Immunoprécipitation de la chromatine native à l’aide de Neurospheres de tumeur de cerveau murin

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Des mécanismes épigénétiques sont fréquemment altérées dans les gliomes. Immunoprécipitation de la chromatine pourrait servir à étudier les conséquences des altérations génétiques dans les gliomes qui résultent de l’évolution des modifications d’histone qui régulent la transcription de gène et de la structure de la chromatine. Ce protocole décrit l’immunoprécipitation de la chromatine native sur neurospheres de tumeur de cerveau murin.

Cite this Article

Copy Citation | Download Citations

Mendez, F. M., Núñez, F. J., Zorrilla-Veloz, R. I., Lowenstein, P. R., Castro, M. G. Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres. J. Vis. Exp. (131), e57016, doi:10.3791/57016 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Modifications épigénétiques peuvent être impliquées dans le développement et la progression des gliomes. Changements dans la méthylation et l’acétylation des promoteurs et des régions régulatrices des oncogènes et suppresseurs de tumeur peuvent entraîner des changements dans l’expression des gènes et jouent un rôle important dans la pathogenèse des tumeurs cérébrales. Immunoprécipitation de la chromatine native (ChIP) est une technique populaire qui permet la détection de modifications ou d’autres protéines étroitement liées à l’ADN. Contrairement à réticulé ChIP, Chip natif, les cellules ne sont pas traités avec du formaldéhyde pour lien par liaison covalente à l’ADN. C’est avantageux parce que parfois les réticulation peut fixer des protéines qui interagissent avec l’ADN seulement transitoirement et qui n’ont pas de signification fonctionnelle dans la régulation des gènes. En outre, les anticorps sont généralement opposés de peptides non fixées. Par conséquent, spécificité de l’anticorps est augmentée dans puce native. Cependant, il est important de garder à l’esprit que puce native ne s’applique qu’à l’étude des histones ou autres protéines qui se lient étroitement à l’ADN. Ce protocole décrit l’immunoprécipitation de la chromatine native sur neurospheres de tumeur de cerveau murin.

Introduction

Événements épigénétiques sont fréquents dans les gliomes et jouent probablement un rôle important dans la pathogenèse de la tumeur. En effet, en pédiatrie gliome, mutations dans les gènes codant les variants d’histones H3.3 et H3.1 produisent fréquemment1. Les mutations affectent des modifications d’histone et ont des conséquences majeures épigénétique2,3. Chez l’adolescent au spectre adult, mutations récurrentes isocitrate déshydrogénase gène 1/2 (IDH1/2), une mutation qui inhibe les α-KG charge histone et l’ADN de-methylasaes et des altérations génétiques dans les autres organismes de réglementation de la chromatine comme ATRX et DAXX se font 4. par conséquent, il est crucial d’étudier comment les mutations qui affectent les régulateurs épigénétiques alter structure chromatinienne et modifications d’histone réglementaires, qui, à son tour, ont des conséquences dramatiques du transcriptome des cellules tumorales.

Immunoprécipitation de la chromatine (ChIP) est un outil puissant utilisé pour évaluer l’impact des modifications épigénétiques dans le génome5,6,7. À puce native, la chromatine est assimilée avec la nucléase micrococcique (MNase), immunoprécipitée à l’aide d’un anticorps dirigé contre la protéine d’intérêt, et puis ADN est purifié du complexe de la chromatine d’immunoprécipitée6. Les cellules ne sont pas fixes au cours de la procédure afin que cette technique ne s’applique que pour l’étude des protéines qui interagissent étroitement avec ADN6. L’absence de réticulation du sida spécificité anticorps puisque les anticorps sont généralement élevés contre les interprétations de peptides ou protéines7. En outre, puisqu’il n’y a aucune étape de réticulation, cela réduit les chances de la fixation des interactions protéine-ADN transitoires qui sont non spécifiques et non réglementaires7,8. Puce peut être utilisé pour identifier l’enrichissement des modifications d’histone dans une région génomique spécifique. Ici, nous détaillons un protocole pour effectuer puce native dans neurospheres (NS) provenant des organismes génétiquement machiné modèles murins de gliome.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Toutes les méthodes décrites ici ont été approuvés par l’animalier institutionnel et utilisation Comité (IACUC) de l’Université du Michigan.

1. génération de tumeur au cerveau NS et des conditions de culture.

  1. Préparer les moyen de cellules souches neurales (NSC) avec supplément Modified Eagle Medium/F12B27 (1 x), Supplément N2 (1 x) et un réactif antimicrobien de Dulbecco. Supplément moyenne NSC le jour d’utilisation avec le facteur de croissance endothélial recombinante humaine (EGF) et facteur de croissance de fibroblaste-basic (FGF) à une concentration finale de 20 ng/mL de chaque.
  2. Induire la tumeur au cerveau chez les souris en utilisant le système de transposon de belle au bois dormant dans lequel les plasmides codant les oncogènes ou shARN ciblant les suppresseurs de tumeur sont injectés dans les ventricules latéraux des nouveau-nés pour générer des tumeurs de cerveau spontanée9. Sélectionnez une souris avec une grande tumeur, qui est confirmée par l’imagerie de la bioluminescence.
    Remarque : Plus d’informations sur les constructions de Sleeping Beauty Transposon System et plasmide utilisées se trouvent dans Calinescu et al. 9.
    1. Pour les souris de l’image, injecter 100 µL de solution de luciférine de 30 mg/mL par voie intrapéritonéale à l’aide d’une aiguille de 26 calibre.
    2. 5 min après l’injection de luciférine, anesthésier l’animal à l’aide d’une chambre d’anesthésie avec débit d’oxygène/isoflurane isoflurane 2 % la valeur.
    3. Quand les animaux sont anesthésiés (généralement 2-3 min), placer les animaux dans la chambre de bioluminescence à l’isoflurane oxygène mis à 2 % isoflurane. Si les animaux sera sous anesthésie pendant plus de 5 min, utiliser une pommade ophtalmique pour prévenir le dessèchement tandis que sous anesthésie.
    4. L’image des souris en utilisant un en vivo optique d’imagerie système avec les paramètres suivants : exposition automatique, grand binning et ouverture f = 1. Le paramètre de l’examiner une grande tumeur est une bioluminescence > 106 photons/s/cm2/sr.
  3. Euthanasier la souris avec une surdose d’inhalation isoflurane anesthésique dans une enceinte fermée, vérifiez par pinch orteil que l’animal est anesthésié et décapiter la souris.
  4. Extraire le cerveau et disséquer il comme décrit précédemment dans Calinescu et al. 9.
  5. Placer le cerveau dans une boîte de Pétri de 10 cm. Si la tumeur induite par exprime une protéine fluorescente, utiliser un fluorescent binoculaire sur le canal approprié fluorescent et 0,3 X grossissement, identifier autrement masse tumorale par les différences dans la texture et la couleur de tissu. Utiliser le scalpel et forceps pour séparer le tissu de tumeur du cerveau normal.
  6. Émincer la tumeur en petits morceaux dans la boîte de Pétri. Placer la tumeur disséquée dans un tube de 1,5 mL avec 300 µL de milieu NSC.
  7. Utilisez un pilon de granulés de plastique jetables qui s’installe sur les murs d’un tube conique microcentrifugeuse pour homogénéiser doucement la tumeur. Ajouter 1 mL de milieu de détachement cellulaire et incuber l’échantillon pendant 5 min à 37 ° C.
    Remarque : L’utilisation d’un pilon peut tuer certaines cellules. Si le lecteur veut maximiser la viabilité des cellules, l’utilisation d’un pilon peut être omise.
  8. Passer la suspension cellulaire de l’étape 1.7 à travers un tamis de cellule 70 µm et lavez le tamis avec 25 mL de milieu de NSC.
  9. Centrifuger la suspension à 300 x g pendant 5 min à température ambiante, éliminer le surnageant et Resuspendre le culot dans 6 mL de milieu de NSC.
  10. La suspension de cellules de tumeur de l’étape 1.9 dans un flacon de culture T-25 de la plaque et la culture à 37 ° C dans un incubateur de culture de tissus avec une atmosphère de 95 % air et 5 % de CO2. Habituellement au bout de 3 jours, il y aura un mélange de quelques cellules mortes, de cellules adhérentes et de certaines cellules formant NS qui flottent dans le milieu.
  11. Transférer la suspension de cellules dans un tube conique de 15 mL, percevoir uniquement les cellules qui se déposent au fond à l’aide d’une micropipette et re-plaque d’eux sur un flacon de culture de tissus T-75.
  12. Maintenir les cellules à une densité relativement élevée (1-3 X 106 cellules dans un T-25). Le passage des cellules lorsqu’elles sont confluentes.
    Remarque : La confluence est déterminée par la taille des sphères. Centre noir de moyenne de grandes sphères qu’il existe des cellules mortes dans le centre et indique que les cellules doivent être repiquées immédiatement.
  13. Ajouter les facteurs de croissance (EGF et basic-FGF ; 20 ng/mL chacun) tous les trois jours. Changer le milieu lorsque les cellules ne sont pas des confluents et la lumière orange de tours moyennes.
  14. Pour modifier le milieu, recueillir le milieu de la vieil et il centrifuger à 300 g à température ambiante pendant 5 min et Resuspendre le culot dans NSC additionné EGF et FGF à la concentration indiquée à l’étape 1.1.
    Remarque : Si les sphères sont à mi-confluence élevé, mais pas prêts à être repiquées (taille de la sphère est faible avec un diamètre < 100 µm), puis les granulés peuvent être divisés en deux flacons.
  15. Pour les cellules, centrifuger les cellules à 300 g pendant 5 min à température ambiante, éliminer le surnageant et incuber les cellules dans un milieu détachement cellulaire pendant 5 min à 37 ° C.
    1. Ajouter 5 mL de solution saline équilibrée au milieu de détachement diluées et il centrifuger à 300 x g pendant 5 min à température ambiante.
    2. Décanter le liquide surnageant, resuspendre le culot dans 18 mL de milieu de NSC et répartissez la suspension également sur trois flacons de T-25.
  16. Pour congeler les aliquotes de cellules, dissocier les cellules comme au point 1.15 et geler les cellules dans 1 ml de sérum de veau fœtal de 90 % à 10 % de diméthyl sulfoxide. Refroidir lentement les cellules en plaçant les cellules sur la glace pendant 10 min, puis en gardant les cellules de-20 ° C pendant 30 min et -80 ° C pendant 1 nuit. Le lendemain, les cellules de transfert à un conteneur de stockage d’azote liquide.

2. native ChIP

  1. Préparation de la chromatine
    1. Après avoir fait le point sur NS dérivée, culture NS dans un T-75 dans 15 mL de milieu de NSC à 37 ° C dans un incubateur de culture de tissus avec une atmosphère d’air de 95 % et 5 % CO2 jusqu'à ce que NS deviennent confluentes. Une plaque de T-75 confluente produira 3-5 X 106 cellules.
    2. Lorsque les cellules deviennent confluentes, centrifuger NS à 300 g pendant 5 min, éliminer le surnageant et ajouter 1 mL de milieu de dissociation cellulaire. Incuber les cellules à 37 ° C pendant 5 min. Ajouter 5 mL de milieu et de compter les cellules à l’aide d’un hémocytomètre10.
      Remarque : 1 x 106 cellules sont requis par la réaction d’immunoprécipitation (IP). Notez qu’un sérum immun pré ou IgG contrôle doit également être inclus11.
    3. Centrifuger le NS dans un tube de microtubes de 1,5 mL à 300 g pendant 5 min, éliminer le surnageant et Resuspendre le culot de NS avec 1 mL de solution saline équilibrée et transférer la suspension pour tubes de microcentrifuge hypoprotidique liaison 1,5 mL.
    4. NS de centrifuger à 300 x g pendant 5 min, éliminer le surnageant et Resuspendre le culot dans 95 µL de tampon de digestion (50 mM Tris-HCl, pH 8,0, 1 mM CaCl2, 0,2 % éther de polyéthylèneglycol octylphényle) par 1 x 106 cellules additionnés de protéase inhibiteur de cocktail à une concentration élevée (1/100). Immédiatement pipette les cellules vers le haut et vers le bas pour éviter les grumeaux et éviter de créer des bulles.
    5. Resuspendre MNase dans 50 % de glycérol pour faire une solution de 1 mg/mL (1.15 unités/µL, conservés à-20 ° C) qui sera dénommée stock « 1 x ». Faire un « 0,1 x » stock en faisant une dilution de 1:9 deuxième à 50 % de glycérol (e.g., 900 µL de « 1 x » MNase et 100 µL de glycérol à 50 %) et les conserver à-20 ° C.
    6. Mix 5 µL de « 0,1 x » MNase et 145 µL de tampon de la digestion. Garder l’enzyme sur la glace tout les temps. Ajouter 5 µL de MNase dilué dans un tampon de digestion par 1 x 106 cellules. Feuilleter le tube pour mélanger et placer le tube dans le bloc de 37 ° C pendant exactement 12 min processus l’un des échantillons à la fois d’assurer un temps d’incubation précis de 12 min.
    7. Ajouter 10 µL de 10 x MNase arrêter le tampon (110 mM Tris-HCl, pH 8,0, 55 mM EDTA) par 1 x 106 cellules. Échantillons doivent être conservés sur glace à partir de là.
    8. Ajouter 110 µL tampon » 2 x RIPA » (280 mM NaCl, éther de polyéthylèneglycol de 1,8 % octylphényle, 0,2 % dodécylsulfate de sodium (SDS), 0,2 % Na-désoxycholate, 5 mM ethylene glycol-bis(β-aminoethyl ether)-N, N, N', N'-tétraacétique (EGTA) ; stockés à 4 ° C) additionné de inhibiteur de la protéase cocktail à forte concentration (au 1/100) par 1 x 106 cellules. Mettez le tube pour mélanger.
    9. Centrifuger les tubes pendant 15 min dans un microtube à 4 ° C et 1700 x g. transférer le surnageant dans un nouveaux tubes de microcentrifuge régulière de 1,5 mL (tubes de microcentrifuge hypoprotidique liaison ne sont plus nécessaires) et stockez-les sur la glace. Jeter le culot.
  2. Immunoprécipitation (IP)
    1. Mélange de protéine A et billes magnétiques de protéines G dans un rapport 1:1. Pour chaque adresse IP, préparer 25 µL de perles.
    2. Les perles de lavage en ajoutant 1 mL de tampon RIPA (10 mM Tris pH 8,0, 1 mM EDTA, 140 mM NaCl, 1 % polyéthylène glycol éther d’octylphényle, SDS 0,1 %, 0,1 % Na-désoxycholate ; stockés à 4 ° C) complétée par des inhibiteurs de protéase à faible concentration (1 : 1000).
    3. Utiliser un aimant pour permettre des perles séparer de la solution de lavage et de décanter la solution de lavage (environ 1 min). Effectuer deux fois l’étape de lavage.
    4. Remettre en suspension les perles au volume initial à l’aide du tampon RIPA additionné d’inhibiteurs de la protéase (1 : 1000).
    5. Si nécessaire, diluer la chromatine à l’aide du tampon RIPA, complétée par des inhibiteurs de protéase (1 : 1000) afin que chaque adresse IP a un volume de 100-200 µL. réserve de 10 % du volume utilisé par la propriété intellectuelle de la chromatine pour l’entrée.
      NOTE : par exemple, si 200 µL sont utilisés par la propriété intellectuelle, 20 µL de chromatine diluée devrait être réservée pour l’entrée. Pour un total de quatre IPs, le volume total de la chromatine doit être dilué à 820 µL.
    6. Préparer l’entrée. Ajouter 100 µL de tampon de TE (10 mM Tris-HCl pH 8,0, EDTA 1 mM) additionné de la protéinase K (0,5 mg/mL) à l’entrée et incuber l’entrée à 55 ° C pendant 1 h.
      Remarque : 2.2.6-2.2.7 étapes peuvent être effectuées avec les étapes 2.3.4 et 2.4.1.
    7. Purifier l’entrée à l’aide d’un kit de purification de PCR suivant les instructions du fabricant et éluer dans 50 µL de tampon d’élution fourni dans le kit.
    8. Mesurer la concentration de l’entrée à l’aide d’un spectrophotomètre microvolume et consigner les résultats dans un carnet. Blanc avec un tampon d’élution du kit.
      Remarque : Dans neurospheres de souris, nous avons utilisé environ 6 µg d’ADN pour chaque adresse IP.
    9. Courir d’entrée sur un gel 1 % ou charger 1 µL sur un Bioanalyzer d’ADN en utilisant des paramètres standards. Conserver le reste pour une utilisation en tant qu’entrée dans les applications en aval.
    10. Ajouter 10 µL de protéine lavée A & billes magnétiques G pour chaque IP et IP Incuber 1 h à 4 ° C.
      NOTE : par exemple, ajouter 30 µL de protéine A et billes magnétiques G pour trois adresses IP.
    11. Placer les échantillons sur un aimant et permettre aux perles de séparer. Diviser la chromatine en transférant la somme préalablement déterminée dans un nouveau tube de 1,5 mL.
    12. Ajoutez l’anticorps et envelopper les bouchons avec film plastique paraffine pour éviter l’évaporation. Incuber les échantillons durant la nuit à 4 ° C avec rotation à 20 tr/min.
      NOTE : Concentration doit être déterminée empiriquement suivant les recommandations du fabricant.
    13. Le lendemain, faire tourner les tubes à l’aide d’une centrifugeuse minie à température ambiante, 2000 x g, pour 10 s. Ajouter 10 µL de perles à chaque adresse IP, puis incuber IP pendant 3 h à 4 ° C avec rotation à 20 tr/min.
  3. Lavages de la propriété intellectuelle et de la Digestion des protéines
    1. Ajouter 150 µL de tampon RIPA, complétée par des inhibiteurs de protéase à faible concentration (1 : 1000) pour chaque adresse IP et incuber IP à 4 ° C, avec rotation à 20 tr/min pendant 5 min Place l’échantillon sur un support magnétique et permettent les billes magnétiques séparer. Utilisez une pipette pour éliminer le surnageant. Répétez cette lave cinq tep.
    2. Ajouter 150 µL de tampon de LiCl (LiCl, 10 mM Tris pH 8,0, EDTA, 0,5 % de 1 mM à 250 mM NP-40, 0,5 % Na-désoxycholate ; conserver à 4 ° C) complétées par des inhibiteurs de la protéase à faible concentration (1 : 1000) pour chaque adresse IP et incuber IP à 4 ° C, avec rotation à 20 tr/min pendant 5 min Place l’échantillon sur un magnétique stand et permettre des billes magnétiques séparer. Utilisez une pipette pour éliminer le surnageant.
    3. Ajouter 150 µL de TE froide (sans inhibiteurs de la protéase) et incuber l’échantillon à 4 ° C avec rotation à 20 tr/min pendant 5 min Place l’échantillon sur un support magnétique et permettent des billes magnétiques séparer. Utilisez une pipette pour éliminer le surnageant.
    4. Après le lavage final, remettre en suspension l’échantillon dans 100 µL de tampon TE additionné de protéinase K (0,5 mg/mL) et incuber l’échantillon à 55 ° C pendant 1 h.
  4. Purification d’ADN et puce Quantitative Real-time PCR (qPCR)
    1. Purifier l’ADN immunoprécipitée à l’aide d’un kit de purification de PCR. Après addition de tampon de liaison ADN du kit pour chaque échantillon, placer le tube sur un aimant et attendre que des billes magnétiques globales, puis transférer le surnageant à la colonne de nettoyage. Suivez les instructions du fabricant et éluer dans 50 µL de tampon d’élution fourni dans le kit.
    2. Pour vérifier si l’IP est réussi, effectuez un qPCR. Idéalement, les amorces doivent être conçus pour les régions témoins positifs et négatifs.
      NOTE : par exemple, pour une adresse IP effectuée avec H3K4me3 et H3K27me3, les exemples suivants doivent être exécutés sur qPCR : H3K4me3, H3K27me3 et IgG puce ADN, entrée ADN et un aucun contrôle modèle (NTC) en utilisant des amorces pour les régions à s’enrichir avec H3K4me3 (contrôle positif) et régions à s’enrichir avec H3K4me3 (témoin négatif) ; de même, pour H3K27me3.
    3. Suivent des protocoles standards pour effectuer qPCR12. En bref, effectuer un qPCR utilisant SYBR vert mix master, 0,5 µL de concentration de travail 10 µM de chaque amorce avant et arrière et 2 µL de puce ou de l’ADN d’entrée. Lire les plaques à l’aide d’un système de PCR en temps réel. Séquences d’amorces sont fournis dans le tableau 2. Les séquences d’amorces Gapdh de Hwang et al. ont été utilisé13.
    4. Analyser les données de la puce par rapport à l’entrée, c'est-à-dire, pour cent d’entrée méthode (IP %)14. Calculer le pourcentage d’entrée à l’aide des formules suivantes :
      Ajusté d’entrée = moyenne ct (entrée)-ouvrir une session2(DF)
      où DF est le facteur de dilution de l’apport de départ et
      DF = volume total de la propriété intellectuelle / volume d’entrée
      % IP = 100 × 2 ^ (ajusté entrée - Ct (IP))
      où Ct est le facteur de seuil.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Une représentation schématique de la tumeur NS généré à partir d’une tumeur au cerveau où les cellules de tumeur de cerveau sont Katushka positive est présentée dans la Figure 1. La figure 2 est une représentation schématique de la technique de la puce ensemble. La figure 3 montre les résultats représentatifs de la chromatine de tumeur au cerveau NS digéré avec MNase pendant 12 min, ce qui donne une majorité de mono, di- et tri-nucléosomes. Suite à puce, un qPCR peuvent être effectuée sur la puce et d’entrée de l’ADN des échantillons. La figure 4 montre des données représentatives de qPCR de puce d’une qPCR de glycéraldéhyde-3-phosphate déshydrogénase (Gapdh). GAPDH est un gène de ménage qui est enrichi avec H3K4me3, une modification qui est associée de transcription active. Les résultats montrent que la Gapdh est enrichi en H3k4me3 et ne sont pas enrichis avec H3K27me3 qui est une modification associée aux régions de chromatine réprimée.

Figure 1
Figure 1 : schéma de tumeur NS généré à partir d’une tumeur au cerveau positif Katushka. Un champ lumineux et fluorescent image d’un cerveau récolté sur une souris qui atteint le stade de point de terminaison. La zone de la tumeur est délimitée par la ligne pointillée et est positive pour le journaliste fluorescent, Katushka. La tumeur est ensuite isolé et le tissu tumoral est recueilli dans un tube de 1,5 mL. Les cellules sont alors dissociées et cultivés sous forme de NSC moyen et tumeur de NS. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : représentation schématique du workflow pour puce native. NS de tumeur sont cultivés et élargies. Chaque adresse IP s’effectue à 1 X 106 cellules. La chromatine est fragmentée à l’aide par digestion MNase pour obtenir mono, di- et tri-nucléosomes. La chromatine est incubée avec un anticorps spécifique pour une modification des histones ou ADN associées à la protéine d’intérêt. Le complexe ADN-anticorps immunoprecipitated avec perles A/G protéine magnétique. Enfin, la protéine est digérée et ADN est épuré pour obtenir uniquement les ADN enrichi avec modification des histones ou ADN associées à la protéine d’intérêt. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : fragmentation de la chromatine par MNase. La chromatine a été établie de tumeur au cerveau NS par addition MNase et incubation à 37 ° C pour exactement 12 min. ADN représentant les résultats de Bioanalyzer analyse d’un échantillon d’entrée démontrent que la majorité de l’ADN a été fragmentée en mono-, di- et tri- nucléosomes. 1 Lane est l’échelle en paires de bases (PB). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : données de qPCR représentant ChIP présentées comme pourcentage entrée. qPCR fut jouée avec IgG, H3K4me3, and H3K27me3 puce ADN en utilisant des amorces de glycéraldéhyde-3-phosphate déshydrogénase (Gapdh). Résultats représentatifs démontrent que Gapdh, un gène de ménage, est seulement enrichi avec la modification H3K4me3, associé de transcription active et pas la modification de H3K27me3, associé de chromatine réprimée. Ce graphique représente les résultats de deux expériences biologiques avec trois puits répétées chaque. Barres d’erreur représentent erreur type de la moyenne (SEM). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Gène Primer avant Inverser l’apprêt
GAPDH TCCCCTCCCCCTATCAGTTC GACCCGCCTCATTTTTGAAA

Tableau 1 : Les amorces utilisées pour des expériences de qPCR ChIP. Les séquences des amorces utilisées pour Gapdh figurent dans ce tableau.

veux dire Ct (entrée) Écart-type Entrée ajustée
24.265 0,071 20.943
Pourcentage d’entrée
Échantillon Brute moyenne Ct Écart-type Pourcentage d’entrée = 100 * 2 ^ (ajusté input-Ct(IP))
IgG 32,23 0,112 0,04
H3K4me3 22.148 0,128 43,37
H3k27me3 32,79 0,519 0,027
NTC indéterminé indéterminé indéterminé

Tableau 2 : exemple de calcul de la p méthode pour l’analyse de qPCR puce d’entrée. Exemple de calcul du pourcentage d’entrée pour la puce réalisée avec 10 % à partir d’entrée ; DF = 10. Les données de ce tableau illustrent les valeurs brutes d’une expérience biologique avec réplicat 3 puits exécutent pour chaque échantillon.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Le protocole présenté ici permettra à l’utilisateur d’effectuer puce native sur NS dérivées de tumeurs cérébrales génétiquement. Contrairement à la puce de réticulation, ce protocole est limité pour l’étude des protéines qui associent étroitement à ADN6. Le nombre de cellules utilisées peut être modifié selon les besoins et le protocole peut être entartré. Nous avons utilisé 1 X 106 cellules / IP, cependant, puce natif peut-être être effectuée avec aussi peu que 4 x 104 cellules5. Dans ce protocole, nous avons analysé la puce ADN par l’intermédiaire de qPCR ; Toutefois, ce protocole peut aussi être combiné avec séquençage de génération suivant pour étudier les interactions protéine-ADN sur un plan large du génome. Nous avons utilisé ce protocole ChIP avec succès pour analyser l’effet des oncogènes gliome sur le dépôt des modifications d’histone dans certaines régions du génome des cellules tumorales.

Il y a quelques étapes critiques lors de l’exécution native ChIP. Tout d’abord, les conditions de digestion pour chaque type de cellule doivent être empiriquement déterminées. La majorité de la chromatine devraient être mono-nucléosomes (150 bp) avec quelques pics de di - et tri-nucléosome (Figure 3). Nos résultats de protocole dans plus de 70 % mono-, di- ou pics tri-nucléosomes, cependant, reste certains ADN non digéré. Si le protocole servira pour ChIP-seq, des mesures supplémentaires devront supprimer ADN non digéré. En outre, il est important de garder à l’esprit que chaque lot de MNase acheté peut différer en activité et nécessitent donc une optimisation des conditions digestion. En second lieu, la qualité d’une puce dépend fortement de la spécificité de l' anticorps utilisé11. Un anticorps de puce de qualité devrait avoir une réactivité élevée contre la cible et la faible réactivité croisée avec d’autres protéines associées à l’ADN ou hors cible histone modifications11. Pour cette raison, nous vous recommandons de tester la spécificité de l’anticorps à l’aide d’un test de liaison peptidique. ENCODE lignes directrices suggèrent qu’un enrichissement dix fois doit être observé pour la modification d’intérêt par rapport à d’autres modifications11. Il est aussi essentiel d’effectuer des immunoprecipations de contrôle nécessaires, c'est-à-dire, avant immunitaire ou contrôle IgG. Lorsque ces considérations sont remplies, les données natives de puce sont une méthode fiable solide afin d’étudier les mécanismes épigénétiques réglementés par des interactions protéine-ADN.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgements

Ce travail a été soutenu par la National instituts de santé/National Institute of Neurological Disorders & Stroke (NINDS/NIH) subventions R37-NS094804, NS074387-R01, R21-NS091555 à M.G.C. ; NIH/NINDS accorde R01-NS076991 et NS082311-R01 R01-NS096756 PRL ; NIH/NINDS R01-EB022563 ; le département de neurochirurgie ; De Léa coeur joyeux et Tchad si Fondation à M.G.C. et PRL RNA biomédecine Grant F046166 à M.G.C. F.M.M. est pris en charge par un F31 NIH/NINDS-F31NS103500. R.I.Z.-V. est pris en charge par le NIH / NIGM grant 5T34GM007821-37.

Materials

Name Company Catalog Number Comments
Agilent 2100 Bioanalyzer Agilent G2946-90004 bioanalyzer
AccuSpin Micro 17R, refrigerated Fisher Scientific 13-100-676
C57BL/6 Taconic B6-f C57BL/6 mouse
Calcium Chloride Aldrich 22350-6 buffer reagent
D-Luciferin, Potassium Salt Goldbio LuckK-1g
DiaMag1.5 magnetic rack Diagenode B04000003 for magnetic bead washes
DiaMag Rotator EU Diagenode B05000001 rotator
DMEM/F-12 Gibco 11330-057 NSC component
Dynabeads Protein A Thermo Fisher Scientific 10001D protein A magnetic beads
Dynabeads Protein G Thermo Fisher Scientific 10003D protein G magnetic beads
EGF PeproTech AF-100-15 prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Ethylenediaminetetraacetic acid (EDTA) Sigma E-4884 buffer reagent
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) (EGTA) Sigma E-4378 buffer reagent
Fast SYBR Green Master Mix Applied Biosystems 4385612 qPCR reagent
Fetal Bovine Serum Gibco 10437028 for freezing cells
FGF PeproTech 100-18b Prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Forceps Fine Science Tools 11008-13 for dissection of tumor
Glycerol, MB Grade EMD- Millipore 356352
H3K4me3 Abcam Ab8580
H3K27me3 Millipore 07-449
HBSS Gibco 14175-103 balanced salt solution
Fluriso VETone 501017 inhalation anesthetic
Ivis Spectrum Perkin-Elmer 124262 in vivo optical imaging system
Hyqtase HyClon SV3003001 cell detachment media
Lithium Chloride Sigma L8895 buffer reagent
Low binding microtubes Corning Costar CLS3207 low protein binding microcentrifuge tube
Microcentrifuge tube Fisher 21-402-903 regular microcentrifuge tube
Micrococcal Nuclease Thermo Fisher Scientific, Affymetrix 70196Y each batch may differ; purchase sufficient amount for experiments and aliquot.
N2 Gibco 17502-048 NSC component
Normal Rabbit IgG Millipore 12-372
Normocin Invivogen NOL-36-063 anti-microbial agent, use at 0.1 mg/mL.
NP-40 (Igepal CA-630) Sigma 18896-50ML buffer reagent
Kimble Kontes Pellet Pestle Fisher Scientific K749515-0000
Protease Inhibitor Cocktail Sigma-Aldrich P8340 aliquot and store at -20 °C.
Protinase K Sigma-Aldrich P2308 make 10 mg/mL stock in water; aliquot and store at -20 °C.
QIAquick PCR Purification Kit Qiagen 28104 DNA purification kit
Scalpel Fine Science Tools 10007-16 for dissection of tumor
Sodium Chloride VWR 0241-5KG buffer reagent
Sodium Deoxycholate Sigma-Aldrich D670-25G buffer reagent
Sodium Dodecyl sulfate (SDS) Sigma L-4390 buffer reagent
Tris Base Thermo Fisher Scientific Bp152-1 buffer reagent
Triton X-100 Thermo Fisher Scientific BP 151-500 polyethylene glycol octylphenyl ether
Standard Mini Centrifuge Fisherbrand 12-006-901 standard mini centrifuge
SZX16 microscope Olympus SZX16 flourescent dissecting microscope
ViiA 7 Real-Time PCR System with Fast 96-Well Block Applied Biosystems 4453535
Nanodrop One Thermo-Fisher Scientific ND-ONEC-W

DOWNLOAD MATERIALS LIST

References

  1. Schwartzentruber, J., et al. Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature. 482, (7384), 226-231 (2012).
  2. Bjerke, L., et al. Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN. Cancer Discov. 3, (5), 512-519 (2013).
  3. Bender, S., et al. Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell. 24, (5), 660-672 (2013).
  4. Maleszewska, M., Kaminska, B. Is glioblastoma an epigenetic malignancy? Cancers (Basel). 5, (3), 1120-1139 (2013).
  5. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  6. Thorne, A. W., Myers, F. A., Hebbes, T. R. Native chromatin immunoprecipitation. Methods Mol Biol. 287, 21-44 (2004).
  7. Turner, B. Mapping Protein/DNA Interactions by Cross-Linking. (2001).
  8. Tseng, Z., Wu, T., Liu, Y., Zhong, M., Xiao, A. Using native chromatin immunoprecipitation to interrogate histone variant protein deposition in embryonic stem cells. Methods Mol Biol. 1176, 11-22 (2014).
  9. Calinescu, A. A., et al. Transposon mediumted integration of plasmid DNA into the subventricular zone of neonatal mice to generate novel models of glioblastoma. J Vis Exp. (96), (2015).
  10. Sambrook, J., Russell, D. W. Estimation of cell number by hemocytometry counting. CSH Protoc. 2006, (1), (2006).
  11. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  12. Kubista, M., et al. The real-time polymerase chain reaction. Mol Aspects Med. 27, (2-3), 95-125 (2006).
  13. Hwang, W. W., et al. Distinct and separable roles for EZH2 in neurogenic astroglia. Elife. 3, e02439 (2014).
  14. Haring, M., et al. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods. 3, 11 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics