश्लेषक पर 1 µ एल लोड । बहाव अनुप्रयोगों में इनपुट के रूप में उपयोग के लिए शेष की दुकान ।
    10. 1 घंटे में 4 डिग्री सेल्सियस के लिए हर आईपी और गर्मी आईपी के लिए धोया प्रोटीन एक और जी चुंबकीय मोती के 10 µ एल जोड़ें ।
      नोट: उदाहरण के लिए, तीन आईपीएस के लिए प्रोटीन ए और जी चुंबकीय मोतियों की 30 µ एल जोड़ें ।
    11. एक चुंबक पर नमूने प्लेस और मोती अलग करने के लिए अनुमति देते हैं । एक नया १.५ मिलीलीटर ट्यूब में पहले से निर्धारित राशि स्थानांतरित करके क्रोमेटिन विभाजित ।
    12. एंटीबॉडी जोड़ें और वाष्पीकरण से बचने के लिए प्लास्टिक आयल फिल्म के साथ टोपियां लपेटें । 20 rpm पर रोटेशन के साथ 4 डिग्री सेल्सियस पर रातोंरात नमूने की मशीन ।
      नोट: एकाग्रता empirically निर्माता सिफारिशों के बाद निर्धारित किया जाना चाहिए ।
    13. अगले दिन, ट्यूबों का उपयोग कर एक मिनी कमरे के तापमान पर केंद्रापसारक, २००० x जी, 10 एस के लिए स्पिन । उसके बाद प्रत्येक आईपी और 20 rpm पर रोटेशन के साथ 4 डिग्री सेल्सियस पर 3 घंटे के लिए गर्मी आईपी के लिए मोती के 10 µ एल जोड़ें ।
  3. आईपी बहाकर और प्रोटीन पाचन
    1. जोड़ें १५० µ RIPA बफर के एल कम एकाग्रता (1:1000) में प्रत्येक आईपी और 4 डिग्री सेल्सियस पर 20 rpm के लिए 5 मिनट के लिए पर रोटेशन के साथ मशीन आईपी पर तंग अवरोधकों के साथ पूरक । एक चुंबकीय स्टैंड पर नमूना प्लेस और चुंबकीय मोती अलग करने के लिए अनुमति देते हैं । supernatant को निकालने के लिए किसी प्लास्टिक का उपयोग करें । इस tep को पांच बहाकर दोहराएं ।
    2. LiCl बफर के १५० µ एल जोड़ें (२५० mm LiCl, 10 मिमी Tris पीएच ८.०, 1 mM EDTA, ०.५% NP-४०, ०.५% Na-deoxycholate; 4 डिग्री सेल्सियस पर स्टोर) कम एकाग्रता (1:1000) में प्रत्येक आईपी और 4 डिग्री सेल्सियस पर 5 मिनट के लिए 20 rpm पर रोटेशन के साथ गर्मी आईपी को छेड़ने अवरोधकों के साथ पूरक । नमूना रखें एक चुंबकीय खड़े पर और अलग करने के लिए चुंबकीय मोतियों की अनुमति देते हैं । supernatant निकालने के लिए किसी प्लास्टिक का उपयोग करें ।
    3. ठंड ते के १५० µ एल जोड़ें (कोई चिढ़ाने अवरोधों) और 5 मिनट के लिए 20 rpm पर रोटेशन के साथ 4 डिग्री सेल्सियस पर नमूना मशीन । एक चुंबकीय स्टैंड पर नमूना प्लेस और चुंबकीय मोतियों को अलग करने की अनुमति । supernatant को निकालने के लिए किसी प्लास्टिक का उपयोग करें ।
    4. अंतिम धुलाई चरण के बाद, फिर से १०० µ एल में नमूने को निलंबित ते proteinase K (०.५ mg/एमएल) के साथ पूरक बफर और 1 एच के लिए ५५ ° c पर नमूना मशीन ।
  4. डीएनए शुद्धि और चिप मात्रात्मक वास्तविक समय पीसीआर (qPCR)
    1. एक पीसीआर शोधन किट का उपयोग डीएनए immunoprecipitated शुद्ध । किट से प्रत्येक नमूने के लिए डीएनए बाध्यकारी बफर के अलावा, एक चुंबक पर ट्यूब जगह है और चुंबकीय मोती कुल तक इंतजार है, तो सफाई कॉलम में supernatant हस्तांतरण । निर्माता के निर्देशों का पालन करें और किट में दिए गए रेफरेंस बफर के ५० µ l में elute ।
    2. IP सफल है, तो जाँच करने के लिए, कोई qPCR करें । आदर्श रूप में, प्राइमरों सकारात्मक और नकारात्मक नियंत्रण क्षेत्रों के लिए डिजाइन किया जाना चाहिए ।
      नोट: उदाहरण के लिए, एक आईपी H3K4me3 और H3K27me3 के साथ प्रदर्शन के लिए, निम्नलिखित नमूने qPCR पर चलाया जाना चाहिए: H3K4me3, H3K27me3, और आईजीजी चिप डीएनए, इनपुट डीएनए, और एक कोई टेम्पलेट नियंत्रण (एनटीसी) क्षेत्रों के लिए प्राइमरों का उपयोग करने के लिए H3K4me3 से समृद्ध हो (सकारात्मक नियंत्रण) और H3K4me3 (नकारात्मक नियंत्रण) से समृद्ध होने वाले क्षेत्र; इसी तरह, H3K27me3 के लिए ।
    3. qPCR12करने के लिए मानक प्रोटोकॉल का पालन करें । संक्षेप में, एक qPCR का उपयोग कर एक SYBR ग्रीन मास्टर मिक्स, ०.५ µ एल के 10 µ मी काम एकाग्रता के प्रत्येक आगे और रिवर्स प्राइमर, और चिप या इनपुट डीएनए के 2 µ एल. एक वास्तविक समय पीसीआर प्रणाली का उपयोग कर प्लेटें पढ़ें । प्राइमरी सीक्वेंस टेबल 2में दिए गए हैं । Gapdh प्राइमरी जुगाड़ से ह्वांग एट अल. 13का इस्तेमाल किया गया ।
    4. इनपुट, यानी, प्रतिशत इनपुट विधि (% IP)14के सापेक्ष चिप डेटा का विश्लेषण करें । निम्न सूत्रों का उपयोग करके प्रतिशत इनपुट परिकलित करें:
      समायोजित इनपुट = मतलब सीटी (इनपुट)-लॉग2(DF)
      जहां DF शुरुआती इनपुट का कमजोर कारक है और
      DF = इनपुट की कुल मात्रा IP/
      % ip = 100 × 2 ^ (समायोजित इनपुट-सीटी (आईपी))
      जहां सीटी दहलीज फैक्टर है ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

मस्तिष्क ट्यूमर कोशिकाओं Katushka सकारात्मक कर रहे हैं, जहां एक मस्तिष्क ट्यूमर से उत्पन्न ट्यूमर एनएस का एक योजनाबद्ध प्रतिनिधित्व चित्रा 1में प्रस्तुत किया जाता है. चित्रा 2 पूरे चिप तकनीक का एक योजनाबद्ध प्रतिनिधित्व है । चित्रा 3 से क्रोमेटिन के प्रतिनिधि परिणाम से पता चलता है ब्रेन ट्यूमर एन एस 12 मिनट के लिए MNase के साथ पचा, मोनो, di, और त्रिकोणीय nucleosomes के बहुमत की उपज. चिप के बाद, एक qPCR चिप और इनपुट डीएनए नमूने पर किया जा सकता है । चित्रा 4 glyceraldehyde-3-फॉस्फेट डिहाइड्रोजनेज (Gapdh) के लिए एक qPCR से प्रतिनिधि चिप qPCR डेटा से पता चलता है. Gapdh एक गृह व्यवस्था जीन है कि H3K4me3, एक संशोधन है कि सक्रिय प्रतिलेखन के साथ जुड़ा हुआ है से समृद्ध है । परिणाम बताते है कि Gapdh H3k4me3 से समृद्ध है और H3K27me3 जो दमित क्रोमेटिन के क्षेत्रों के साथ जुड़े एक संशोधन है के साथ समृद्ध नहीं हैं ।

Figure 1
चित्रा 1: एक Katushka सकारात्मक ब्रेन ट्यूमर से उत्पन्न ट्यूमर एनएस के योजनाबद्ध । एक चमकदार क्षेत्र और एक मस्तिष्क के फ्लोरोसेंट छवि एक चूहा है कि अंत बिंदु मंच तक पहुंच से काटा । ट्यूमर क्षेत्र बिंदीदार रेखा से delineated है और फ्लोरोसेंट रिपोर्टर, Katushka के लिए सकारात्मक है । ट्यूमर तो अलग है और ट्यूमर ऊतक एक १.५ मिलीलीटर ट्यूब में एकत्र की है । इसके बाद कोशिकाएं एनएससी मीडियम और ट्यूमर एनएस फार्म में असंबद्ध और कल्चर्ड होती हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: देशी चिप के लिए कार्यप्रवाह का एक योजनाबद्ध प्रतिनिधित्व. ट्यूमर एनएस और संस्कृति का विस्तार कर रहे हैं । प्रत्येक आईपी 1 एक्स 106 कोशिकाओं के साथ किया जाता है । क्रोमेटिन MNase पाचन द्वारा मोनो प्राप्त करने के लिए का उपयोग कर खंडित है, di-, और त्रिकोणीय nucleosomes. क्रोमेटिन एक citrullinated संशोधन या डीएनए के लिए विशिष्ट एंटीबॉडी के साथ मशीन है ब्याज की प्रोटीन जुड़े । एंटीबॉडी-डीएनए जटिल चुंबकीय प्रोटीन के साथ immunoprecipitated है/ अंत में, प्रोटीन पचता है और डीएनए केवल citrullinated संशोधन या डीएनए से समृद्ध डीएनए प्राप्त करने के लिए शुद्ध है ब्याज की प्रोटीन जुड़े । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्र 3: क्रोमेटिन विखंडन द्वारा MNase. क्रोमेटिन मस्तिष्क ट्यूमर एनएस से ठीक 12 मिनट के लिए ३७ डिग्री सेल्सियस पर इसके अलावा MNase और मशीन द्वारा तैयार किया गया था । एक इनपुट नमूने के अधिक विश्लेषक विश्लेषण से प्रतिनिधि डीएनए परिणाम प्रदर्शित करता है कि डीएनए के बहुमत मोनो में खंडित किया गया है, di-, और त्रि- nucleosomes । लेन 1 आधार जोड़े (बीपी) में सीढ़ी है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्र 4: प्रतिशत इनपुट के रूप में प्रस्तुत किया गया प्रतिनिधि चिप qPCR डेटा. qPCR आईजीजी, H3K4me3, और H3K27me3 चिप डीएनए glyceraldehyde-3-फॉस्फेट डिहाइड्रोजनेज (Gapdh) के लिए प्राइमरों का उपयोग कर के साथ प्रदर्शन किया गया था । प्रतिनिधि परिणाम प्रदर्शित करता है कि Gapdh, एक गृह व्यवस्था जीन, केवल H3K4me3 संशोधन से समृद्ध है, सक्रिय प्रतिलेखन के साथ जुड़े, और नहीं H3K27me3 संशोधन, दमित क्रोमेटिन के साथ जुड़े । यह ग्राफ दो जैविक तीन कुओं प्रत्येक दोहराने के साथ चलाने के प्रयोगों के परिणाम का प्रतिनिधित्व करता है । त्रुटि पट्टियां माध्य (SEM) के मानक त्रुटि दर्शाती हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

जीन फॉरवर्ड प्राइमर रिवर्स प्राइमर
gapdh TCCCCTCCCCCTATCAGTTC GACCCGCCTCATTTTTGAAA

तालिका 1: प्राइमरों चिप qPCR प्रयोगों के लिए इस्तेमाल किया। Gapdh के लिए इस्तेमाल किया प्राइमरों के लिए अनुक्रम इस तालिका में प्रदान की जाती हैं ।

मतलब सीटी (इनपुट) मानक विचलन समायोजित इनपुट
२४.२६५ ०.०७१ २०.९४३
प्रतिशत इनपुट
नमूना कच्चे मीन सीटी मानक विचलन प्रतिशत इनपुट = 100 * 2 ^ (समायोजित इनपुट-सीटी (आईपी))
आईजीजी ३२.२३ ०.११२ ०.०४
H3K4me3 २२.१४८ ०.१२८ ४३.३७
H3k27me3 ३२.७९ ०.५१९ ०.०२७
एनटीसी अनिर्धारित अनिर्धारित अनिर्धारित

तालिका 2: चिप qPCR विश्लेषण के लिए प्रतिशत इनपुट पद्धति का नमूना परिकलन। 10% शुरू इनपुट के साथ प्रदर्शन चिप के लिए प्रतिशत इनपुट का नमूना गणना; DF = 10 । इस तालिका में संख्या के साथ एक जैविक प्रयोग के कच्चे मूल्यों उदाहरण देकर स्पष्ट करना 3 दोहराने कुओं प्रत्येक नमूने के लिए भागो ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

यहां प्रस्तुत प्रोटोकॉल उपयोगकर्ता आनुवंशिक रूप से इंजीनियर ब्रेन ट्यूमर से व्युत्पन्न एनएस पर देशी चिप प्रदर्शन करने के लिए सक्षम हो जाएगा । पार से जोड़ने के लिए चिप के विपरीत, इस प्रोटोकॉल प्रोटीन है कि डीएनए के साथ कसकर सहयोगी6के अध्ययन के लिए सीमित है । उपयोग किए गए कक्षों की संख्या आवश्यकतानुसार संशोधित की जा सकती है और प्रोटोकॉल को स्केल किया जा सकता है । हम आईपी प्रति 1 x 106 कोशिकाओं का इस्तेमाल किया, तथापि, देशी चिप भी के रूप में छोटे रूप में 4 x 104 कोशिकाओं5के साथ किया जा सकता है । इस प्रोटोकॉल में, हम qPCR के माध्यम से चिप डीएनए का विश्लेषण; हालांकि, इस प्रोटोकॉल भी एक जीनोम व्यापक स्तर पर प्रोटीन डीएनए बातचीत का अध्ययन करने के लिए अगली पीढ़ी sequencing के साथ संयुक्त किया जा सकता है । हम ट्यूमर कोशिकाओं के जीनोम के विशिष्ट क्षेत्रों के भीतर citrullinated संशोधनों के जमाव पर तंत्रिकाबंधार्बुद oncogenes के प्रभाव का विश्लेषण करने के लिए सफलतापूर्वक इस चिप प्रोटोकॉल का इस्तेमाल किया है ।

वहां कुछ महत्वपूर्ण कदम जब देशी चिप प्रदर्शन कर रहे हैं । सबसे पहले, प्रत्येक कक्ष प्रकार के लिए पाचन शर्तों empirically निर्धारित किया जाना चाहिए । क्रोमेटिन के बहुमत मोनो nucleosomes (१५० बीपी) कुछ di-और त्रिकोणीय nucleosome चोटियों (चित्रा 3) के साथ होना चाहिए । अधिक से अधिक ७०% मोनो में हमारे प्रोटोकॉल परिणाम-, di-, या त्रि-nucleosome चोटियों, हालांकि, कुछ अपच डीएनए रहता है. यदि प्रोटोकॉल चिप-seq के लिए इस्तेमाल किया जाएगा, अतिरिक्त कदम के लिए आवश्यक हो जाएगा अपच डीएनए को दूर करने के लिए । इसके अलावा, यह ध्यान में रखना महत्वपूर्ण है कि MNase खरीदा के प्रत्येक बैच गतिविधि में अलग हो सकता है और इस प्रकार पाचन शर्तों के अनुकूलन की आवश्यकता है । दूसरा, एक चिप की गुणवत्ता एंटीबॉडी की विशिष्टता पर अत्यधिक निर्भर करता है11इस्तेमाल किया । एक उच्च गुणवत्ता चिप एंटीबॉडी इरादा लक्ष्य और अंय डीएनए से जुड़े प्रोटीन या लक्ष्य citrullinated संशोधनों के बंद के साथ कम क्रॉस जेट के खिलाफ उच्च जेट होना चाहिए11। इस कारण से, हम एक पेप्टाइड बाइंडिंग परीक्षण का उपयोग कर एंटीबॉडी विशिष्टता परीक्षण की सलाह देते हैं । सांकेतिक शब्दों में बदलना सुझाव है कि एक दस गुना संवर्धन अन्य संशोधनों के सापेक्ष ब्याज के संशोधन के लिए देखा जाना चाहिए11. यह आवश्यक नियंत्रण immunoprecipations, यानी, पूर्व प्रतिरक्षा या आईजीजी नियंत्रण करने के लिए भी महत्वपूर्ण है । जब इन बातों को पूरा कर रहे हैं, देशी चिप डेटा एक मजबूत विश्वसनीय तरीका epigenetic प्रोटीन डीएनए बातचीत द्वारा विनियमित तंत्र का अध्ययन है ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgements

यह काम स्वास्थ्य के राष्ट्रीय संस्थानों द्वारा समर्थित किया गया था/राष्ट्रीय मस्तिष्क संबंधी विकार और स्ट्रोक के संस्थान (NIH/NINDS) पलाश R37-NS094804, R01-NS074387, R21-NS091555 को M.G.C.; NIH/NINDS पलाश R01-NS076991, R01-NS082311, और R01-NS096756 को P.R.L.; NIH/NINDS R01-EB022563; न्यूरोसर्जरी विभाग; लिआ है मुबारक दिल, और चाड हालांकि फाउंडेशन M.G.C. और P.R.L. आरएनए के लिए F046166 M.G.C. F.M.M. को एक F31 NIH/NINDS-F31NS103500 द्वारा समर्थित है । R.I.Z.-व्ही. NIH/NIGMS ग्रांट 5T34GM007821-37 द्वारा समर्थित है ।

Materials

Name Company Catalog Number Comments
Agilent 2100 Bioanalyzer Agilent G2946-90004 bioanalyzer
AccuSpin Micro 17R, refrigerated Fisher Scientific 13-100-676
C57BL/6 Taconic B6-f C57BL/6 mouse
Calcium Chloride Aldrich 22350-6 buffer reagent
D-Luciferin, Potassium Salt Goldbio LuckK-1g
DiaMag1.5 magnetic rack Diagenode B04000003 for magnetic bead washes
DiaMag Rotator EU Diagenode B05000001 rotator
DMEM/F-12 Gibco 11330-057 NSC component
Dynabeads Protein A Thermo Fisher Scientific 10001D protein A magnetic beads
Dynabeads Protein G Thermo Fisher Scientific 10003D protein G magnetic beads
EGF PeproTech AF-100-15 prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Ethylenediaminetetraacetic acid (EDTA) Sigma E-4884 buffer reagent
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) (EGTA) Sigma E-4378 buffer reagent
Fast SYBR Green Master Mix Applied Biosystems 4385612 qPCR reagent
Fetal Bovine Serum Gibco 10437028 for freezing cells
FGF PeproTech 100-18b Prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Forceps Fine Science Tools 11008-13 for dissection of tumor
Glycerol, MB Grade EMD- Millipore 356352
H3K4me3 Abcam Ab8580
H3K27me3 Millipore 07-449
HBSS Gibco 14175-103 balanced salt solution
Fluriso VETone 501017 inhalation anesthetic
Ivis Spectrum Perkin-Elmer 124262 in vivo optical imaging system
Hyqtase HyClon SV3003001 cell detachment media
Lithium Chloride Sigma L8895 buffer reagent
Low binding microtubes Corning Costar CLS3207 low protein binding microcentrifuge tube
Microcentrifuge tube Fisher 21-402-903 regular microcentrifuge tube
Micrococcal Nuclease Thermo Fisher Scientific, Affymetrix 70196Y each batch may differ; purchase sufficient amount for experiments and aliquot.
N2 Gibco 17502-048 NSC component
Normal Rabbit IgG Millipore 12-372
Normocin Invivogen NOL-36-063 anti-microbial agent, use at 0.1 mg/mL.
NP-40 (Igepal CA-630) Sigma 18896-50ML buffer reagent
Kimble Kontes Pellet Pestle Fisher Scientific K749515-0000
Protease Inhibitor Cocktail Sigma-Aldrich P8340 aliquot and store at -20 °C.
Protinase K Sigma-Aldrich P2308 make 10 mg/mL stock in water; aliquot and store at -20 °C.
QIAquick PCR Purification Kit Qiagen 28104 DNA purification kit
Scalpel Fine Science Tools 10007-16 for dissection of tumor
Sodium Chloride VWR 0241-5KG buffer reagent
Sodium Deoxycholate Sigma-Aldrich D670-25G buffer reagent
Sodium Dodecyl sulfate (SDS) Sigma L-4390 buffer reagent
Tris Base Thermo Fisher Scientific Bp152-1 buffer reagent
Triton X-100 Thermo Fisher Scientific BP 151-500 polyethylene glycol octylphenyl ether
Standard Mini Centrifuge Fisherbrand 12-006-901 standard mini centrifuge
SZX16 microscope Olympus SZX16 flourescent dissecting microscope
ViiA 7 Real-Time PCR System with Fast 96-Well Block Applied Biosystems 4453535
Nanodrop One Thermo-Fisher Scientific ND-ONEC-W

DOWNLOAD MATERIALS LIST

References

  1. Schwartzentruber, J., et al. Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature. 482, (7384), 226-231 (2012).
  2. Bjerke, L., et al. Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN. Cancer Discov. 3, (5), 512-519 (2013).
  3. Bender, S., et al. Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell. 24, (5), 660-672 (2013).
  4. Maleszewska, M., Kaminska, B. Is glioblastoma an epigenetic malignancy? Cancers (Basel). 5, (3), 1120-1139 (2013).
  5. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  6. Thorne, A. W., Myers, F. A., Hebbes, T. R. Native chromatin immunoprecipitation. Methods Mol Biol. 287, 21-44 (2004).
  7. Turner, B. Mapping Protein/DNA Interactions by Cross-Linking. (2001).
  8. Tseng, Z., Wu, T., Liu, Y., Zhong, M., Xiao, A. Using native chromatin immunoprecipitation to interrogate histone variant protein deposition in embryonic stem cells. Methods Mol Biol. 1176, 11-22 (2014).
  9. Calinescu, A. A., et al. Transposon mediumted integration of plasmid DNA into the subventricular zone of neonatal mice to generate novel models of glioblastoma. J Vis Exp. (96), (2015).
  10. Sambrook, J., Russell, D. W. Estimation of cell number by hemocytometry counting. CSH Protoc. 2006, (1), (2006).
  11. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  12. Kubista, M., et al. The real-time polymerase chain reaction. Mol Aspects Med. 27, (2-3), 95-125 (2006).
  13. Hwang, W. W., et al. Distinct and separable roles for EZH2 in neurogenic astroglia. Elife. 3, e02439 (2014).
  14. Haring, M., et al. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods. 3, 11 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics