Native Chromatin Immunoprecipitation med Murine hjerne svulst Neurospheres

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Epigenetic mekanismer endres ofte i glioma. Chromatin immunoprecipitation kan brukes til å studere konsekvensene av genetiske endringer i glioma som skyldes endringer i histone modifikasjoner som regulerer chromatin struktur og gene transkripsjon. Denne protokollen beskriver innfødt chromatin immunoprecipitation på murine hjerne svulst neurospheres.

Cite this Article

Copy Citation | Download Citations

Mendez, F. M., Núñez, F. J., Zorrilla-Veloz, R. I., Lowenstein, P. R., Castro, M. G. Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres. J. Vis. Exp. (131), e57016, doi:10.3791/57016 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Epigenetic endringer kan være involvert i utvikling og progresjon av glioma. Endringer i metylering og acetylation av arrangører og regulatoriske regionene oncogenes og svulst suppressors kan føre til endringer i genuttrykk og spiller en viktig rolle i patogenesen av hjernesvulster. Native chromatin immunoprecipitation (ChIP) er en populær teknikk som gjør påvisning av endringer eller andre proteiner bundet til DNA. I motsetning til krysskoblet ChIP, innfødt chip, behandles celler ikke med formaldehyd covalently koble protein til DNA. Dette er en fordel fordi noen ganger crosslinking kan fikse proteiner som bare transiently samhandle med DNA og har ikke funksjonell betydning i genreguleringen. I tillegg er antistoffer generelt reist mot unfixed peptider. Derfor er antistoff spesifisitet økt i opprinnelige brikken. Det er imidlertid viktig å huske at innfødt ChIP gjelder bare å studere histones eller andre proteiner som binder tett DNA. Denne protokollen beskriver den opprinnelige chromatin immunoprecipitation på murine hjerne svulst neurospheres.

Introduction

Epigenetic hendelser er hyppig i gliomas og trolig spille en viktig rolle i patogenesen ved svulst. Faktisk i pediatric høyverdig glioma forekommer mutasjoner i gener som koder histone varianter H3.3 og H3.1 hyppig1. Mutasjoner påvirker histone modifikasjoner og har store epigenetic konsekvenser2,3. I unge voksne spektrum oppstår tilbakevendende mutasjoner i isocitrate dehydrogenase gen 1/2 (IDH1/2), en mutasjon som hemmer α-KG avhengige histone og DNA de-methylasaes, og genetiske endringer i andre chromatin regulatorer som ATRX og DAXX 4. derfor det er av avgjørende betydning å studere hvordan mutasjoner som påvirker epigenetic regulatorer endrer chromatin struktur og regulatoriske histone modifikasjoner, som i sin tur ha en dramatisk innvirkning av kreftceller transcriptome.

Chromatin immunoprecipitation (ChIP) er et kraftig verktøy som brukes til å evaluere virkningen av epigenetic endringer i genomet5,6,7. I native ChIP, chromatin er fordøyd med micrococcal nuclease (MNase), immunoprecipitated med et antistoff reist mot protein av interesse, og deretter DNA er renset fra immunoprecipitated chromatin komplekse6. Celler fast ikke under prosedyren så denne teknikken er bare anvendelig for studier av proteiner som samarbeide tett med DNA6. Fravær av cross-linking hjelpemidler antistoff spesifisitet siden antistoffer er vanligvis reist mot unfixed peptider eller proteiner7. I tillegg, siden det er ingen cross-linking trinn, reduserer dette sjansene for fikse forbigående protein-DNA interaksjoner som er uspesifikke og ikke regulatoriske7,8. ChIP kan brukes til å identifisere anriking av histone endringer i et bestemt genomisk område. Her, detalj vi en protokoll for utføre native ChIP i neurospheres (NS) generert fra genetisk konstruert musen modeller av glioma.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle metodene som er beskrevet her er godkjent av institusjonelle Animal Care og bruk Committee (IACUC) av University of Michigan.

1. generasjon hjernesvulst NS og dyrking forhold.

  1. Klargjør nevrale stamceller Medium (NSC) med Dulbeccos endret Eagle Medium/F12B27 supplement (1 x), N2 supplement (1 x), og en antimikrobiell reagens. Supplere NSC medium ved menneskelige rekombinant endotelial vekstfaktor (EGF) og basic-fibroblast vekst faktor (FGF) i en siste konsentrasjon på 20 ng/mL hver.
  2. Indusere hjernesvulst musen bruker Sleeping Beauty transposon systemet der plasmider koding oncogenes eller shRNA målretting svulst suppressors injiseres i laterale ventriklene av nyfødte for å generere spontan hjernen svulster9. Velg en mus med en stor svulst, som er bekreftet med bioluminescens imaging.
    Merk: Mer detaljert informasjon om de sovende skjønnhet Transposon systemet og plasmider konstruksjoner brukes finnes i Calinescu et al. 9.
    1. For å bilde musene, injisere 100 µL av 30 mg/mL luciferin løsning intraperitoneally bruker en 26 gauge nål.
    2. 5 min etter injeksjon av luciferin, bedøve dyret med en bedøvelse kammer med oksygen/isoflurane flyt satt til 2% isoflurane.
    3. Når dyrene er anesthetized (vanligvis 2-3 min), plasserer dyrene i bioluminescens kammer med oksygen isoflurane satt til 2% isoflurane. Hvis dyrene under narkose lenger enn 5 min, bruk en ophthalmica salve for å hindre tørrhet mens under narkose.
    4. Bilde mus med en i vivo optisk tenkelig system med følgende parametere: automatisk eksponering, store binning og blenderåpning f = 1. Parameteren å vurdere det en stor svulst er en bioluminescens > 106 fotoner/s/cm2/sr.
  3. Euthanize musen med en overdose av isoflurane innånding anestesi i et lukket kammer, sjekk av tå knipe at dyret er anesthetized, og halshugge musen.
  4. Ekstra hjernen og dissekere den som beskrevet tidligere i Calinescu et al. 9.
  5. Sette hjernen i en 10 cm Petriskål. Hvis svulsten indusert uttrykker et fluorescerende protein, bruk en fluorescerende dissekere mikroskop satt til den aktuelle fluorescerende kanalen og 0,3 X forstørrelse, ellers identifisere svulst masse av forskjellene i vev farge og tekstur. Bruk skalpell og tang for å skille tumor vev fra normal hjernen.
  6. Hakke svulst i små biter i Petriskål. Plass dissekert svulst i en 1,5 mL tube med 300 µL av NSC medium.
  7. Bruk en engangs plast pellet støter som passer til veggene av en konisk microcentrifuge rør til forsiktig homogenize svulsten. Legg 1 mL av cellen avdeling medium og ruge utvalget for 5 min på 37 ° C.
    Merk: Bruk av en støter kan drepe noen celler. Hvis leseren ønsker å maksimere celle levedyktighet, kan bruk av en støter utelates.
  8. Passerer cellen suspensjon fra trinn 1.7 gjennom en 70 µm celle sil og vaske silen med 25 mL NSC medium.
  9. Sentrifuge suspensjon på 300 x g i 5 minutter ved romtemperatur, Dekanter nedbryting og re suspendere pellet til 6 mL av NSC medium.
  10. Plate svulst celle suspensjon fra trinn 1,9 i en T-25 kultur kolbe og kultur det på 37 ° C i en vev kultur inkubator med en atmosfære av 95% luft og 5% CO2. Vanligvis etter 3 dager, vil det være en blanding av noen døde celler, overholdt celler og noen celler danner NS som flyter i medium.
  11. Overføre celle suspensjon i en 15 mL konisk tube, samle bare cellene synke å bunnen med brønnene og re plate dem på en T-75 vev kultur kolbe.
  12. Opprettholde cellene på relativt høy tetthet (1-3 X 106 celler i et T-25). Passasje celler når de er confluent.
    Merk: Confluency avhenger av kuler størrelsen. Svart sentre store kuler betyr at det er døde celler i midten og indikerer at cellene skal være passaged umiddelbart.
  13. Legge til vekstfaktorer (EGF og basic-FGF; 20 ng/mL hver) hver tredje dag. Endre mediet når cellene ikke er confluent og middels svinger lys oransje.
  14. For å endre medium, samle gamle mediet sentrifuge det 300 x g ved romtemperatur for 5 min og å suspendere celle pellet i NSC medium supplert med EGF og FGF på konsentrasjonen angitt i trinn 1.1.
    Merk: Hvis kulene på midt-høy confluency, men ikke klar til å bli passaged (sfære størrelsen er liten med en diameter < 100 µm), så pellet kan deles i to flasker.
  15. For å passasje cellene, sentrifuge cellene på 300 x g i 5 minutter ved romtemperatur, Dekanter nedbryting og ruge cellene i cellen avdeling medium for 5 min på 37 ° C.
    1. Legg til 5 mL av balansert salt løsning å fortynne avdeling medium og sentrifuge det 300 x g i 5 minutter ved romtemperatur.
    2. Dekanter nedbryting, resuspend celle pellet i 18 mL av NSC medium og del suspensjon like i tre T-25 flasker.
  16. Hvis du vil fryse dele celler, distansere cellene som i trinn 1.15 og fryse cellene i 1 mL dele 90% fosterets bovin serum med 10% dimethyl sulfoxide. Sakte avkjølt cellene ved å plassere cellene på is 10 min og deretter holde cellene 20 ° C i 30 min, og-80 ° C i 1 dag. Neste dag, overføre cellene til en flytende nitrogen-beholderen.

2. innfødt ChIP

  1. Chromatin forberedelse
    1. Etter lager av avledede NS, kultur NS i en T-75 i 15 mL NSC medium på 37 ° C i en vev kultur inkubator med en atmosfære av 95% luft og 5% CO2 til NS blir confluent. En confluent T-75 plate vil gi 3-5 X 106 celler.
    2. Når cellene blir confluent, sentrifuge NS på 300 x g i 5 min, Dekanter nedbryting og legge 1 mL av cellen dissosiasjon medium. Inkuber cellene på 37 ° C i 5 min. legge 5 mL av medium og telle celler ved hjelp av en hemocytometer10.
      Merk: 1 x 106 celler er nødvendig per immunoprecipitation (IP) reaksjon. Merk at en pre immunsystemet serum eller IgG kontroll må også være inkludert11.
    3. Sentrifuge NS i en 1,5 mL microcentrifuge tube 300 x g i 5 min, Dekanter nedbryting og å suspendere NS pellets med 1 mL av balansert salt løsning og overføre suspensjon til lav protein bindende 1,5 mL microcentrifuge rør.
    4. Sentrifuger NS på 300 x g i 5 min, Dekanter nedbryting og å suspendere celle pellet i 95 µL fordøyelsen bufferen (50 mM Tris-HCl, pH 8.0, 1 mM CaCl2, 0,2% polyetylenglykol octylphenyl Eter) per 1 x 106 celler med protease hemmer cocktail i en høy konsentrasjon (1: 100). Umiddelbart Pipetter cellene opp og ned for å hindre clumping og unngå å skape bobler.
    5. Resuspend MNase i 50% glyserol å 1 mg/mL løsning (1,15 enheter/µL, lagret på 20 ° C) som vil bli referert til som "1 x" lager. Gjør en "0,1 x" lager ved å gjøre en andre 1:9 fortynning med 50% glyserol (f.eks., 900 µL av "1 x" MNase og 100 µL 50% glyserol) og lagre den på 20 ° C.
    6. Mix 5 µL av "0,1 x" MNase og 145 µL fordøyelsen bufferen. Holde enzymet på is alle gangene. Legge til 5 µL av fortynnet MNase i fordøyelsen buffer per 1 x 106 celler. Sveip røret for å mikse og sett røret i 37 ° C blokk for akkurat 12 min. prosessen prøver en samtidig for å sikre en nøyaktig inkubasjon gang 12 min.
    7. Legge til 10 µL av 10 x MNase stoppe Buffer (110 mM Tris-HCl, pH 8.0, 55 mM EDTA) per 1 x 106 celler. Prøver må holdes på is fra dette punktet og fremover.
    8. Legge til 110 µL "2 x RIPA buffer" (280 mM NaCl, 1,8% polyetylenglykol octylphenyl Eter, 0,2% natrium dodecyl sulfate (SDS), 0,2% Na-deoxycholate, 5 mM etylenglykol-bis(β-aminoethyl ether)-N, N N', N'-tetraacetic syre (EGTA), lagret på 4 ° C) med protease hemmer cocktail i høy konsentrasjon (1: 100) per 1 x 106 celler. Sveip røret å blande.
    9. Sentrifuge rør i 15 min i en microfuge på 4 ° C og 1700 x g. overføre nedbryting til en ny vanlig 1,5 mL microcentrifuge rør (lav protein bindende microcentrifuge rør er ikke lenger nødvendig), og lagre dem på isen. Kast pellet.
  2. Immunoprecipitation (IP)
    1. Bland Protein A og Protein G magnetiske perler i en 1:1 ratio. For hver IP, forberede 25 µL av perler.
    2. Vask perler ved å legge til 1 mL av RIPA buffer (10 mM Tris pH 8.0, 1 mM EDTA, 140 mM NaCl, 1% polyetylenglykol octylphenyl Eter, 0,1% SDS, 0,1% Na-deoxycholate, lagret på 4 ° C) med proteasehemmere på lav konsentrasjon (1:1000).
    3. Bruk en magnet for å tillate perler å skille fra vask løsning og Dekanter vask løsningen (ca 1 min). Utfør vask trinn to ganger.
    4. Nytt suspendere perlene opprinnelige volumet med RIPA buffer med proteasehemmere (1:1000).
    5. Hvis nødvendig, fortynnet reservere chromatin bruker RIPA buffer supplert med proteasehemmere (1:1000) slik at hver IP har et volum av 100-200 µL. 10% av volumet brukes per IP av chromatin for innspill.
      Merk: For eksempel hvis 200 µL brukes per IP, 20 µL av fortynnet chromatin skal reserveres for innspill. Totalt fire IPs, bør totalt chromatin volumet fortynnes til 820 µL.
    6. Forberede input. Legg 100 µL av TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA) med proteinasen K (0,5 mg/mL) til inngangen og ruge input ved 55 ° C i 1 time.
      Merk: Trinn 2.2.6-2.2.7 kan utføres sammen med trinn 2.3.4 og 2.4.1.
    7. Rens input bruker en PCR rensing kit følger produsentens instruksjoner og elute i 50 µL elueringsrør bufferen i kit.
    8. Måle konsentrasjonen av inndata ved hjelp av et microvolume spektrofotometer og registrere resultatene i en notatblokk. Tomt med elueringsbufferen Kit.
      Merk: I musen neurospheres, vi brukte ca 6 µg DNA for hver IP.
    9. Kjør inn på en 1% gel eller laste 1 µL på en DNA-Bioanalyzer med standard innstillinger. Lagre resten for bruk som inndata i nedstrøms programmer.
    10. Legg til 10 µL vasket protein A & G magnetiske perler for hver IP og Inkuber IP 1t på 4 ° C.
      Merk: For eksempel legge 30 µL av protein A & G magnetiske perler for tre IPs.
    11. Plasser eksemplene på en magnet og la perler å skille. Dele chromatin overføre tidligere fastsatte beløpet i en ny 1,5 mL tube.
    12. Legg antistoffer og vikle caps med plast parafin film å unngå fordampning. Inkuber prøvene overnatting på 4 ° C med rotasjon på 20 rpm.
      Merk: Konsentrasjon bør fastsettes empirisk etter produsent anbefalinger.
    13. Neste dag, spin rør ved hjelp av en mini sentrifuge i romtemperatur, 2000 x g, for 10 s. Deretter legger 10 µL av perler til hver IP og ruge IP for 3t 4 ° c med rotasjon på 20 rpm.
  3. IP vasker og Protein fordøyelse
    1. Legge til 150 µL RIPA bufferen med proteasehemmere på lav konsentrasjon (1:1000) til hver IP og ruge IP på 4 ° C med rotasjon på 20 rpm for 5 min. sted prøven på en magnetisk stand og tillate de magnetiske perlene å skille. Bruk en Pipetter for å fjerne nedbryting. Gjenta denne tep fem vasker.
    2. Legge til 150 µL LiCl bufferen (250 mM LiCl, 10 mM Tris pH 8.0, 1 mM EDTA, 0,5% NP-40, 0,5% Na-deoxycholate, butikken på 4 ° C) supplert med proteasehemmere på lav konsentrasjon (1:1000) til hver IP og ruge IP på 4 ° C med rotasjon på 20 rpm for 5 min. sted prøven på en magnetisk stå og tillate magnetiske perler å skille. Bruk en Pipetter for å fjerne nedbryting.
    3. Legge til 150 µL av kaldt TE (ingen proteasehemmere) og ruge prøven på 4 ° C med rotasjon på 20 rpm for 5 min. sted prøven på en magnetisk stand og tillate magnetiske perler å skille. Bruk en Pipetter for å fjerne nedbryting.
    4. Etter siste vask trinn, å suspendere prøven i 100 µL TE-bufferen som er supplert med proteinasen K (0,5 mg/mL) og ruge prøven ved 55 ° C i 1 time.
  4. DNA rensing og ChIP kvantitative Real-Time PCR (qPCR)
    1. Rense immunoprecipitated bruker en PCR rensing kit. Etter tillegg av DNA bindende buffer fra kit hver prøve, sett røret på en magnet og vent til magnetiske perler samlet, deretter overføre nedbryting kolonnen opprydding. Følg instruksjonene fra produsenten og elute i 50 µL elueringsrør bufferen i kit.
    2. Hvis du vil kontrollere om IP er vellykket, kan du utføre en qPCR. Ideelt sett bør primere være utformet for positive og negative kontroll regioner.
      Merk: For eksempel for en IP utført med H3K4me3 og H3K27me3, følgende prøvene skal kjøres på qPCR: H3K4me3, H3K27me3 og IgG ChIP DNA, inndataverdier DNA og en ingen mal kontroll (NTC) bruker primere for områder å bli beriket med H3K4me3 (positiv kontroll) og regioner for å bli beriket med H3K4me3 (negativ kontroll); likeledes, for H3K27me3.
    3. Følg standardprotokoller for å utføre qPCR12. Kort, Utfør en qPCR SYBR grønne master mix, 0,5 µL av 10 µM arbeider konsentrasjonen av hver forover og bakover grunning og 2 µL av ChIP eller input DNA. Les plater med en sanntid PCR-system. Primer sekvenser er gitt i tabell 2. Gapdh primer sekvenser fra Hwang et al. ble brukt13.
    4. Analysere ChIP data i forhold til innspill, dvs. prosent input metoden (% IP)14. Beregne prosent med følgende formler:
      Justert input = betyr ct (inngang)-logge2(DF)
      hvor DF er fortynningsfaktoren av Start input og
      DF = totalt volum på IP / volumet av inndata
      % IP = 100 × 2 ^ (justert inndata - Ct (IP))
      hvor Ct er terskelen faktor.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

En skjematisk fremstilling av svulst NS generert fra en hjernesvulst hvor hjerne svulst cellene er Katushka positive vises i figur 1. Figur 2 er en skjematisk fremstilling av hele ChIP teknikken. Figur 3 viser representant resultatene av chromatin fra hjernesvulst NS fordøyd med MNase i 12 min, gir et flertall av mono, di- og tri-nucleosomes. Etter ChIP, en qPCR kan utføres på ChIP og input DNA prøver. Figur 4 viser representant ChIP qPCR data fra en qPCR for glyceraldehyde-3-fosfat dehydrogenase (Gapdh). Gapdh er en housekeeping genet som er beriket med H3K4me3, en endring som forbindes med aktiv transkripsjon. Resultatene viser at Gapdh er beriket med H3k4me3 og er ikke beriket med H3K27me3 som er en endring som er tilknyttet områder av fortrengte chromatin.

Figure 1
Figur 1: skjematisk svulst NS generert fra en Katushka positiv hjernesvulst. En lysende felt og fluorescerende bildet av en hjerne høstet fra en mus som nådde endepunktet scenen. Svulst området er preget av den stiplede linjen og er positivt for fluorescerende reporteren, Katushka. Svulsten er isolert og tumor vev er samlet i en 1,5 mL tube. Cellene deretter avstand og kultivert i NSC medium og tumor NS-skjemaet. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: en skjematisk fremstilling av arbeidsflyten for native ChIP. Svulst NS er kultivert og utvidet. Hver IP utføres med 1 X 106 celler. Chromatin er fragmentert ved hjelp av MNase fordøyelse hente mono, di- og tri-nucleosomes. Chromatin er ruges med et antistoff som er spesifikke for en histone endring eller DNA-assosiert protein av interesse. Antistoff-DNA komplekset er immunoprecipitated med magnetiske protein A/G perler. Endelig protein er fordøyd og DNA er renset for å få bare DNA beriket med histone endring eller DNA-assosiert protein av interesse. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: Chromatin fragmentering av MNase. Chromatin var forberedt fra hjernesvulst NS med tillegg MNase og inkubasjon på 37 ° C for akkurat 12 min. representant DNA resultatene fra Bioanalyzer analyse av en input prøve viser at flertallet av DNA har blitt fragmentert i mono - di- og tri- nucleosomes. Lane 1 er stigen i base parene (BP). Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: representant ChIP qPCR dataene presenteres som prosent. qPCR ble utført med IgG, H3K4me3 og H3K27me3 ChIP DNA bruker primere for glyceraldehyde-3-fosfat dehydrogenase (Gapdh). Representant resultater viser at Gapdh, en housekeeping genet, bare er beriket med H3K4me3 endring, forbundet med aktiv transkripsjon, og ikke H3K27me3 endring, forbundet med undertrykt chromatin. Denne grafen representerer resultatet av to biologiske eksperimenter med tre Repliker brønner hver. Feilfelt representerer standard feil av gjsnitt (SEM). Klikk her for å se en større versjon av dette tallet.

Gene Fremover primer Omvendt primer
Gapdh TCCCCTCCCCCTATCAGTTC GACCCGCCTCATTTTTGAAA

Tabell 1: Primere brukt for ChIP qPCR eksperimenter. Sekvenser for primere brukt for Gapdh er gitt i denne tabellen.

mener Ct (inngang) Standardavvik Justert Input
24.265 0.071 20.943
Prosent-inngang
Eksempel Rå betyr Ct Standardavvik Prosent input = 100 * 2 ^ (justert input-Ct(IP))
IgG 32.23 0.112 0,04
H3K4me3 22.148 0.128 43.37
H3k27me3 32.79 0.519 0,027
NTC Ukjent Ukjent Ukjent

Tabell 2: eksempel beregning av prosent inndatametode for ChIP qPCR analyse. Eksempel beregning av prosent inngang for ChIP utført med 10% fra input; DF = 10. Tallene i tabellen illustrerer rå verdiene av en biologisk eksperiment med 3 replikere brønner kjøre for hvert utvalg.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Protokollen presenteres her vil at brukeren skal kunne utføre native ChIP på NS avledet fra genmodifiserte hjernesvulster. I motsetning til cross-linking ChIP, er denne protokollen begrenset for studiet av proteiner som knytter tett med DNA6. Antall celler brukes kan endres etter behov, og protokollen kan besteget. Vi brukte 1 X 106 celler per IP, men opprinnelig ChIP kan også utføres med så lite som 4 x 104 celler5. I denne protokollen analyserte vi ChIP DNA via qPCR; men kan denne protokollen også kombineres med neste generasjons sekvensering å studere protein-DNA samhandlinger på et genom bredt nivå. Vi har brukt denne ChIP-protokollen er for å analysere effekten av glioma oncogenes på avsetning av histone modifikasjoner i bestemte regioner av tumor celler genomet.

Det er noen viktige trinn når du utfører innebygd ChIP. Først må fordøyelsen betingelsene for hver celle empirisk bestemmes. Fleste av chromatin skal mono-nucleosomes (150 bp) med noen di - og tri-nucleosome topper (Figur 3). Protokollen resultatene i mer enn 70% mono, di- eller tri-nucleosome topper, men noen ufordøyd DNA gjenstår. Hvis protokollen skal brukes for ChIP-seq, må forholdsregler fjerne ufordøyd DNA. I tillegg er det viktig å huske på at hvert sett med MNase kjøpt kan variere i aktivitet og krever derfor optimalisering av fordøyelsen. Andre avhenger kvaliteten på en ChIP sterkt spesifisitet av antistoffer brukes11. Et høykvalitets ChIP antistoff bør ha høy reaktivitet mot ment målet og lav kryssreaksjon med andre DNA-assosiert proteiner eller målet histone modifikasjoner11. Derfor anbefaler vi testing antistoff spesifisitet bruker en peptid bindende test. KODE retningslinjer foreslår at en ti-fold berikelse observeres for ombygging av interesse i forhold til andre endringer11. Det er også viktig å utføre nødvendig kontroll immunoprecipations, dvs., pre immun eller IgG kontroll. Når disse betraktningene er oppfylt, er innfødt ChIP-data en sterk pålitelig metode å studere epigenetic mekanismer regulert av protein-DNA interaksjoner.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgements

Dette arbeidet ble støttet av nasjonale institutter for helse/National Institute av nevrologiske lidelser og slag (NIH/NINDS) tilskudd R37-NS094804, R01-NS074387, R21-NS091555 å M.G.C.; NIH/NINDS gir R01-NS076991, R01-NS082311 og R01-NS096756 P.R.L.; NIH/NINDS R01-EB022563; Department of Neurosurgery; Leah Happy Hearts og Chad om grunnlaget for M.G.C. og P.R.L. RNA biomedisin Grant F046166 å M.G.C. F.M.M. støttes av en F31 NIH/NINDS-F31NS103500. R.I.Z.-V. støttes av NIH NIGMS støtte 5T34GM007821-37.

Materials

Name Company Catalog Number Comments
Agilent 2100 Bioanalyzer Agilent G2946-90004 bioanalyzer
AccuSpin Micro 17R, refrigerated Fisher Scientific 13-100-676
C57BL/6 Taconic B6-f C57BL/6 mouse
Calcium Chloride Aldrich 22350-6 buffer reagent
D-Luciferin, Potassium Salt Goldbio LuckK-1g
DiaMag1.5 magnetic rack Diagenode B04000003 for magnetic bead washes
DiaMag Rotator EU Diagenode B05000001 rotator
DMEM/F-12 Gibco 11330-057 NSC component
Dynabeads Protein A Thermo Fisher Scientific 10001D protein A magnetic beads
Dynabeads Protein G Thermo Fisher Scientific 10003D protein G magnetic beads
EGF PeproTech AF-100-15 prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Ethylenediaminetetraacetic acid (EDTA) Sigma E-4884 buffer reagent
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) (EGTA) Sigma E-4378 buffer reagent
Fast SYBR Green Master Mix Applied Biosystems 4385612 qPCR reagent
Fetal Bovine Serum Gibco 10437028 for freezing cells
FGF PeproTech 100-18b Prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Forceps Fine Science Tools 11008-13 for dissection of tumor
Glycerol, MB Grade EMD- Millipore 356352
H3K4me3 Abcam Ab8580
H3K27me3 Millipore 07-449
HBSS Gibco 14175-103 balanced salt solution
Fluriso VETone 501017 inhalation anesthetic
Ivis Spectrum Perkin-Elmer 124262 in vivo optical imaging system
Hyqtase HyClon SV3003001 cell detachment media
Lithium Chloride Sigma L8895 buffer reagent
Low binding microtubes Corning Costar CLS3207 low protein binding microcentrifuge tube
Microcentrifuge tube Fisher 21-402-903 regular microcentrifuge tube
Micrococcal Nuclease Thermo Fisher Scientific, Affymetrix 70196Y each batch may differ; purchase sufficient amount for experiments and aliquot.
N2 Gibco 17502-048 NSC component
Normal Rabbit IgG Millipore 12-372
Normocin Invivogen NOL-36-063 anti-microbial agent, use at 0.1 mg/mL.
NP-40 (Igepal CA-630) Sigma 18896-50ML buffer reagent
Kimble Kontes Pellet Pestle Fisher Scientific K749515-0000
Protease Inhibitor Cocktail Sigma-Aldrich P8340 aliquot and store at -20 °C.
Protinase K Sigma-Aldrich P2308 make 10 mg/mL stock in water; aliquot and store at -20 °C.
QIAquick PCR Purification Kit Qiagen 28104 DNA purification kit
Scalpel Fine Science Tools 10007-16 for dissection of tumor
Sodium Chloride VWR 0241-5KG buffer reagent
Sodium Deoxycholate Sigma-Aldrich D670-25G buffer reagent
Sodium Dodecyl sulfate (SDS) Sigma L-4390 buffer reagent
Tris Base Thermo Fisher Scientific Bp152-1 buffer reagent
Triton X-100 Thermo Fisher Scientific BP 151-500 polyethylene glycol octylphenyl ether
Standard Mini Centrifuge Fisherbrand 12-006-901 standard mini centrifuge
SZX16 microscope Olympus SZX16 flourescent dissecting microscope
ViiA 7 Real-Time PCR System with Fast 96-Well Block Applied Biosystems 4453535
Nanodrop One Thermo-Fisher Scientific ND-ONEC-W

DOWNLOAD MATERIALS LIST

References

  1. Schwartzentruber, J., et al. Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature. 482, (7384), 226-231 (2012).
  2. Bjerke, L., et al. Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN. Cancer Discov. 3, (5), 512-519 (2013).
  3. Bender, S., et al. Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell. 24, (5), 660-672 (2013).
  4. Maleszewska, M., Kaminska, B. Is glioblastoma an epigenetic malignancy? Cancers (Basel). 5, (3), 1120-1139 (2013).
  5. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  6. Thorne, A. W., Myers, F. A., Hebbes, T. R. Native chromatin immunoprecipitation. Methods Mol Biol. 287, 21-44 (2004).
  7. Turner, B. Mapping Protein/DNA Interactions by Cross-Linking. (2001).
  8. Tseng, Z., Wu, T., Liu, Y., Zhong, M., Xiao, A. Using native chromatin immunoprecipitation to interrogate histone variant protein deposition in embryonic stem cells. Methods Mol Biol. 1176, 11-22 (2014).
  9. Calinescu, A. A., et al. Transposon mediumted integration of plasmid DNA into the subventricular zone of neonatal mice to generate novel models of glioblastoma. J Vis Exp. (96), (2015).
  10. Sambrook, J., Russell, D. W. Estimation of cell number by hemocytometry counting. CSH Protoc. 2006, (1), (2006).
  11. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  12. Kubista, M., et al. The real-time polymerase chain reaction. Mol Aspects Med. 27, (2-3), 95-125 (2006).
  13. Hwang, W. W., et al. Distinct and separable roles for EZH2 in neurogenic astroglia. Elife. 3, e02439 (2014).
  14. Haring, M., et al. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods. 3, 11 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics