Native chromatine Immunoprecipitation met behulp van lymfkliertest Brain Tumor Neurospheres

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Epigenetische mechanismen worden regelmatig gewijzigd in glioma. Chromatine immunoprecipitation kan worden gebruikt om de gevolgen van genetische wijzigingen in glioma die voortvloeien uit wijzigingen in histone modificaties tot regeling van de chromatine structuur en gene transcriptie. Dit protocol beschrijft een native chromatine immunoprecipitation op lymfkliertest hersenen tumor neurospheres.

Cite this Article

Copy Citation | Download Citations

Mendez, F. M., Núñez, F. J., Zorrilla-Veloz, R. I., Lowenstein, P. R., Castro, M. G. Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres. J. Vis. Exp. (131), e57016, doi:10.3791/57016 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Epigenetische aanpassingen kunnen worden betrokken bij de ontwikkeling en de progressie van glioma. Wijzigingen in methylation en acetylation voor initiatiefnemers en regelgevende gebieden oncogenen en tumor suppressors kunnen leiden tot wijzigingen in genexpressie en spelen een belangrijke rol in de pathogenese van hersentumoren. Native chromatine immunoprecipitation (ChIP) is een populaire techniek waarmee de opsporing van wijzigingen of andere eiwitten strak gebonden aan DNA. In tegenstelling tot de kruiselings gekoppelde ChIP, in native-ChIP, worden de cellen niet behandeld met formaldehyde covalent eiwit te koppelen aan DNA. Dit is voordelig omdat soms crosslinking eiwitten die alleen Transient interactie met DNA en hebben geen functionele betekenis in genregulatie kan oplossen. Bovendien zijn antilichamen over het algemeen ingebracht nietgefixeerde peptiden. Daarom is antilichamenspecificiteit verhoogd in native ChIP. Het is echter belangrijk om in gedachten houden dat inheemse ChIP alleen geldt voor het bestuderen van histones of andere eiwitten die strak aan het DNA binden. Dit protocol beschrijft de inheemse chromatine immunoprecipitation op lymfkliertest hersenen tumor neurospheres.

Introduction

Epigenetische gebeurtenissen zijn frequent in de gliomen en waarschijnlijk een belangrijke rol spelen in de pathogenese van de tumor. Inderdaad, in pediatrische hoogwaardige glioma, mutaties in de genen coderend voor Histon varianten H3.3 en H3.1 komen vaak voor1. De mutaties beïnvloeden histone modificaties en hebben grote gevolgen epigenetische hebben2,3. In de adolescente tot volwassen spectrum optreden periodieke mutaties in isocitrate dehydrogenase gen 1/2 (IDH1/2), een mutatie die α-KG afhankelijk histone en DNA de-methylasaes remt, en genetische wijzigingen in andere regelgevers van de chromatine zoals ATRX en DAXX 4. Daarom is het van cruciaal belang om te bestuderen hoe mutaties die invloed hebben op de regelgevers van de epigenetische structuur van de chromatine en regelgevende histone modificaties, die op hun beurt een dramatische impact van de tumorcellen transcriptome hebben veranderen.

Chromatine immunoprecipitation (ChIP) is een krachtig hulpmiddel gebruikt voor het evalueren van het effect van de epigenetische aanpassingen in de genoom5,6,7. In native-ChIP, chromatine wordt verteerd met micrococcal nuclease (MNase), immunoprecipitated met behulp van een antilichaam tegen het eiwit van belang, aan de orde gesteld en vervolgens DNA wordt gezuiverd van de immunoprecipitated chromatine complexe6. Cellen zijn niet tijdens de procedure vast zodat deze techniek is alleen van toepassing voor de studie van eiwitten die nauw met DNA6 samenwerken. Het ontbreken van de cross-linking helpt antilichamenspecificiteit aangezien antilichamen zijn gewoonlijk verhoogd tegen nietgefixeerde peptiden of eiwitten7. Bovendien, aangezien er geen cross-linking stap, vermindert dit de kans op vaststelling van voorbijgaande eiwit-DNA interacties die aspecifieke en niet regelgevende7,8. ChIP kan worden gebruikt voor identificatie van de verrijking van Histon modificaties in een specifiek gebied van het genoom. Hier, detail we een protocol voor het uitvoeren van inheemse ChIP in neurospheres (NS) gegenereerd op basis van genetisch gemanipuleerde Muismodellen van glioma.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle methoden die hier worden beschreven zijn goedgekeurd door de institutionele Animal Care en gebruik Comité (IACUC) van de Universiteit van Michigan.

1. generatie van hersentumor NS en voorwaarden te kweken.

  1. Neurale stamcellen Medium (NSC) met Dulbecco van bewerkt Eagle Medium/F12B27 toeslag (1 x), N2 toeslag (1 x), en een antimicrobiële reagens te bereiden. NSC medium een aanvulling vormen op de dag van gebruik met menselijke recombinante endothelial groei factor (EGF) en basic-fibroblast groeifactor (FGF) op een eindconcentratie van 20 ng/mL elke.
  2. De hersentumor in muis met behulp van de schone slaapster transposon systeem waarin plasmiden codering oncogenen of shRNA gericht op tumor suppressors wordt geïnjecteerd in de laterale ventrikels van pasgeborenen voor het genereren van spontane hersenen tumoren9induceren. Selecteer een muis met een grote tumor, die wordt bevestigd met bioluminescentie beeldvorming.
    Opmerking: Meer gedetailleerde informatie over de Sleeping Beauty Transposon systeem en plasmide constructies die gebruikt kan worden gevonden in Calinescu et al. 9.
    1. Naar het image van de muizen, injecteren 100 µL van 30 mg/mL luciferine oplossing intraperitoneally met behulp van een naald van 26 meter.
    2. 5 min na injectie van luciferine, anesthetize het dier een verdoving kamer met zuurstof/Isofluraan stroom ingesteld op 2% Isofluraan.
    3. Wanneer de dieren zijn verdoofd (meestal 2-3 min), plaats van de dieren in de Bioluminescentie zaal met zuurstof Isofluraan ingesteld op 2% Isofluraan. Als de dieren onder verdoving langer dan 5 min, gebruik maken van een oogheelkundige zalf om te voorkomen dat droogte terwijl onder verdoving.
    4. Afbeelding van de muizen met behulp van een in vivo optisch imaging systeem met de volgende parameters: automatische belichting, grote weggooien en diafragma f = 1. De parameter om het te overwegen een grote tumor is een bioluminescentie > 106 fotonen/s/cm2/sr.
  3. Euthanaseren van de muis met een overdosis van Isofluraan inademing verdoving in een gesloten kamer, Controleer door teen snuifje dat het dier wordt verdoofd, en het onthoofden van de muis.
  4. Extract van de hersenen en het ontleden, zoals eerder is beschreven in Calinescu et al. 9.
  5. Plaats de hersenen in een 10 cm petrischaal. Als de tumor-geïnduceerde spreekt een fluorescente proteïne, gebruik een TL ontrafeling van Microscoop ingesteld op het juiste TL kanaal en 0.3 X vergroting, anders identificeren tumor massa door de verschillen in weefsel kleur en textuur. Gebruik de scalpel en pincet te scheiden van de tumor weefsel van de normale hersenen.
  6. Mince de tumor in kleine stukjes in de petrischaal. Plaats de ontleed tumor in een 1,5 mL tube met 300 µL van het NSC-medium.
  7. Gebruik een wegwerp plastic pellet stamper die bij de muren van een conische microcentrifuge buis past te voorzichtig het homogeniseren van de tumor. Voeg 1 mL van cel detachement medium toe en Incubeer het monster gedurende 5 minuten bij 37 ° C.
    Opmerking: Het gebruik van een stamper kan sommige cellen doden. Als de lezer wil maximaliseren van de levensvatbaarheid van de cellen, kan het gebruik van een stamper achterwege blijven.
  8. Passeren van de celsuspensie van stap 1.7 door een 70 µm cel zeef en wassen van de zeef met 25 mL van NSC medium.
  9. Centrifugeer de schorsing bij 300 x g gedurende 5 minuten bij kamertemperatuur, decanteren het supernatant en resuspendeer de pellet in 6 mL van NSC medium.
  10. Plaat van de tumor celsuspensie uit stap 1.9 in een maatkolf van T-25 cultuur en cultuur het bij 37 ° C in een broedstoof weefselkweek met een sfeer van 95% lucht en 5% CO2. Meestal na 3 dagen, zal er een mengsel van sommige dode cellen, zelfklevend cellen en sommige cellen vormen van NS die in het medium zweven.
  11. De celsuspensie Breng in een conische tube van 15 mL, verzamelen alleen de cellen bevat die zinken naar de bodem met behulp van een micropipet en hen opnieuw plaat op een T-75 weefselkweek kolf.
  12. Het handhaven van de cellen bij relatief hoge dichtheid (1-3 X 106 cellen in een T-25). Passage van de cellen die confluente.
    Opmerking: Confluentie wordt bepaald door de grootte van de bollen. Zwarte centra van grote bollen betekenen dat er zijn dode cellen in het midden en aan te geven dat de cellen onmiddellijk moeten worden gepasseerd.
  13. Toevoegen van de groeifactoren (EGF en basic-FGF; 20 ng/mL elk) elke drie dagen. Het medium wijzigen wanneer de cellen niet heuvels en de middellange draait licht oranje.
  14. Als u wilt wijzigen het medium, verzamelen de oud medium en Centrifugeer het bij 300 x g bij kamertemperatuur gedurende 5 minuten en resuspendeer de pellet cel in NSC medium aangevuld met EGF en FGF op de concentratie in stap 1.1 hebt opgegeven.
    Opmerking: Als de bollen staan midden-tot hoge confluentie, maar niet klaar om te worden gepasseerd (bol grootte is klein met een diameter van < 100 µm), dan de pellet kan worden gesplitst in twee maatkolven.
  15. Om de passage van de cellen, centrifugeren van de cellen bij 300 x g gedurende 5 minuten bij kamertemperatuur, de bovendrijvende vloeistof decanteren en Incubeer de cellen in cel detachement medium voor 5 minuten bij 37 ° C.
    1. Voeg 5 mL van evenwichtige zout oplossing verdund detachement medium samen en Centrifugeer het bij 300 x g gedurende 5 minuten bij kamertemperatuur.
    2. De bovendrijvende vloeistof decanteren, resuspendeer de pellet cel in 18 mL van NSC medium en de schorsing gelijkelijk verdelen in drie T-25 kolven.
  16. Als u wilt blokkeren de aliquots van cellen, distantiëren van de cellen zoals in stap 1.15 en bevriezen van de cellen in 1 mL aliquots van 90% foetale runderserum met 10% dimethylsulfoxide. Langzaam afkoelen van de cellen door het plaatsen van de cellen op het ijs gedurende 10 minuten, dan houden van de cellen-20 ° C gedurende 30 minuten, en -80 ° C voor 1 dag. De volgende dag, worden de cellen overbrengen in een opslagcontainer vloeibare stikstof.

2. eigen ChIP

  1. Chromatine voorbereiding
    1. Cultuur na het maken van voorraad van afgeleide NS, NS in een T-75 in 15 mL van NSC medium bij 37 ° C in een broedstoof weefselkweek met een sfeer van 95% lucht en 5% CO2 totdat NS confluente geworden. Één confluente T-75 plaat zal 3-5 X 106 cellen opleveren.
    2. Wanneer de cellen confluente worden, NS Centrifugeer bij 300 x g gedurende 5 min, giet het supernatant en voeg 1 mL van cel dissociatie medium. Incubeer de cellen bij 37 ° C gedurende 5 min. Voeg 5 mL van medium en de cellen met behulp van een hemocytometer10tellen.
      Opmerking: 1 x 106 cellen zijn per immunoprecipitation (IP) reactie nodig. Let erop dat een vooraf immuun serum of IgG besturingselement ook opgenomen11moet zijn.
    3. Centrifugeer de NS in een tube van de microcentrifuge van de 1,5 mL bij 300 x g gedurende 5 min, giet het supernatant en resuspendeer de pellet van de NS met 1 mL van evenwichtige zoutoplossing en spoel de suspensie laag eiwitgehalte bindende 1,5 mL microcentrifuge buizen.
    4. Centrifuge NS bij 300 x g voor 5 min, giet het supernatant en resuspendeer de pellet cel in 95 µL van spijsvertering buffer (50 mM Tris-HCl, pH 8,0, 1 mM CaCl2, 0,2% polyethyleenglycol octylphenyl ether) per 1 x 106 cellen aangevuld met protease remmer cocktail in een hoge concentratie (1:100). Onmiddellijk Pipetteer de cellen op en neer ter voorkoming van samendoen en voorkomen dat er bubbels.
    5. Resuspendeer MNase in 50% glycerol te maken van 1 mg/mL oplossing (1,15 eenheden/µL, opgeslagen bij-20 ° C), die zal worden verwezen als "1 x" voorraad. Maak een "0.1 x" voorraad verwerkingsopties in op een tweede 1:9-verdunning met 50% glycerol (bv., 900 µL van "1 x" MNase en 100 µL 50% glycerol) en opslaan bij-20 ° C.
    6. Meng 5 µL van "0.1 x" MNase en 145 µL van spijsvertering buffer. Houd het enzym op ijs al the times. Voeg 5 µL van verdunde MNase in spijsvertering buffer per 1 x 106 cellen. Flick de buis te mengen en de buis in 37 ° C blok voor precies 12 min. proces de monsters één tegelijk om een nauwkeurige incubatietijd van 12 min.
    7. Voeg 10 µL van 10 x MNase stoppen Buffer (110 mM Tris-HCl, pH 8.0, 55 mM EDTA) per 1 x 106 cellen. Monsters moeten worden bewaard op ijs vanaf dit moment.
    8. Voeg 110 µL "2 x RIPA buffer" (280 mM NaCl, 1,8% polyethyleenglycol octylphenyl ether 0,2% natrium dodecyl sulfaat (SDS), 0,2% Na-deoxycholate, 5 mM ethyleen glycol-bis(β-aminoethyl ether)-N, N, N', N'-Dinatriumethyleendiaminetetra-azijnzuuroplossing (EGTA); opgeslagen bij 4 ° C) aangevuld met proteaseinhibitor cocktail in hoge concentraties (1:100) per 1 x 106 cellen. Flick de buis te mengen.
    9. Centrifugeer de buizen gedurende 15 min. in een microfuge bij 4 ° C en 1700 x g. het supernatant overbrengen in een nieuwe reguliere 1,5 mL microcentrifuge buizen (laag eiwitgehalte bindende microcentrifuge buizen zijn niet meer nodig) en bewaar ze op ijs. Gooi de pellet.
  2. Immunoprecipitation (IP)
    1. Meng EiwitA en eiwit G magnetische kralen in een 1:1 verhouding. Voor elke IP, 25 µL van parels te bereiden.
    2. Wassen van de kralen door toevoeging van 1 mL van de buffer RIPA (10 mM Tris pH 8,0, 1 mM EDTA, 140 mM NaCl, 1% polyethyleenglycol octylphenyl ether, 0,1% SDS, 0,1% nb-deoxycholate; opgeslagen bij 4 ° C) aangevuld met proteaseinhibitors bij lage concentratie (1:1000).
    3. Gebruik een magneet om parels te scheiden van de oplossing van het wassen en decanteren van de Supermarket-oplossing (ongeveer 1 minuut). De wassen stap tweemaal uitvoeren.
    4. Resuspendeer de kralen op het oorspronkelijke volume met behulp van de buffer RIPA aangevuld met proteaseinhibitors (1:1000).
    5. Indien nodig, verdunde Reserve de chromatine met behulp van de buffer RIPA aangevuld met proteaseinhibitors (1:1000), zodat elk IP een volume van 100-200 heeft µL. 10% van het volume per IP-adres van de chromatine gebruikt voor de input.
      Opmerking: bijvoorbeeld als 200 µL worden gebruikt per IP, 20 µL van de verdunde chromatine moeten worden gereserveerd voor de input. Voor een totaal van vier IPs, moet totale chromatine volume worden verdund tot 820 µL.
    6. De ingang voor te bereiden. Voeg 100 µL van TE buffer (10 mM Tris-HCl pH 8,0, 1 mM EDTA) aangevuld met proteïnase K (0,5 mg/mL) aan op de ingang en de input bij 55 ° C gedurende 1 uur uit te broeden.
      Opmerking: De stappen 2.2.6-2.2.7 kan worden uitgevoerd samen met stappen 2.3.4 en 2.4.1.
    7. Zuiveren van de invoer met behulp van een PCR zuivering kit na instructies van de fabrikant en elueer in 50 µL van elutie buffer geleverd in kit.
    8. De concentratie van de invoer met behulp van een microvolume spectrofotometer meten en de resultaten daarvan vastleggen in een notitieblok. Lege met elutie buffer van kit.
      Opmerking: In de muis neurospheres gebruikten we ongeveer 6 µg van DNA voor elk IP.
    9. Input uitvoeren op een 1% gel of laden 1 µL op een DNA-Bioanalyzer met behulp van de standaard instellingen. Bewaar de rest voor gebruik als input in downstream toepassingen.
    10. Voeg 10 µL van gewassen EiwitA & G magnetische kralen voor elke IP en IP Incubeer gedurende 1 uur bij 4 ° C.
      Opmerking: Voeg bijvoorbeeld 30 µL van EiwitA & G magnetische kralen voor drie IP-adressen.
    11. Leg de monsters op een magneet en laat kralen om te scheiden. Verdeel de chromatine door het vooraf bepaalde bedrag over te brengen in een nieuwe 1,5 mL-buis.
    12. Toevoegen van het antilichaam en wikkel de doppen met kunststof paraffine film om verdamping. Incubeer de monsters 's nachts bij 4 ° C met rotatie bij 20 omwentelingen per minuut.
      Opmerking: Concentratie moet worden bepaald empirisch na aanbevelingen van de fabrikant.
    13. De volgende dag, draaien de buizen met behulp van een mini centrifuge bij kamertemperatuur, 2000 x g, voor 10 s. Dan 10 µL van kralen toevoegen aan elk IP en IP Incubeer gedurende 3 uur bij 4 ° C met rotatie bij 20 omwentelingen per minuut.
  3. IP-wast en vertering van de eiwitten
    1. Voeg 150 µL van RIPA buffer aangevuld met proteaseinhibitors bij lage concentratie (1:1000) naar elk IP en incubeer IP bij 4 ° C met rotatie bij 20 omwentelingen per minuut gedurende 5 minuten plaats het monster op een magnetische standaard en laat van de magnetische kralen om te scheiden. Gebruik een pipet wilt verwijderen van de bovendrijvende substantie. Herhaal dit vijf tep-wast.
    2. Voeg 150 µL van LiCl buffer (250 mM LiCl, 10 mM Tris pH 8,0, 1 mM EDTA, 0,5% NP-40, 0,5% NB-deoxycholate; bewaren bij 4 ° C) aangevuld met proteaseinhibitors bij lage concentratie (1:1000) naar elk IP en IP Incubeer bij 4 ° C met rotatie bij 20 omwentelingen per minuut gedurende 5 minuten plaats het monster op een magnetische staan en toestaan van magnetische kralen om te scheiden. Gebruik een pipet wilt verwijderen van de bovendrijvende substantie.
    3. Voeg 150 µL van koude TE (geen proteaseinhibitors) en Incubeer het monster bij 4 ° C met rotatie bij 20 omwentelingen per minuut gedurende 5 minuten plaats het monster op een magnetische standaard en laat van magnetische kralen om te scheiden. Gebruik een pipet wilt verwijderen van de bovendrijvende substantie.
    4. Na de definitieve wassen stap, resuspendeer de steekproef in 100 µL TE buffer aangevuld met proteïnase K (0,5 mg/mL) en Incubeer het monster bij 55 ° C gedurende 1 uur.
  4. DNA zuivering en ChIP kwantitatieve Real-Time PCR (qPCR)
    1. Zuiveren van immunoprecipitated DNA met behulp van een PCR zuivering kit. Na toevoeging van DNA-bindende buffer uit de kit aan elk monster, plaats de buis op een magneet en wacht totdat het supernatant magnetische kralen statistische, vervolgens overbrengen naar de kolom opruimen. Volg de instructies van de fabrikant en elueer in 50 µL van elutie buffer geleverd in kit.
    2. Om te controleren als het IP succesvol is, een qPCR uit te voeren. Idealiter moeten de inleidingen voor positieve en negatieve controle regio's worden ontworpen.
      Opmerking: bijvoorbeeld, voor een IP uitgevoerd met H3K4me3 en H3K27me3, de volgende monsters moeten worden uitgevoerd op qPCR: H3K4me3, H3K27me3 en IgG ChIP DNA, invoerwaarden DNA en een sjabloon oncontroleerbaar (NTC) gebruikend inleidingen voor regio's worden verrijkt met H3K4me3 (positieve controle) en regio's worden verrijkt met H3K4me3 (negatieve controle); ook voor H3K27me3.
    3. Volg standaardprotocollen voor het uitvoeren van qPCR12. Kortom, een qPCR met SYBR groen master mix, 0,5 µL van 10 µM werken concentratie van elke voorwaartse en omgekeerde primer en 2 µL van ChIP of input DNA uitvoeren Lees platen met behulp van een Real Time PCR-systeem. Primer sequenties zijn opgenomen in tabel 2. De Gapdh primer sequenties van twee exemplaren Hwang et al. gebruikte13waren.
    4. ChIP gegevens analyseren ten opzichte van de invoer, dat wil zeggen, procent input methode (% IP)14. Bereken het percentage invoeren met behulp van de volgende formules:
      Aangepast input = gemiddelde ct (input)-log2(DF)
      waar DF is de verdunningsfactor van de startende input en
      DF = totaalvolume van IP / volume van input
      % IP = 100 × 2 ^ (aangepast input - Ct (IP))
      Ct is waar de drempel-factor.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Een schematische weergave van NS gegenereerd op basis van een hersentumor waar de tumor hersencellen Katushka positieve zijn tumor wordt gepresenteerd in Figuur 1. Figuur 2 is een schematische weergave van de hele techniek van de ChIP. Figuur 3 toont de representatieve resultaten van de chromatine van hersentumor NS verteerd met MNase voor 12 min, opbrengst van een meerderheid van mono, di- en tri-nucleosomes. Na ChIP, een qPCR kan worden uitgevoerd op de ChIP en input van DNA monsters. Figuur 4 vertegenwoordiger ChIP qPCR worden gegevens weergegeven uit een qPCR voor glyceraldehyde-3-fosfaat dehydrogenase (Gapdh). Gapdh is een gen van de huishouding die is verrijkt met H3K4me3, een wijziging die is gekoppeld aan de actieve transcriptie. De resultaten tonen aan dat Gapdh is verrijkt met H3k4me3 en worden niet verrijkt met H3K27me3 die een wijziging die is gekoppeld aan de regio's van de onderdrukte chromatine is.

Figure 1
Figuur 1: schematische van tumor NS gegenereerd op basis van een positieve hersentumor Katushka. Een heldere veld en fluorescerende beeld van een hersenen geoogst van een muis die het eindpunt stadium bereikt. Het gebied van de tumor is afgebakend door de stippellijn en is positief voor de fluorescerende reporter, Katushka. De tumor is dan geïsoleerd en de tumor weefsel wordt verzameld in een 1,5 mL-buis. De cellen zijn dan losgekoppeld en gekweekt in NSC medium en tumor NS vorm. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: een schematische voorstelling van de workflow voor inheemse ChIP. Tumor NS zijn gekweekt en uitgebreid. Elk IP wordt uitgevoerd met 1 X 106 cellen. Chromatine is gefragmenteerd gebruik door MNase spijsvertering om te verkrijgen mono, di- en tri-nucleosomes. De chromatine is geïncubeerd met een antilichaam specifiek voor een Histon wijziging of DNA-geassocieerde proteïne van belang. De antilichaam-DNA-complex is immunoprecipitated met magnetische eiwit A/G kralen. Ten slotte, eiwit wordt verteerd en DNA wordt gezuiverd om te verkrijgen alleen DNA verrijkt met Histon wijziging of DNA-geassocieerde proteïne van belang. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: chromatine fragmentatie door MNase. Chromatine opgesteld van hersentumor NS door de toevoeging MNase en incubatie bij 37 ° C voor precies 12 min. representatieve DNA resultaten uit Bioanalyzer analyse van een monster input tonen aan dat de meerderheid van het DNA heeft is versnipperd in mono-, di- en tri- nucleosomes. Lane 1 is de ladder in basenparen (BP). Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: vertegenwoordiger ChIP qPCR gegevens gepresenteerd als percentage input. qPCR werd uitgevoerd met IgG, H3K4me3 en H3K27me3 ChIP DNA gebruikend inleidingen voor glyceraldehyde-3-fosfaat dehydrogenase (Gapdh). Representatieve resultaten tonen aan dat Gapdh, een huishouden gen, alleen is verrijkt met de wijziging van de H3K4me3, die is gekoppeld aan de actieve transcriptie, en niet de H3K27me3 wijziging, onderdrukte chromatine is gekoppeld. De grafiek hieronder geeft de resultaten van twee biologische experimenten uitgevoerd met drie repliceren putten elke. Foutbalken vertegenwoordigen de standaardfout van het gemiddelde (SEM). Klik hier voor een grotere versie van dit cijfer.

Gen Voorwaartse primer Omgekeerde primer
Gapdh TCCCCTCCCCCTATCAGTTC GACCCGCCTCATTTTTGAAA

Tabel 1: Primers gebruikt voor ChIP qPCR experimenten. De reeksen inleidingen gebruikt voor Gapdh vindt u in deze tabel.

gemiddelde Ct (input) Standaarddeviatie Aangepaste Input
24.265 0.071 20.943
Percentage van de input
Monster Ruwe gemiddelde Ct Standaarddeviatie Percentage input = 100 * 2 ^ (aangepast input-Ct(IP))
IgG 32.23 0.112 0.04
H3K4me3 22.148 0.128 43.37
H3k27me3 32.79 0.519 0.027
NTC onbepaald onbepaald onbepaald

Tabel 2: voorbeeld berekening van het percentage tekstinvoermethode voor ChIP qPCR analyse. Voorbeeld berekening van procent ingang voor ChIP uitgevoerd met 10% met ingang van invoer; DF = 10. De getallen in deze tabel illustreren de ruwe waarden van een biologische experiment met 3 repliceren wells voor elk monster lopen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Het hier gepresenteerde protocol kan de gebruiker voor het uitvoeren van de native ChIP op NS afgeleid van genetisch gemanipuleerde hersentumoren. In tegenstelling tot dwarsbinding ChIP, is dit protocol beperkt voor de studie van eiwitten waarmee strak gekoppeld aan DNA-6. Het aantal cellen die worden gebruikt als noodzakelijk kan worden gewijzigd en het protocol kan worden opgeschaald. We gebruikten 1 X 106 cellen per IP, inheemse ChIP kan echter ook worden uitgevoerd met zo weinig als 4 x 104 cellen5. In dit protocol geanalyseerd wij ChIP DNA via qPCR; Dit protocol kan echter ook worden gecombineerd met de volgende generatie sequencing aan studie eiwit-DNA interacties op een breed niveau van genoom. We hebben dit ChIP protocol met succes gebruikt om te analyseren het effect van glioma oncogenen op de afzetting van Histon modificaties binnen bepaalde regio's van de tumor cellen genoom.

Er zijn een paar kritische stappen bij het uitvoeren van de native ChIP. Ten eerste moeten de spijsvertering voorwaarden voor elk celtype empirisch worden bepaald. De meerderheid van de chromatine moet mono-nucleosomes (150 bp) met sommige di - en tri-nucleosoom pieken (Figuur 3). De resultaten van onze protocol in meer dan 70% mono-, di-, tri-nucleosoom pieken, echter sommige onverteerd DNA blijft. Als het protocol zal worden gebruikt voor ChIP-seq, zal extra stappen moeten verwijderen van onverteerd DNA. Daarnaast is het belangrijk om te houden in het achterhoofd dat elke batch van MNase gekocht kan in activiteit verschillen en dus optimalisatie van de voorwaarden van de spijsvertering vereisen. Ten tweede, de kwaliteit van een ChIP hangt zeer de specificiteit van het antilichaam gebruikt11. Een kwalitatief hoogwaardige ChIP antilichaam moet hoge reactiviteit tegen het beoogde doel en lage kruis-reactiviteit met andere DNA-geassocieerde eiwitten of uitschakelen doel histone modificaties11. Om deze reden is het raadzaam de testen antilichamenspecificiteit met behulp van een peptide bindende test. ENCODE richtsnoeren suggereren dat een tienvoudige verrijking voor de wijziging van belang ten opzichte van andere wijzigingen11moet worden nageleefd. Het is ook cruciaal voor het uitvoeren van de nodige regulerende immunoprecipations, dat wil zeggen, pre immuun of IgG controle. Wanneer deze overwegingen wordt voldaan, is eigen ChIP gegevens een sterke en betrouwbare methode om te studeren Epigenetische mechanismen geregeld eiwit-DNA interacties.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgements

Dit werk werd gesteund door de nationale instituten van gezondheid/National Institute of Neurological Disorders & beroerte (NIH/NINDS) subsidies R37-NS094804, R01-NS074387, R21-NS091555 naar M.G.C.; NIH/NINDS verleent R01-NS076991, R01-NS082311 en R01-NS096756 P.R.L.; NIH/NINDS R01-EB022563; de Afdeling Neurochirurgie; Leahs Happy Hearts, en Tsjaad hoewel Stichting M.G.C. en P.R.L. RNA biogeneeskunde Grant F046166 aan M.G.C. F.M.M. wordt ondersteund door een F31 NIH/NINDS-F31NS103500. R.I.Z.-V. wordt ondersteund door de NIH / NIGMS verlenen 5T34GM007821-37.

Materials

Name Company Catalog Number Comments
Agilent 2100 Bioanalyzer Agilent G2946-90004 bioanalyzer
AccuSpin Micro 17R, refrigerated Fisher Scientific 13-100-676
C57BL/6 Taconic B6-f C57BL/6 mouse
Calcium Chloride Aldrich 22350-6 buffer reagent
D-Luciferin, Potassium Salt Goldbio LuckK-1g
DiaMag1.5 magnetic rack Diagenode B04000003 for magnetic bead washes
DiaMag Rotator EU Diagenode B05000001 rotator
DMEM/F-12 Gibco 11330-057 NSC component
Dynabeads Protein A Thermo Fisher Scientific 10001D protein A magnetic beads
Dynabeads Protein G Thermo Fisher Scientific 10003D protein G magnetic beads
EGF PeproTech AF-100-15 prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Ethylenediaminetetraacetic acid (EDTA) Sigma E-4884 buffer reagent
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) (EGTA) Sigma E-4378 buffer reagent
Fast SYBR Green Master Mix Applied Biosystems 4385612 qPCR reagent
Fetal Bovine Serum Gibco 10437028 for freezing cells
FGF PeproTech 100-18b Prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Forceps Fine Science Tools 11008-13 for dissection of tumor
Glycerol, MB Grade EMD- Millipore 356352
H3K4me3 Abcam Ab8580
H3K27me3 Millipore 07-449
HBSS Gibco 14175-103 balanced salt solution
Fluriso VETone 501017 inhalation anesthetic
Ivis Spectrum Perkin-Elmer 124262 in vivo optical imaging system
Hyqtase HyClon SV3003001 cell detachment media
Lithium Chloride Sigma L8895 buffer reagent
Low binding microtubes Corning Costar CLS3207 low protein binding microcentrifuge tube
Microcentrifuge tube Fisher 21-402-903 regular microcentrifuge tube
Micrococcal Nuclease Thermo Fisher Scientific, Affymetrix 70196Y each batch may differ; purchase sufficient amount for experiments and aliquot.
N2 Gibco 17502-048 NSC component
Normal Rabbit IgG Millipore 12-372
Normocin Invivogen NOL-36-063 anti-microbial agent, use at 0.1 mg/mL.
NP-40 (Igepal CA-630) Sigma 18896-50ML buffer reagent
Kimble Kontes Pellet Pestle Fisher Scientific K749515-0000
Protease Inhibitor Cocktail Sigma-Aldrich P8340 aliquot and store at -20 °C.
Protinase K Sigma-Aldrich P2308 make 10 mg/mL stock in water; aliquot and store at -20 °C.
QIAquick PCR Purification Kit Qiagen 28104 DNA purification kit
Scalpel Fine Science Tools 10007-16 for dissection of tumor
Sodium Chloride VWR 0241-5KG buffer reagent
Sodium Deoxycholate Sigma-Aldrich D670-25G buffer reagent
Sodium Dodecyl sulfate (SDS) Sigma L-4390 buffer reagent
Tris Base Thermo Fisher Scientific Bp152-1 buffer reagent
Triton X-100 Thermo Fisher Scientific BP 151-500 polyethylene glycol octylphenyl ether
Standard Mini Centrifuge Fisherbrand 12-006-901 standard mini centrifuge
SZX16 microscope Olympus SZX16 flourescent dissecting microscope
ViiA 7 Real-Time PCR System with Fast 96-Well Block Applied Biosystems 4453535
Nanodrop One Thermo-Fisher Scientific ND-ONEC-W

DOWNLOAD MATERIALS LIST

References

  1. Schwartzentruber, J., et al. Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature. 482, (7384), 226-231 (2012).
  2. Bjerke, L., et al. Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN. Cancer Discov. 3, (5), 512-519 (2013).
  3. Bender, S., et al. Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell. 24, (5), 660-672 (2013).
  4. Maleszewska, M., Kaminska, B. Is glioblastoma an epigenetic malignancy? Cancers (Basel). 5, (3), 1120-1139 (2013).
  5. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  6. Thorne, A. W., Myers, F. A., Hebbes, T. R. Native chromatin immunoprecipitation. Methods Mol Biol. 287, 21-44 (2004).
  7. Turner, B. Mapping Protein/DNA Interactions by Cross-Linking. (2001).
  8. Tseng, Z., Wu, T., Liu, Y., Zhong, M., Xiao, A. Using native chromatin immunoprecipitation to interrogate histone variant protein deposition in embryonic stem cells. Methods Mol Biol. 1176, 11-22 (2014).
  9. Calinescu, A. A., et al. Transposon mediumted integration of plasmid DNA into the subventricular zone of neonatal mice to generate novel models of glioblastoma. J Vis Exp. (96), (2015).
  10. Sambrook, J., Russell, D. W. Estimation of cell number by hemocytometry counting. CSH Protoc. 2006, (1), (2006).
  11. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  12. Kubista, M., et al. The real-time polymerase chain reaction. Mol Aspects Med. 27, (2-3), 95-125 (2006).
  13. Hwang, W. W., et al. Distinct and separable roles for EZH2 in neurogenic astroglia. Elife. 3, e02439 (2014).
  14. Haring, M., et al. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods. 3, 11 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics