Fare Beyin tümör Neurospheres kullanarak yerel Kromatin Immunoprecipitation

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Epigenetik mekanizmalar sık tümörü değişmiş. Kromatin immunoprecipitation Kromatin yapısı ve gen transkripsiyonu düzenleyen Histon modifikasyonlar değişimler sonucu genetik değişiklikler gliyom içinde sonuçlarını incelemek için kullanılabilir. Bu iletişim kuralı yerel Kromatin immunoprecipitation fare Beyin tümör neurospheres üzerinde açıklar.

Cite this Article

Copy Citation | Download Citations

Mendez, F. M., Núñez, F. J., Zorrilla-Veloz, R. I., Lowenstein, P. R., Castro, M. G. Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres. J. Vis. Exp. (131), e57016, doi:10.3791/57016 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Epigenetik değişiklikler geliştirme ve tümörü ilerlemesini ve tutulabilir. Metilasyonu ve asetilasyon rehberleri ve oncogenes ve tümör bastırıcılarının düzenleyici bölgelerinde değişiklikler gen ekspresyonu değişikliklere yol ve Beyin Tümörleri patogenezinde önemli bir rol oynamaktadır. Yerel Kromatin immunoprecipitation (ChIP) değişiklikler veya diğer proteinler DNA için sıkı bir şekilde bağlı algılanmasını sağlar popüler bir tekniktir. Çapraz bağlı yongasında yerli çip, aksine hücre kovalent protein DNA'yı bağlamak için formaldehit ile kabul edilmediği. Bu avantajlı çünkü bazen çapraz sadece geçici DNA ile etkileşim ve işlevsel öneme gen yönetmelikte var mı proteinler giderebilir. Buna ek olarak, antikorlar genellikle karşı sabitlenmemiş peptidler yetiştirilir. Bu nedenle, antikor özgüllük yerli yongasında arttı. Ancak, yerel çip sadece Histon veya sıkıca bağlamak için DNA diğer proteinler eğitimi için geçerli olduğunu unutmayın tutmak önemlidir. Bu iletişim kuralı yerel Kromatin immunoprecipitation fare Beyin tümör neurospheres üzerinde açıklar.

Introduction

Epigenetik olaylar gliomas sık sık ve büyük olasılıkla tümör patogenezinde önemli bir rol oynamaktadır. Nitekim, pediatrik yüksek kalitede gliyom içinde Histon değişik H3.3 ve H3.1 kodlama genlerdeki mutasyonlar sık1oluşur. Mutasyonlar Histon değişiklikler etkiler ve büyük epigenetik sonuçların2,3var. İçinde ergen için yetişkin spektrum, ATRX ve sergi gibi diğer Kromatin düzenleyiciler içinde genetik değişiklik ve tekrarlayan isocitrate dehidrogenaz gen 1/2 (IDH1/2), α-KG bağımlı Histon ve DNA de-methylasaes inhibe bir mutasyon mutasyonların meydana 4. bu nedenle, nasıl epigenetik düzenleyicileri etkiler mutasyonlar Kromatin yapısı ve düzenleyici Histon değişiklikler, daha, buna karşılık, tümör hücreleri transcriptome dramatik bir etkiye sahip alter eğitim için kritik öneme sahiptir.

Kromatin immunoprecipitation (ChIP) genom5,6,7epigenetik değişikliklerin etkisini değerlendirmek için kullanılan güçlü bir araçtır. Yerel yongası, Kromatin micrococcal nükleaz (MNase), faiz, protein karşı harekete geçirilen bir antikor kullanarak immunoprecipitated ile sindirmek ve DNA immunoprecipitated Kromatin karmaşık6sonra saf. Bu teknik yalnızca sıkı bir şekilde DNA6ile etkileşim proteinlerin incelenmesi için geçerlidir bu yüzden hücreleri işlem sırasında sabit değildir. Antikorlar genellikle sabitlenmemiş peptidler veya protein7karşı başlatılan bu yana cross-linking yokluğu antikor özgüllük yardımcı olur. Buna ek olarak, cross-linking hiçbir adım olduğundan, bu belirsiz ve değil düzenleyici7,' i8geçici protein-DNA etkileşimleri sabitleme şansını azaltır. Çip Histon değişiklikler belirli bir genomik bölgesinde zenginleştirme tanımlamak için kullanılabilir. Burada, genetik olarak üretilen neurospheres (NS) yerel ChIP performans mühendislik gliyom fare modelleri için bir protokol ayrıntılı.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tüm yöntem tanımlamak burada kurumsal hayvan bakım ve kullanım Komitesi (IACUC) Michigan Üniversitesi tarafından onaylanmıştır.

1. nesil beyin tümörü NS ve koşullar kültür.

  1. Nöral kök hücre orta (NSC) Dulbecco'nın modifiye kartal orta/F12B27 ek (1 x), N2 ek (1 x) ve antimikrobiyal bir reaktif ile hazırlayın. NSC orta insan rekombinant endotelyal büyüme faktörü (EGF) ve temel fibroblast büyüme faktörü (FGF) 20 ng/mL her son bir konsantrasyon, günü ek.
  2. Beyin tümörü spontan Beyin Tümörleri9oluşturmak için Yenidoğan Bebeklerin lateral ventrikül hangi oncogenes veya tümör bastırıcılarının hedefleme shRNA kodlama plazmid enjekte edilir uyuyan güzel transposon sistemini kullanarak fare neden. Bir fare ile bioluminescence görüntülemede doğruladı büyük bir tümör ile seçin.
    Not: Kullanılan uyku güzellik Transposon sistemi ve plazmid yapıları hakkında daha ayrıntılı bilgi-ebilmek bulunmak içinde Calinescu vd. 9.
    1. Fareler görüntüye intraperitoneally 26 gauge iğne kullanarak 30 mg/mL biyoluminesans solüsyonu 100 µL enjekte.
    2. 5 dk sonra biyoluminesans, enjeksiyon anestezi için % 2 isoflurane ayarla oksijen/isoflurane akışı ile bir anestezi odası kullanarak hayvan.
    3. Ne zaman hayvanlar anestezi (genellikle 2-3 dk), hayvanlar için % 2 isoflurane ayarla oksijen isoflurane bioluminescence odasında yerleştirin. Hayvanlar 5 dk daha uzun süre anestezi altında olması durumunda, bir oftalmik merhem anestezi altında iken kuruluk engellemek için kullanın.
    4. Fareyi kullanarak bir vivo içinde görüntüleme sistemi aşağıdaki parametreler ile optik görüntü: otomatik pozlama, büyük binning ve diyafram f = 1. Büyük bir tümör düşünmek için bir bioluminescence parametresidir > 106 fotonlar/s/cm2/sr.
  3. Ötenazi isoflurane anestezik inhalasyon kapalı odasında aşırı dozda fareyle kontrol tarafından ayak çimdik hayvan anestezi ve fare başını kesmek.
  4. Beyin ayıklamak ve Calinescu vd. daha önce açıklandığı gibi incelemek 9.
  5. Beyin bir 10 cm Petri kabına yerleştirin. İndüklenen tümör floresan bir protein ifade eder, uygun floresan kanal ve 0.3 X büyütme, bir floresan mikroskop dissekan kümesini kullanın aksi takdirde tanımlamak tümör kitle doku renk ve doku farklılıkları tarafından. Neşter ve forseps normal beyin tümörü dokusundan ayırmak için kullanın.
  6. Tümör küçük parçalara Petri kabına kıyma. NSC orta 300 µL ile 1,5 mL tüp disseke tümör yerleştirin.
  7. Konik microcentrifuge tüp duvarlar hafifçe tümör homojenize uygun bir tek kullanımlık plastik Pelet havaneli kullanın. Hücre dekolmanı orta 1 mL ekleyin ve 37 ° C'de 5 min için örnek kuluçkaya
    Not: Bazı hücreler bir havaneli ile kullanımı öldürebilir. Okuyucu hücre canlılığı en üst düzeye çıkarmak istiyorsa, bir havaneli ile kullanımı atlanabilir.
  8. Adım 1.7 70 µm hücre süzgeç aracılığıyla hücre süspansiyon geçmek ve süzgeç NSC Orta 25 mL ile yıkayın.
  9. 300 x g oda sıcaklığında 5 min için de süspansiyon santrifüj kapasitesi, süpernatant dikkatle boşaltmak ve Pelet NSC orta 6 mL yeniden askıya alma.
  10. Tümör hücre süspansiyon adım 1.9 T-25 kültür şişesi içine plaka ve doku kültürü kuluçka % 95 hava ve % 5 CO2atmosferiyle 37 ° C'de kültür. Genellikle 3 gün sonra bazı ölü hücreleri, yapıştırılan hücrelere ve ortamda float NS oluşturan bazı hücreler bir karışımı olacak.
  11. Hücre süspansiyon 15 mL konik tüp içine aktarmak, yalnızca bir micropipette kullanarak alt lavabo hücreleri toplamak ve onları yeniden bir T-75 doku kültürü şişesi plakası.
  12. Nispeten yüksek yoğunluklu (1-3 X 106 hücrelerde bir T-25), hücreleri korumak. Konfluent olduklarında hücreleri geçiş.
    Not: Confluency küreler boyutu tarafından belirlenir. Siyah büyük küre ortalaması ki merkezi ölü hücreleri ve hücre hemen passaged belirtmek merkezleri.
  13. Büyüme faktörleri ekleyin (EGF ve basic-FGF; 20 ng/mL her) üç günde. Hücreleri birleşmesi ve Orta döner ışık turuncu değilse orta değiştirin.
  14. Orta değiştirmek için eski orta toplamak ve 300 x g 5 min için oda sıcaklığında, santrifüj kapasitesi ve hücre Pelet 1.1 adımda belirtilen konsantrasyon, EGF ve FGF ile desteklenmiş NSC ortamda yeniden askıya alma.
    Not: küreler, eğer orta-yüksek confluency, ama hazır değilim pasajlı (küre boyutu olan bir çapı < 100 µm ile küçük), o zaman Pelet iki şişe bölebilirsiniz.
  15. Hücreleri geçiş için 300 x g oda sıcaklığında 5 min için de hücreleri santrifüj kapasitesi, süpernatant dikkatle boşaltmak ve hücre dekolmanı orta 37 ° C'de 5 min için hücrelerde kuluçkaya
    1. Dengeli tuz solüsyonu 5 mL seyreltik dekolmanı Orta olarak ekleyin ve 300 x g oda sıcaklığında 5 min için de santrifüj kapasitesi.
    2. Süpernatant dikkatle boşaltmak, hücre Pelet 18 mL NSC orta resuspend ve süspansiyon eşit üç T-25 şişeler bölmek.
  16. Hücre aliquots dondurmak için hücreleri olduğu gibi adım 1,15 ayırmak ve 1 mL aliquots % 90 ile % 10 Dimetil sülfoksit bir fetal sığır serum hücrelerde Don. Yavaş yavaş buz 10 min için hücreleri yerleştirerek, daha sonra hücreleri-20 ° C-30 dk, tutmak hücreleri serin ve-80 ° C için 1 gün. Ertesi gün, hücreleri bir sıvı azot depolama kabına aktarın.

2. yerel çip

  1. Kromatin hazırlık
    1. NS Konfluent olana türetilmiş NS stokunun yaptıktan sonra bir T-75 NSC orta bir doku kültürü kuluçka 37 ° C'de 15 ml % 95'i hava ve % 5 CO2 bir atmosfer ile NS kültür. Bir Konfluent T-75 plaka 3-5 X 106 hücre ortaya çıkarır.
    2. Hücreleri Konfluent olduğunda, 300 x g 5 min için de NS santrifüj kapasitesi, süpernatant dikkatle boşaltmak ve hücre ayrılma orta 1 mL ekleyin. 5 dk. eklemek 5 mL orta için 37 ° C'de hücreler kuluçkaya ve hemasitometre10kullanarak hücreleri saymak.
      Not: 1 x 106 hücre immunoprecipitation (IP) tepki ihtiyaç vardır. Önceden bağışık serum veya IgG denetimi de dahil11olması gerektiğini unutmayın.
    3. Bir 1.5 mL microcentrifuge tüpü 300 x g 5 min için de NS santrifüj kapasitesi, süpernatant dikkatle boşaltmak ve NS Pelet 1 mL dengeli tuz solüsyonu ile yeniden askıya alma ve süspansiyon düşük protein bağlayıcı 1.5 mL microcentrifuge tüpler için transfer.
    4. 300 x g santrifüj NS 5 min için süpernatant dikkatle boşaltmak ve sindirim arabelleği (50 mM Tris-HCl, pH 8.0, 1 mM CaCl2, % 0,2 polietilen glikol octylphenyl eter) 95 µL hücre Pelet proteaz ile desteklenmiş 1 x 106 hücre başına yeniden askıya alma önleyici bir yüksek konsantrasyon (1: 100) kokteyl. Hemen damlalıklı hücreleri yukarı ve aşağı topaklanma önlemek ve herhangi bir kabarcıklar oluşturmaktan kaçının.
    5. MNase "1 x" stok olarak sevk edilecek 1 mg/mL solüsyon (1.15 birimleri /-20 ° C'de depolanan µL,) yapmak için % 50 gliserol resuspend. Yapmak bir "0.1 x" hisse senedi % 50 gliserol ile ikinci bir 1:9 seyreltme yaparak (e.g., 900 µL "1 x" MNase ve % 50 gliserol 100 µL) ve -20 ° C'de saklayın
    6. Mix 5 µL olan "0.1 x" MNase ve sindirim arabelleği 145 µL. Enzim buz üzerinde her zaman tutun. 1 x 106 hücre başına sindirim arabellek içinde seyreltilmiş MNase 5 µL ekleyin. Mix ve 37 ° C Blok tam olarak 12 dk. işlemi için tüp yerleştirmek için tüp 12 dk bir doğru kuluçka süresi sağlamak için teker teker örnekleri bir fiske.
    7. 10 10 µL eklemek MNase durdurmak arabellek (110 mM Tris-HCl, pH 8.0, 55 mM EDTA) 1 x 106 hücre başına x. Örnekleri buz bu noktadan itibaren saklanmalıdır.
    8. 110 µL "2 x RIPA tampon" Ekle (280 mM NaCl, % 1,8 polietilen glikol octylphenyl eter, % 0,2 Sodyum Lauryl Sülfat (SDS), %0.2 Na-deoxycholate, 5 mM etilen glikol-bis(β-aminoethyl ether)-N, N, N', N'-tetraacetic asit (EGTA); 4 ° C'de depolanan) ile takıma proteaz inhibitörü yüksek konsantrasyon (1: 100) 1 x 106 hücre başına kokteyl. Karıştırmak için tüp fiske.
    9. Bir microfuge 4 ° C'de 15 dakika tüpler santrifüj kapasitesi ve 1700 x g. süpernatant (düşük protein bağlayıcı microcentrifuge tüpler artık gerekli olmayan) bir yeni düzenli 1.5 mL microcentrifuge tüpler için Transfer ve buz üzerinde saklayabilirsiniz. Pelet atmak.
  2. Immunoprecipitation (IP)
    1. Mix protein A ve 1:1 oranında Protein G manyetik boncuklar. Her IP için boncuk 25 µL hazırlayın.
    2. 1 mL RIPA arabelleği ekleyerek boncuk yıkayın (10 mM Tris pH 8.0, 1 mM EDTA, 140 mM NaCl, % 1 polietilen glikol octylphenyl eter, % 0,1 SDS, % 0,1 Na-deoxycholate; 4 ° C'de depolanan) düşük konsantrasyon (1: 1000), proteaz inhibitörleri ile desteklenmiştir.
    3. Bir mıknatıs boncuk çamaşır eriyik--dan ayırmak ve yıkama çözüm (yaklaşık 1 dakika) dikkatle boşaltmak izin vermek için kullanın. İki kez yıkama adımı gerçekleştirin.
    4. Boncuk proteaz inhibitörleri (1: 1000) ile desteklenmiş RIPA arabellek kullanarak özgün birimi için yeniden askıya alma.
    5. Gerekirse, seyreltik her IP 100-200 hacmi böylece proteaz inhibitörleri (1: 1000) ile desteklenmiş RIPA tampon kullanarak Kromatin µL. rezerv Kromatin IP giriş için kullanılan hacminin % 10.
      Not: IP 200 µL kullandıysanız, örneğin, seyreltilmiş Kromatin 20 µL giriş için rezerve edilmesinin gerekip. Dört IP'leri toplam için toplam Kromatin birim için 820 µL seyreltilmiş.
    6. Giriş hazırlayın. İndinavir K (0,5 mg/mL) giri ile takıma 100 µL TE arabelleği (10 mM Tris-HCl pH 8.0, 1 mM EDTA) ekleyin ve giriş için 1 h 55 ° C'de kuluçkaya.
      Not: Adımları 2.2.6-2.2.7 2.3.4 ve 2.4.1 adımları ile birlikte gerçekleştirilir.
    7. Üreticinin yönergelerini izleyerek bir PCR arıtma kit kullanarak giriş arındırmak ve 50 µL Seti'nde sağlanan elüsyon arabelleği elute.
    8. Microvolume Spektrofotometre kullanarak giriş konsantrasyonu ölçmek ve sonuçları bir defterde kaydedebilirsiniz. Elüsyon arabelleği kiti ile boş.
      Not: fare neurospheres, biz yaklaşık 6 µg DNA'ın her IP için kullanılır.
    9. Üzerinde % 1 jel giriş veya standart ayarları kullanarak bir DNA Bioanalyzer üzerinde 1 µL yüklenmesine. Kalan kullanım için aşağı akım uygulamalarda girişi olarak saklamak.
    10. 10 µL yıkanmış protein A & G manyetik boncuklar eklemek için her IP ve IP 4 ° C'de 1 h için kuluçkaya
      Not: Örneğin, üç IP için 30 µL protein A & G manyetik boncuklar ekleyin.
    11. Örnekleri üzerinde bir mıknatıs yerleştirmek ve boncuk ayırmak izin verir. Kromatin yeni 1,5 mL tüp içine önceden belirlenmiş miktar aktararak bölün.
    12. Antikor ekleyin ve kapaklar buharlaşma önlemek için plastik parafin film ile sarın. Gecede 4 ° C'de örnekleri 20 RPM döndürme kuluçkaya.
      Not: Konsantrasyon ampirik olarak aşağıdaki üretici önerileri tespit edilmelidir.
    13. Ertesi gün, bir mini santrifüj oda sıcaklığında, 2000 x g, 10 için kullanarak tüpler spin s. Daha sonra 10 µL boncuk her IP ekleyin ve 3 h 4 ° C'de 20 RPM döndürme için IP kuluçkaya.
  3. IP yıkama ve Protein sindirimi
    1. Düşük konsantrasyon (1: 1000) her IP, proteaz inhibitörleri ile takıma RIPA arabelleği 150 µL ekleyin ve IP 5 dk. yer 20 RPM döndürme 4 ° C'de örnek manyetik bir stand üzerinde kuluçkaya ve ayırmak manyetik boncuklar. Bir damlalıklı süpernatant kaldırmak için kullanın. Bu tep beş yıkar yineleyin.
    2. LiCl arabelleği 150 µL eklemek (250 mM LiCl, 10 mM Tris pH 8.0, 1 mM EDTA, % 0.5 NP-40, % 0.5'na-deoxycholate; mağaza 4 ° C'de) düşük konsantrasyon (1: 1000) her IP, proteaz inhibitörleri ile desteklenmiş ve IP 5 dk. yer örnek 20 RPM döndürme 4 ° C'de kuluçkaya bir manyetik üzerinde durmak ve ayırmak manyetik boncuklar sağlar. Bir damlalıklı süpernatant kaldırmak için kullanın.
    3. Soğuk TE (proteaz inhibitörleri) 150 µL ekleyin ve 5 dk. yer 20 RPM döndürme ile 4 ° C'de örnek örnek manyetik bir stand üzerinde kuluçkaya ve ayırmak manyetik boncuklar. Bir damlalıklı süpernatant kaldırmak için kullanın.
    4. Son yıkama adım sonra örnek 100 µL İndinavir K (0,5 mg/mL) ile desteklenmiş TE arabelleği yeniden askıya ve örnek için 1 h 55 ° C'de kuluçkaya.
  4. DNA arıtma ve çip nicel gerçek zamanlı PCR (qPCR)
    1. İmmunoprecipitated DNA PCR arıtma seti kullanarak arındırmak. Her örnek Takımı'ndan DNA bağlayıcı arabelleğe eklenmesi sonra tüp üzerinde bir mıknatıs yerleştirmek ve sonra manyetik boncuklar toplama, transfer kadar süpernatant Temizleme sütun için bekleyin. Üreticinin yönergeleri izleyin ve 50 µL Seti'nde sağlanan elüsyon arabelleği elute.
    2. IP başarılı olup olmadığını denetlemek için bir qPCR gerçekleştirin. İdeal olarak, astar pozitif ve negatif kontrol bölgeler için tasarlanmış olması.
      Not: bir IP H3K4me3 ve H3K27me3 ile gerçekleştirilen için örneğin, aşağıdaki örnekleri qPCR üzerinde çalıştırılması gerekir: H3K4me3, H3K27me3 ve çip DNA, IgG giriş DNA ve H3K4me3 ile zenginleştirilmiş için bölgelerin primerler kullanılarak bir şablon kontrol (NTC) (pozitif kontrol) ve H3K4me3 ile zenginleştirilmiş için bölge (negatif kontrol); aynı şekilde, H3K27me3 için.
    3. QPCR12gerçekleştirmek için standart iletişim kuralları izleyin. Kısaca, bir qPCR SYBR yeşil ana karışımı, her ileri ve ters astar 10 µM çalışma konsantrasyonu 0.5 µL ve ChIP veya giriş DNA 2 µL kullanarak gerçekleştirin. Bir gerçek zamanlı PCR sistemi kullanarak plakaları okuyun. Astar dizileri Tablo 2' de verilmektedir. Gapdh astar dizileri üzerinden Hwang ve ark. kullanılan13yaşındaydın.
    4. ChIP verileri analiz giriş göre Yani, yüzde giriş yöntemi (% IP)14. Aşağıdaki formülleri kullanarak giriş yüzdesini hesaplamak:
      Giriş düzeltilmiş ortalama ct (giriş) =-2(DF) oturum
      DF seyreltme faktörü başlangıç giriş nerede ve
      DF IP hacmi = / giriş hacmi
      % IP 100 × 2 = ^ (giriş - Ct (IP) ayarlanabilir)
      nerede Ct eşik faktördür.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Tümör Beyin tümör hücreleri Katushka olumlu nerede bir beyin tümöründen üretilen NS şematik gösterimi şekil 1' de sunulmuştur. Şekil 2 tüm ChIP tekniği, şematik bir gösterimidir. Şekil 3 gösterir Kromatin beyin tümörü NS gelen temsilcisi sonuçlarını MNase ile 12 dk mono, di- ve tri-oluşturarlar çoğunluğu oluşturan sindirilir. ChIP, ardından bir qPCR yonga üzerinde gerçekleştirilebilir ve DNA girişi örnekleri. Şekil 4 gliseraldehit-3-fosfat dehidrogenaz (Gapdh) için bir qPCR temsilcisi ChIP qPCR verileri gösterir. Gapdh H3K4me3, etkin transkripsiyon ile ilişkili bir değişiklik ile zenginleştirilmiş bir temizlik gen olduğunu. Sonuçlar Gapdh H3k4me3 ile zenginleştirilmiş ve bastırılmış Kromatin bölgeleri ile ilişkili bir değişiklik olan H3K27me3 ile zenginleştirilmiş değil gösterir.

Figure 1
Şekil 1: tümör Katushka olumlu beyin tümöründen üretilen NS şematik. Bir parlak alan ve bitiş noktası aşamaya bir fareden hasat beyin floresan görüntü. Tümör alanı noktalı çizgi tarafından belirlenen ve floresan muhabiri, Katushka pozitiftir. O zaman tümördür izole ve tümör doku bir 1,5 mL tüp içinde toplanır. Hücreler sonra ayrışmış ve NSC orta ve tümör NS formunda kültürlü. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2: Yerel çip için iş akışı şematik gösterimi. Tümör NS kültürlü ve genişletilmiş. Her IP 1 X 106 hücreler ile gerçekleştirilir. Kromatin mono, di- ve tri-oluşturarlar elde etmek için MNase sindirim tarafından kullanarak parçalanır. Kromatin Histon değişiklik veya DNA ilişkili protein ilgi için özel bir antikor ile inkübe. Antikor-DNA karmaşık manyetik protein A/G boncuk ile immunoprecipitated olduğunu. Son olarak, protein sindirilir ve DNA Histon ve/veya DNA ilişkili protein ilgi ile zenginleştirilmiş DNA elde etmek için saf. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: Kromatin parçalanma tarafından MNase. Tam olarak 12 dk. temsilcisi DNA sonuçlarını Bioanalyzer analiz giriş örneği DNA çoğunluğu mono-, di-ve tri - parçalanmış göstermek için Kromatin beyin tümörü NS ek MNase tarafından ve kuluçka 37 ° C'de hazırlanmıştır oluşturarlar. 1 yolu için baz çifti (BP) içinde merdiveni var. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4: yüzde giriş olarak sunulan temsilcisi ChIP qPCR verinin. qPCR IgG, H3K4me3 ve H3K27me3 çip DNA gliseraldehit-3-fosfat dehidrogenaz (Gapdh) primerler kullanılarak gerçekleştirildi. Gapdh, Oda temizliği gene, yalnızca etkin transkripsiyon ile ilişkili H3K4me3 değişiklik ve bastırılmış Kromatin ile ilişkili değil H3K27me3 değişiklik ile zenginleştirilmiştir temsilcisi sonuçlar gösterilmektedir. Bu grafik çalıştırmak üç Çoğalt wells ile her iki biyolojik deneylerin sonuçlarını temsil eder. Hata çubukları standart hata ortalamaya (SEM) temsil eder. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Gen İleri astar Ters astar
Gapdh TCCCCTCCCCCTATCAGTTC GACCCGCCTCATTTTTGAAA

Tablo 1: Astar ChIP qPCR deneyler için kullanılan. Gapdh için kullanılan astar için sıralarını bu tabloda sunulmaktadır.

CT (giriş) demek Standart sapma Ayarlanan giriş
24.265 0.071 20.943
Yüzde giriş
Örnek Ham demek Ct Standart sapma Yüzde giriş = 100 * 2 ^ (input-Ct(IP)) ayarlanabilir
IgG 32.23 0.112 0,04
H3K4me3 22.148 0.128 43.37
H3k27me3 32.79 0.519 0,027
NTC belirsiz belirsiz belirsiz

Tablo 2: örnek hesaplama yüzde giriş yöntemi ChIP qPCR analiz için. Örnek hesaplama yüzde %10 ile giriş başlangıç gerçekleştirilen çip için giriş; DF = 10. Bu tablodaki sayılar 3 REPLICATE wells her örneği için çalıştırmak ile bir biyolojik deneme ham değerlerini göstermektedir.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Burada sunulan Protokolü NS genetiği Beyin Tümörleri türetilen yerel çip gerçekleştirileceği kullanıcı sağlayacaktır. ChIP cross-linking aksine, bu iletişim kuralı için sıkı bir şekilde DNA6ile ilişkilendirmek proteinlerin çalışma sınırlıdır. Kullanılan hücre sayısını gerektiği şekilde değiştirilebilir ve protokol ölçeklendirilebilir. Biz IP başına 1 X 106 hücre kullanılan, ancak, yerel ChIP kadar az 4 x 104 hücreleri5ile de gerçekleştirilebilir. Bu protokol için qPCR yolu ile çip DNA analiz; Ancak, bu iletişim kuralını da protein-DNA etkileşimleri genom geniş düzeyde eğitim için sonraki nesil sıralama ile birlikte. Biz bu çip iletişim kuralı başarıyla devrilmesinden sonra tümör hücreleri genom özel bölgeler içinde Histon değişiklikler üzerinde tümörü oncogenes etkisini analiz için kullandık.

Yerel ChIP işlemi sırasında birkaç kritik adım vardır. İlk olarak, sindirim koşulları her hücre türü için ampirik olarak belirlenmelidir. Kromatin çoğunluğu mono-oluşturarlar olmalıdır (150 bp) ile bazı di ve tri nucleosome tepeler (şekil 3). İletişim kuralı sonuçlarımızda % 70 mono-, di-, ya da daha tri-nucleosome tepeler, ancak, bazı sindirilmemiş DNA kalır. Protokol ChIP-seq için kullanılacaksa, sindirilmemiş DNA kaldırmak için ek adımlar gereklidir. Ayrıca, satın MNase her dizi etkinliğinde farklı ve böylece sindirim koşullardan en iyi duruma getirme ihtiyacı göz önünde tutmak önemlidir. İkinci olarak, bir çip kalitesini çok kullanılan antikor11özgüllük bağlıdır. Yüksek kaliteli çip antikor amaçlanan hedefe karşı yüksek reaktivite ve düşük çapraz reaktivite diğer DNA ilişkili proteinler ile veya hedef Histon değişiklikler11kapalı olmalıdır. Bu nedenle, bir peptid bağlama testi kullanılarak antikor özgüllük test etmenizi öneririz. KODLA yönergeleri panolarında bir zenginleştirme ilgi diğer değişiklikler11göre değişiklik dikkat edilmelidir öneririz. Gerekli denetim immunoprecipations, Yani, ön bağışıklık veya IgG denetimi gerçekleştirmek için önemlidir. Bu hususlar gerçekleştiğinde, yerel çip veri epigenetik mekanizmalar protein-DNA etkileşimleri tarafından düzenlenmiş çalışma güçlü güvenilir bir yöntemdir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgements

Bu eser Ulusal kurumları, sağlık/Ulusal Enstitüsü, nörolojik bozukluklar & kontur (NIH/NINDS) hibe R37-NS094804, R01-NS074387, R21-NS091555 için M.G.C. tarafından desteklenen; NIH/NINDS verir R01-NS076991, R01-NS082311 ve R01-NS096756 P.R.L. için; NIH/NINDS R01-EB022563; Nörocerrahi bölümü; Leah'ın Happy Hearts ve Chad rağmen Vakfı'na M.G.C. ve P.R.L. RNA Biyomedikal Grant F046166 M.G.C. F.M.M. için bir F31 NIH/NINDS-F31NS103500 tarafından desteklenmektedir. R.I.Z.-V. NIH tarafından desteklenen / NIGMS vermek 5T34GM007821-37.

Materials

Name Company Catalog Number Comments
Agilent 2100 Bioanalyzer Agilent G2946-90004 bioanalyzer
AccuSpin Micro 17R, refrigerated Fisher Scientific 13-100-676
C57BL/6 Taconic B6-f C57BL/6 mouse
Calcium Chloride Aldrich 22350-6 buffer reagent
D-Luciferin, Potassium Salt Goldbio LuckK-1g
DiaMag1.5 magnetic rack Diagenode B04000003 for magnetic bead washes
DiaMag Rotator EU Diagenode B05000001 rotator
DMEM/F-12 Gibco 11330-057 NSC component
Dynabeads Protein A Thermo Fisher Scientific 10001D protein A magnetic beads
Dynabeads Protein G Thermo Fisher Scientific 10003D protein G magnetic beads
EGF PeproTech AF-100-15 prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Ethylenediaminetetraacetic acid (EDTA) Sigma E-4884 buffer reagent
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) (EGTA) Sigma E-4378 buffer reagent
Fast SYBR Green Master Mix Applied Biosystems 4385612 qPCR reagent
Fetal Bovine Serum Gibco 10437028 for freezing cells
FGF PeproTech 100-18b Prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Forceps Fine Science Tools 11008-13 for dissection of tumor
Glycerol, MB Grade EMD- Millipore 356352
H3K4me3 Abcam Ab8580
H3K27me3 Millipore 07-449
HBSS Gibco 14175-103 balanced salt solution
Fluriso VETone 501017 inhalation anesthetic
Ivis Spectrum Perkin-Elmer 124262 in vivo optical imaging system
Hyqtase HyClon SV3003001 cell detachment media
Lithium Chloride Sigma L8895 buffer reagent
Low binding microtubes Corning Costar CLS3207 low protein binding microcentrifuge tube
Microcentrifuge tube Fisher 21-402-903 regular microcentrifuge tube
Micrococcal Nuclease Thermo Fisher Scientific, Affymetrix 70196Y each batch may differ; purchase sufficient amount for experiments and aliquot.
N2 Gibco 17502-048 NSC component
Normal Rabbit IgG Millipore 12-372
Normocin Invivogen NOL-36-063 anti-microbial agent, use at 0.1 mg/mL.
NP-40 (Igepal CA-630) Sigma 18896-50ML buffer reagent
Kimble Kontes Pellet Pestle Fisher Scientific K749515-0000
Protease Inhibitor Cocktail Sigma-Aldrich P8340 aliquot and store at -20 °C.
Protinase K Sigma-Aldrich P2308 make 10 mg/mL stock in water; aliquot and store at -20 °C.
QIAquick PCR Purification Kit Qiagen 28104 DNA purification kit
Scalpel Fine Science Tools 10007-16 for dissection of tumor
Sodium Chloride VWR 0241-5KG buffer reagent
Sodium Deoxycholate Sigma-Aldrich D670-25G buffer reagent
Sodium Dodecyl sulfate (SDS) Sigma L-4390 buffer reagent
Tris Base Thermo Fisher Scientific Bp152-1 buffer reagent
Triton X-100 Thermo Fisher Scientific BP 151-500 polyethylene glycol octylphenyl ether
Standard Mini Centrifuge Fisherbrand 12-006-901 standard mini centrifuge
SZX16 microscope Olympus SZX16 flourescent dissecting microscope
ViiA 7 Real-Time PCR System with Fast 96-Well Block Applied Biosystems 4453535
Nanodrop One Thermo-Fisher Scientific ND-ONEC-W

DOWNLOAD MATERIALS LIST

References

  1. Schwartzentruber, J., et al. Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature. 482, (7384), 226-231 (2012).
  2. Bjerke, L., et al. Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN. Cancer Discov. 3, (5), 512-519 (2013).
  3. Bender, S., et al. Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell. 24, (5), 660-672 (2013).
  4. Maleszewska, M., Kaminska, B. Is glioblastoma an epigenetic malignancy? Cancers (Basel). 5, (3), 1120-1139 (2013).
  5. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  6. Thorne, A. W., Myers, F. A., Hebbes, T. R. Native chromatin immunoprecipitation. Methods Mol Biol. 287, 21-44 (2004).
  7. Turner, B. Mapping Protein/DNA Interactions by Cross-Linking. (2001).
  8. Tseng, Z., Wu, T., Liu, Y., Zhong, M., Xiao, A. Using native chromatin immunoprecipitation to interrogate histone variant protein deposition in embryonic stem cells. Methods Mol Biol. 1176, 11-22 (2014).
  9. Calinescu, A. A., et al. Transposon mediumted integration of plasmid DNA into the subventricular zone of neonatal mice to generate novel models of glioblastoma. J Vis Exp. (96), (2015).
  10. Sambrook, J., Russell, D. W. Estimation of cell number by hemocytometry counting. CSH Protoc. 2006, (1), (2006).
  11. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  12. Kubista, M., et al. The real-time polymerase chain reaction. Mol Aspects Med. 27, (2-3), 95-125 (2006).
  13. Hwang, W. W., et al. Distinct and separable roles for EZH2 in neurogenic astroglia. Elife. 3, e02439 (2014).
  14. Haring, M., et al. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods. 3, 11 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics