Un metodo per definire gli effetti dell'arricchimento ambientale sul Colon Microbiome biodiversità in un modello di tumore del Colon del topo

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Arricchimento ambientale (EE) è un ambiente di stabulazione degli animali che viene utilizzato per rivelare i meccanismi che sottendono le connessioni tra stile di vita, lo stress e la malattia. Questo protocollo descrive una procedura che utilizza un modello murino di tumorigenesis dei due punti ed EE per definire specificamente alterazioni nel microbiota biodiversità che potrebbero influenzare la mortalità degli animali.

Cite this Article

Copy Citation | Download Citations

Fuller, A. K., Bice, B. D., Venancio, A. R., Crowley, O. M., Staab, A. M., Georges, S. J., Hidalgo, J. R., Warncke, A. V., Angus-Hill, M. L. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (132), e57182, doi:10.3791/57182 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Parecchi studi recenti hanno illustrato gli effetti benefici di vivere in un ambiente arricchito sul miglioramento della malattia umana. Nei topi, arricchimento ambientale (EE) riduce la tumorigenesi attivando il sistema immunitario del mouse, o colpisce sopravvivenza animale di cuscinetto del tumore stimolando la risposta di riparazione della ferita, incluso migliorata microbiome diversità, nel microambiente tumorale. Fornito qui è una procedura dettagliata per valutare gli effetti dell'arricchimento ambientale sulla biodiversità del microbioma in un modello di tumore del colon del topo. Precauzioni relative all'allevamento di animali e considerazioni per l'integrazione Colonia animale genotipo e mouse sono descritti, che infine colpiscono la biodiversità microbica. Ascoltando queste precauzioni può consentire più uniforme microbiome trasmissione e di conseguenza allevierà non-trattamento effetti dipendenti che possono confondere i risultati dello studio. Inoltre, in questa procedura, microbiota modifiche sono caratterizzate tramite sequenziamento del 16S rDNA del DNA isolato dalle feci raccolti dal colon distale dopo arricchimento ambientale a lungo termine. Lo squilibrio del microbiota intestinale è associato con la patogenesi di infiammatorie intestinali malattia e cancro del colon, ma anche di obesità e diabete tra gli altri. D'importanza, questo protocollo per l'analisi EE e microbiome può essere utilizzato per studiare il ruolo della patogenesi microbiome attraverso una varietà di malattie dove esistono modelli murini robusto che può ricapitolare la malattia umana.

Introduction

Studi di arricchimento ambientale (EE) utilizzano parametri complessi alloggiamento per interessare la stimolazione sociale (gabbie di custodia di grandi dimensioni, grandi gruppi di animali), stimolazione cognitiva (capanne, tunnel, materiali di nidificazione, piattaforme) e attività fisica (in esecuzione ruote). EE è stato utilizzato da molti laboratori per capire gli effetti di una maggiore attività e interazioni sociali e cognitive migliorate sulla malattia iniziazione e progressione utilizzando una vasta gamma di modelli murini, inclusi barbering alopecia indotta, morbo di Alzheimer, La sindrome di Rett e la malattia del tumore e digestivo diversi modelli1,2,3,4,5,6.

Sono stati sviluppati diversi modelli di mouse per studiare il tumorigenesis dei due punti in topi. Forse il modello più ben definito è il mouse ApcMin . Il mouse di ApcMin è stato sviluppato nel laboratorio di William colomba nel 19907e viene utilizzato come un modello murino di mutazioni del gene APC che sono comunemente associati con cancro colorettale umano. In contrasto con gli esseri umani che harboring le mutazioni di APC , ApcMin topi sviluppano principalmente piccoli tumori intestinali, con un avvenimento molto raro di tumori del colon. Tuttavia, un allele Tcf4Het con una singola mutazione eterozigotica Knockin ' knock-out in Tcf4, aumenta considerevolmente il tumorigenesis dei due punti quando combinato con l' allele di ApcMin 8. Recentemente, questo modello del topo di tumorigenesis dei due punti è stato utilizzato per determinare gli effetti di EE il colon tumorigenesi6. Nella Bice et al. lo studio, gli effetti fisiologici e fenotipici dell'EE su maschi e femmine di quattro linee di diverso tipo di mouse (wild type (WT), Tcf4Het / + Apc+ +, Tcf4+ + ApcMin / +, e Tcf4 Het / + APCMin / +)) sono stati definiti. Forse la scoperta più interessante era che EE aumenta significativamente la durata della vita degli animali del colon del tumore-cuscinetto sia maschile che femminile. Questo ha dimostrato che EE può ridurre almeno alcuni dei sintomi associati con tumorigenesis dei due punti e migliorare la salute degli animali. Notevolmente, questa durata migliorata nei maschi non è un risultato diretto della ridotta tumorigenesi e invece era legata all'avvio di una risposta, incluso il miglioramento microbiome biodiversità6di cicatrizzazione del tumore.

Sono stati pubblicati diversi studi specifici di EE con risultati interessanti. Tuttavia, dal punto di vista tecnico, importanti risultati spesso non sono traducibili in altri laboratori. Il mantenimento di metodologie EE identici tra laboratori diversi è un problema incredibilmente complesso, non solo a causa di dispositivi di arricchimento e alloggio utilizzato, ma anche biancheria da letto, cibo, ventilazione, allevamento, genetica, attività in camera e protocollo animale requisiti, tra gli altri9,10,11. Un esempio è integrazione animale, dove gli animali devono essere stabilmente integrati nella Colonia del mouse, quindi normalizzare la composizione genetica di sfondo e la dieta, per evitare gli effetti correlati non-trattamento. Ulteriormente, molti studi EE sono stati completati prima della realizzazione dell'importanza del microbioma nella malattia e il modo che comuni pratiche di allevamento del mouse possono influenzare la composizione del microbioma intestinale10,12.

Posizionamento di strategia e animale di allevamento in EE può aumentare lo sforzo, se non effettuata correttamente. Poiché gli studi EE utilizzano un numero elevato di animali maschii e femminili e di genotipi multipli, messa a punto sperimentale può essere difficile dato il requisito per gli animali da cucciolate diverse da combinare. Di conseguenza, un allevamento e lo svezzamento di strategia è stato sviluppato per consentire la combinazione di animali svezzati del genotipo corretto da diverse cucciolate. La motivazione principale per questo era a normalizzare il microbiota tra cucciolate e a ridurre lo stress quando gli animali sono stati spostati all'ambiente sperimentale. Il microbioma è stata trasmessa dalla diga10. Per garantire la diversità microbica alla Colonia, le femmine erano acquistate da Jackson Labs e integrate nella Colonia per un mese prima che l'esperimento ha cominciato9,10,12. Per normalizzare ulteriormente microbiome biodiversità tra gli animali, le femmine erano co-ospitate prima dell'allevamento. A seguito allevamento, alloggio comunale durante l'allevamento e la possibilità di fuggire cura cuccioli migliorato i livelli di stress di cure materne13,14, possibilmente promuovendo microbiome normalizzazione. Per evitare la non-EE correlati effetti sul microbioma, questa custodia comune di tutti gli animali sperimentali ha impedito lo stress di combattimento e altre che si sono verificati quando si combinano diversi maschi da cucciolate diverse in una gabbia sperimentale. Infine, un numero uguale di animali di tutti i genotipi sono stati inclusi nelle gabbie. Questo ha offerto l'opportunità per la biodiversità microbiota migliorata attraverso genotipi e rimosso il contributo di coprofagia (tendenza dell'animale a consumare sgabello) o possibili differenze di comportamento di genotipo specifico allo studio generale.

Questo protocollo fornisce una strategia che si espande gli studi per includere aspetti noti del microbioma ricerca, compresa l'integrazione di microbiota animale e trasmissione Colonia per la normalizzazione del microbiota, per consentire più uniforme microbiome popolazioni precedenti-EE tra gli animali da esperimento. Ascoltando queste precauzioni è essenziale a causa della capacità di non-trattamento correlate microbiota differenze per confondere i risultati dello studio. Eliminando non-EE relative modifiche microbiota permetterà ai ricercatori di definire specificamente il ruolo di EE sulla composizione del microbiota durante lo sviluppo della malattia e la progressione.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tutti i metodi descritti qui sono stati effettuati secondo protocolli approvati dalla istituzionale Animal Care and uso Committee (IACUC) presso l'Università dello Utah.

1. disegno sperimentale ed EE e controllo gabbia Setup

Nota: Per riferimento, è illustrato un contorno del disegno sperimentale (Figura 1).

  1. Impostare controllo (NE) e gabbie EE (Figura 2).
    1. Per impostare NE gabbie, utilizzare gabbie di controllo convenzionali in autoclave (tabella 1) che non dispongono di dispositivi di arricchimento.
    2. Per grandi gabbie, praticare un foro per gabbia che è grande abbastanza per ospitare un gommino di protezione e tunnel (Tabella materiali).
    3. Per impostare il cucciolo allevamento e gabbie EE, collegare due grandi gabbie in autoclave con un tunnel protetto sterilizzati gommino e sterilizzati 2 piattaforme per aumentare lo spazio di pavimento (tabella 1). Per gli esperimenti EE, fornire sterilizzato in esecuzione ruote, tunnel, igloo, capanne, palle di ricerca per indicizzazione e nidificazione materiale all'interno delle gabbie EE.
    4. Posto sia EE e NE gabbie in un rack ventilato per fornire la ventilazione uguale.
      Nota: Due grandi gabbie con 2 piattaforme (tabella 1) consentono per un massimo di 12 femmine gravide al cucciolo allevamento installazione15 (Vedi Tabella materiali, passo 3.2 nel documento e tabella 2).
    5. Alimentazione topi ad libitum irradiati in autoclave ad osmosi inversa acqua e cibo standard.
    6. Fornire topi con materiali da lettiera sterile.
      Nota: Tutte le manipolazioni delle gabbie vuote e le gabbie con gli animali devono essere fatto nella cappa per prevenire la contaminazione. Per la manipolazione di gabbia di grandi gabbie, coprire il foro nella gabbia con una pellicola adesiva.
  2. Preparare gli animali per l'allevamento. Gruppo 15 femmine 2 - mese-vecchia casa in una grande gabbia singola (tabella 1) per 2 settimane prima dell'accoppiamento. Separatamente casa 2 - mese-vecchio littermate maschi per 2 settimane prima dell'accoppiamento.
    Nota: Il numero di femmine per allevamento dipende l'esperimento e il numero di animali necessari. In questo studio, 15 femmine venivano utilizzate per ottenere 12 femmine collegate, che è il massimo numero consentito nel cucciolo allevamento installazione descritto al punto 1.1.2 (tabella 2).
  3. Per l'allevamento, combinare gli animali sire e diga, 1 maschio a 2 femmine. Il primo check-nella mattina dovrebbe essere per spine vaginale, che possono essere un segno visivo che gli animali hanno accoppiato durante la notte.
    Nota: Casa maschi e femmine insieme fino a quando ogni femmina ha collegato. Un plug vaginale può essere identificato visivamente, se è esterno.
    1. Per rilevare tappi interiorizzati, una sonda è inserita nell'apertura vaginale e se il plug vaginale è presente, la sonda non è facilmente inserita (16; vedere paragrafo 4.3.6).
      Nota: Registrare la mattina che una spina viene rilevata come ½ giornata, poiché l'accoppiamento si è verificato nella notte.
    2. Una volta che le femmine hanno spine vaginali, trasferirli a un cucciolo di grande allevamento gabbia di stabulazione in gruppo con altre femmine accoppiate (programma di installazione nel passaggio 1.1.2 senza dispositivi di arricchimento).
    3. Sostituisci accoppiato femmine con nuove femmine spaiato gruppo ospitato per l'accoppiamento e continuare l'accoppiamento per ottenere il massimo numero di cucciolate in un periodo di 7 giorni.
      Nota: Tutti gli animali devono avere una data di consegna entro 7 giorni uno da altro.
  4. Consentire le femmine gravide a partorire nel gruppo alloggiamento in modo che tutte le cucciolate vengono generati all'interno di un grande cucciolo allevamento gabbia (programma di installazione nel passaggio 1.1.2 senza dispositivi di arricchimento).
    1. Tenere traccia delle date di nascita e numeri di pup e inizio cuccioli di genotipizzazione a 7 giorni di età.
      1. Tatuaggio cuccioli sulle loro punte a 7 giorni di età con un codice numerico per identificarli13,17.
      2. Pulire la punta con etanolo al 70% e inserire delicatamente un dispositivo di micro-tatuaggio contenenti inchiostro nella superficie della pelle parallela al punta17 (Vedi Tabella materiali).
      3. Raccogliere del tessuto con le forbici per genotipizzazione dalle punte della coda di pungere un piccolo pezzo di tessuto da neonati 7 - giorno-vecchi.
    2. Isolare il DNA di genomic dal tessuto ed eseguire PCR utilizzando un metodo convenzionale di HotSHOT come descritto in 18.
    3. Animali separati per sesso a 14-21 giorni in grandi gabbie con le madri.
      Nota: Assicurarsi che i cuccioli più vecchi sono in grado di alimentare proprio, e che i cuccioli più giovani continuano ad allattare fino al vecchio abbastanza per sfamare proprio.
    4. Alle 21-28 giorni, distribuire gli animali maschii e femminili separatamente dal genotipo in ambienti NE o EE, assicurandosi di mantenere proporzioni uguali di ciascun genotipo per gabbia (Figura 2A).
      Nota: Assicurarsi che il numero totale di animali ammessi in ogni gabbia NE o EE si basa sul numero massimo consentito di IACUC (tabella 2). Le gabbie NE hanno al massimo 5 animali (tabella 2). In gabbie EE, per stimolazione sociale, non meno di 20 e con le limitazioni di spazio, non più di 41 animali dovrebbero essere consentiti nella gabbia EE (tabella 2).

2. sgabello collezione a 16 settimane di età

  1. Iniziare la raccolta di feci 1 a 2 giorni prima del sacrificio e raccogliere separatamente sgabello il giorno del sacrificio durante la dissezione utilizzando strumenti sterili.
    Nota: Sgabello raccolta allo stesso tempo 1-2 giorni prima della raccolta può contribuire ad per evitare la perdita di un campione dalla possibilità che no sgabello è presente al momento della raccolta.
    1. A raccogliere Sgabello da animali vivi, attentamente collottola l'animale sopra una gabbia pulita. Raccogliere le feci utilizzando pinze sterili in una provetta sterile microfuge.
      Nota: Animali in genere eliminerà sgabello quando immobilizzato, che permette di rapido sgabello collezione direttamente in una provetta sterile microfuge. Se un animale non immediatamente defecare quando immobilizzato, metterlo in una gabbia pulita e attendere che l'animale a defecare (in genere fino a 1 h).
    2. Raccogliere le feci il giorno del sacrificio.
      1. Per eutanasia animale, metti l'animale sotto una campana di vetro contenente un piccolo contenitore con un batuffolo di cotone imbevuto di isoflurane. Una volta che la cessazione della respirazione è osservata (solitamente dopo 2 min), posare l'animale sul dorso per consentire la dissezione del colon.
      2. Applicare etanolo al 70% all'addome del mouse.
      3. Sollevare la pelle anteriore l'apertura uretrale con il forcipe e usare le forbici per tagliare lungo la linea mediana ventrale fino a raggiungere la gabbia toracica e tagliato dalla base della prima incisione verso ogni gamba. Piegare indietro la pelle e usare le forbici per tagliare attraverso la parete peritoneale nello stesso modello.
      4. Utilizzare pinze per afferrare il colon distale all'ano da sezionare e staccare il colon distale dal retto. Tirando i due punti in verticale con il forcipe, usare le forbici per tagliare attraverso il mesentere per rilasciare i due punti.
      5. Tagliare i due punti appena sotto l'intestino cieco ed adagiarlo su carta da filtro. Utilizzare pinze per sollevare la parte superiore del tubo del colon, apertura del lume per consentire un lato delle forbici aperte da inserire. Tagliare longitudinalmente, Apri distale prossimale e strombatura colon longitudinalmente.
      6. Raccogliere feci dal colon distale in una provetta sterile microfuge utilizzando pinze sterili.
  2. Sgabello di archivio in un tubo di microfuge a-80 ° c fino al momento dell'isolamento del DNA batterico.
    Nota: Il giorno del sacrificio, oltre allo sgabello, raccogliere altri campioni quali sangue intero, siero, plasma, normale e il tessuto del tumore da colon e intestino tenue, microsomi, tessuto adiposo, ecc. alle domande di indirizzo definito nello studio.

3. isolamento genomic del DNA da sgabello

Nota: Utilizzare un kit commerciale per isolare il DNA microbico da sgabello seguendo un protocollo di rilevamento del patogeno sgabello. Rimuovere i campioni direttamente per il congelatore ˚ c-80 e l'archivio su ghiaccio secco durante la pesatura.

  1. Trasferimento fino a 220 mg di feci in una provetta pulita microfuge contenente 1,4 mL di tampone di lisi sgabello di temperatura ambiente (TA) (Vedi Tabella materiali).
  2. Esempio di vortice per 1 min a omogeneizzare accuratamente solidi (Figura 2B). Riscaldare la sospensione a 95 ˚ c per 5 min lisare tutti i batteri (compresi i batteri Gram-positivi).
  3. Esempi di vortice per 15 s e poi Centrifugare a 20.000 x g per 1 min a pellet i solidi di sgabello. Trasferire il surnatante in una provetta 2 mL microfuge. Aggiungere una compressa per ogni campione di inibitori della PCR, vortice fino a quando la compressa è sciolta, di assorbire e mantenere in incubazione il campione a temperatura ambiente per 1 min.
  4. Centrifugare il campione a 20.000 x g per 3 min e trasferire il surnatante in una provetta di microfuge nuovo. Centrifugare a 20.000 x g per 3 min Aliquot 15 µ l di proteinasi K (20 mg/mL di brodo) in una nuova provetta microfuge 1,5 mL. Aggiungere 200 μL del campione nella provetta contenente proteinasi K.
  5. Aggiungere 200 μL di tampone di lisi di cloruro di guanidinio al tubo, vortice accuratamente per 15 s (Vedi Tabella materiali) e incubare il campione a 70 ˚ c per 10 min. aggiungere 200 μL di etanolo (96-100%) ai tubi e mescolare bene su Vortex.
  6. Posto una silice colonna spin in una provetta 2 mL di base e applicare i campioni alla colonna. Chiudere il coperchio e centrifugare per 1 min a 20.000 x g.
  7. Trasferire la colonna ad un nuovo tubo di raccolta da 2 mL e aggiungere 500 μL di tampone di lavaggio 1 alla colonna, cap la colonna e centrifugare per 1 min 20.000 x g. trasferimento della colonna ad un nuovo tubo di raccolta da 2 mL e aggiungere 500 μL di tampone di lavaggio 2 nella colonna , chiudere il tappo e centrifugare a 20.000 x g per 3 min.
  8. Con il cappuccio chiuso, trasferire la colonna ad un nuovo tubo di raccolta da 2 mL e centrifugare per un ulteriore 1 min a 20.000 x g per rimuovere il tampone di lavaggio residua. Trasferire la colonna a un 1,5 mL etichettato microfuge tubo ed eluire il campione aggiungendo 200 μL di tampone di eluizione contenenti EDTA alla membrana (Vedi Tabella materiali).
  9. Chiudere il tappo e incubare a temperatura ambiente per 1 min. Centrifugare il campione per 1 min a 20.000 x g. gettare la colonna.

4. DNA concentrazione determinazione e preparazione del campione per la PCR

Nota: Utilizzare un fluorimetro e un'analisi fluorescente dsDNA disponibile in commercio per determinare la concentrazione di DNA genomica in ciascun campione (Vedi Tabella materiali). Il colorante fluorescente deve associare specificamente DNA a doppio filamento.

  1. Preparare una diluizione di 1: 200 di ogni campione (1 µ l di ciascun campione in 199 mix master di dsDNA µ l) e un 01:50 diluizione degli standard. Analizzare su un fluorometro utilizzando l'impostazione di dsDNA.
    Nota: Un elevato volume di DNA in PCR può essere inibitorio, di conseguenza, il volume di DNA utilizzato non deve essere oltre il 10% del volume finale del PCR. Un fluorometro consente misure accurate di DNA nel campione, come solo DNA associato alla tintura fluorescente darà fluorescenza, eliminando il possibile contributo di contaminanti alla concentrazione finale calcolata del DNA. Questo livello di quantificazione accurata è essenziale per l'applicazione di sequenziamento a valle.
  2. Preparare modelli PCR diluiti a 5 ng/μL con il volume appropriato di 10 mM Tris, pH 8.5 a fare scorte di modello di lavoro di ciascun campione.
  3. Conservare i campioni a-20 ° C.

5. design primer per il 16S desiderato V regioni

  1. Disegnare primers per amplificare selettivamente la regione di rRNA 16S V desiderata.
  2. Analizzare gli iniettori con sonda partita, dal progetto di Database Ribosomal19, per determinare il tasso di successo approssimativo per vari phyla.
    Nota: Per le regioni di V1-V3, lo studio corrente ha utilizzato pubblicato primer Bosshard avanti20, che si legano alla posizione 8 nella regione di V1 e 533 inversa21, che si lega alla posizione 533 all'interno della regione V3. Primer deve includere sporgenza adattatore sequenze per l'indicizzazione.
  3. Quando progettazione degli iniettori, includere sequenze di adattatore all'estremità 5' di ogni primer, come consigliato per 16S metagenomica sequenziamento libreria preparazione22 (tabella 3).
  4. Sintetizzare questi grandi iniettori con purificazione cartuccia. Primer essiccata di ricostituire e diluire una PCR lavorandoin stock a 1 μM 10 mM Tris, pH 8.5.

6. amplicone PCR per amplificare le regioni V con sporgenza adattatore sequenze allegato 22

  1. Impostare l'amplicone miscela di reazione PCR come descritto nella tabella 4.
  2. Inserire un sigillo di piastra PCR chiaro adesivo sulla piastra ed eseguire l'amplicone PCR utilizzando i parametri nella tabella 5.
  3. (Opzionale) Eseguire amplicone PCR prodotti su un gel dell'agarosi o un'analisi di DNA ad alta sensibilità che consente la misurazione quantitativa di amplicon dimensioni (Vedi Tabella materiali).
    Nota: La dimensione amplicone da questo studio è di 550 bp (Figura 3A).

7. PCR di pulitura mediante magnetico perline 22

  1. Centrifugare la piastra di amplicone PCR rapidamente a 1.000 x g per 1 min raccogliere la condensa.
    Nota: PCR tubo strisce possono essere utilizzati invece di piastre PCR per minimizzare la contaminazione. Scartare il tubo coperchi e non riutilizzare mai.
  2. Vortice i branelli magnetici uniformemente disperderli e aggiungere 20 μL di magnetico perline per ogni amplicone PCR bene, quindi dispensare l'intero volume su e giù lentamente 10 volte.
  3. Incubare a RT per 5 min. Posizionare la piastra PCR su un supporto magnetico per 2 min, fino a biglie magnetiche sono raccolti e il surnatante è chiaro. Rimuovere e scartare il surnatante.
  4. Perle di lavaggio con 200 μL fresco 80% etanolo mentre il piatto PCR è il magnetico stand e incubare per 30 s a RT su supporto magnetico. Rimuovere con cautela il supernatante.
  5. Ripetere il lavaggio per una seconda volta. Ora, è possibile utilizzare una punta fine per rimuovere qualsiasi residuo etanolo dai pozzi e permettere all'aria di essiccazione per 10 min.
  6. Rimuovere la piastra PCR dal supporto magnetico e aggiungere 52,5 μL di Tris 10 mM pH 8,5 in ciascun pozzetto. Pipettare fino e giù 10 volte a sospendere perline e incubare a temperatura ambiente per 2 min.
  7. Trasferire la piastra PCR per il supporto magnetico per raccogliere perle magnetiche e trasferire 50 μL del surnatante di un piatto pulito di PCR. Collocare un sigillo di piastra PCR chiaro adesivo sulla piastra e conservare a-20 ° c fino a una settimana.

8. preparazione di un regime di piastra per indice PCR

Nota: Per generare una libreria di V1-V3, una seconda PCR è stata effettuata con un indice kit (Vedi Tabella materiali). Uno schema di indicizzazione predefinito è stato utilizzato per mappare combinazioni Indice dual univoco per ogni campione (Figura 3B e 23).

  1. Garantire che ogni campione ha una combinazione unica di 2 primer di indice (cioè, doppia indicizzazione).

9. eseguire Indice PCR per collegare i codici a barre per le sequenze di adattatore come descritto 22 .

  1. Trasferire 2,5 μL di ampliconi PCR (pulito ampliconi) una nuova piastra ben 96 e posto in un dispositivo a piastra di indice per facilitare l'indicizzazione.
  2. Organizzare l'indice 1 e indice 2 primer come nell'esempio del grafico piatto preparato (Figura 3B).
    Nota: Segnali visivi vengono forniti per evitare confusioni di primer: Indice 2 primer tubi dovrebbero hanno cappucci bianchi e soluzione limpida, mentre tubi primer indice 1 dovrebbero avere tappi arancione e giallo soluzione.
  3. Assemblare l'indice della reazione di PCR Mix come descritto nella tabella 6. Mescolare pipettando su e giù per 10 volte. Coprire con un sigillo di piastra PCR chiaro adesivo e centrifugare per raccogliere a 1.000 x g a temperatura ambiente per 1 min.
  4. Eseguire l'indice PCR utilizzando i parametri nella tabella 7.

10. purificare PCR finale biblioteca

Nota: Questo PCR clean-up è identico al passaggio 7 sopra e utilizza microsfere magnetiche per eseguire PCR Clean-Up dell'indice PCR22.

  1. Centrifugare la piastra PCR dal passaggio 10 rapidamente a 1.000 x g per 1 min raccogliere la condensa.
  2. Vortice i branelli magnetici uniformemente disperderli, quindi aggiungere 20 μL di magnetico perline per ogni amplicone PCR Beh, pipettare quindi l'intero volume su e giù lentamente 10 volte per mescolare.
  3. Incubare a temperatura ambiente per 5 min.
  4. Piastra di PCR posto su un supporto magnetico per 2 min fino a biglie magnetiche sono raccolti e surnatante è chiaro. Rimuovere e scartare il surnatante.
  5. Perle di lavaggio con 200 μL fresco 80% etanolo mentre il piatto PCR è il magnetico stand e incubare per 30 s a temperatura ambiente su supporto magnetico. Rimuovere con cautela il supernatante.
  6. Ripetere il lavaggio per una seconda volta.
  7. Dopo il secondo lavaggio, utilizzare una punta fine per rimuovere qualsiasi residuo etanolo dai pozzi e permettere all'aria di essiccazione per 10 min.
  8. Rimuovere la piastra PCR dal supporto magnetico e aggiungere 52,5 μL di Tris 10 mM pH 8,5 in ciascun pozzetto. Pipettare fino e giù 10 volte a sospendere perline e incubare a temperatura ambiente per 2 min.
  9. Trasferire la piastra PCR per il supporto magnetico per raccogliere perle magnetiche e trasferire 50 μL del surnatante di un piatto pulito di PCR. Collocare un sigillo di piastra PCR chiaro adesivo sulla piastra e conservare a-20 ° c fino a una settimana.
  10. (Opzionale) Eseguire i prodotti PCR di indice su un gel dell'agarosi o un'analisi di DNA ad alta sensibilità che consente la misurazione quantitativa di amplicon dimensioni (Vedi Tabella materiali).
    Nota: La dimensione finale raccolta indicizzata da questo studio è stato 668 bp (Figura 3C-D).

11. quantificare, normalizzare e piscina le librerie indicizzate per il sequenziamento

  1. Determinare la concentrazione di DNA di ciascun campione con un fluorimetro e un kit di analisi fluorescente di dsDNA (Vedi tabella materiali).
    1. Preparare una diluizione di 1: 200 del campione (1 µ l di ciascun campione in 199 µ l dsDNA mix master, che include il buffer e reagente) per ciascuno dei campioni indicizzati e standard (mix master dsDNA di 190 µ l e 10 µ l di standard). Analizzare su un fluorometro utilizzando l'impostazione di dsDNA.
  2. Dopo il calcolo di concentrazione di DNA, normalizzare le librerie di calcolo della dimensione media biblioteca. Fare questo sommando lunghezze adattatore, lunghezze di indice e V amplicone dimensioni da primer e Mostra i prodotti di gel di agarosio per essere certi che la dimensione effettiva è simile alla dimensione calcolata (cfr.Figura 3C, 22).
    1. In alternativa, utilizzare un test di DNA ad alta sensibilità che consente la misurazione quantitativa dell'integrità del DNA, dimensione amplicone e concentrazione (tabella materiali, Figura 3D).
      Nota: In questo studio, la dimensione media library è stata calcolata sulla base sommando le lunghezze di adattatore, lunghezze di indice e dimensione amplicone V1-V3 da primer. La dimensione media è 668 bp.
    2. Le concentrazioni di campioni sono normalizzate utilizzando la formula nella tabella 8.
  3. Diluire i campioni a 4 nM e piscina 5 µ l di ogni campione 4-nM in un singolo tubo per il sequenziamento.

12. la libreria utilizzando un sistema di sequenziamento di nuova generazione di sequenza e analizzare i dati

  1. Sequenza della libreria.
    Nota: Per questo studio, l'Università dello Utah High Throughput genomica Core eseguita biblioteca denaturazione e sequenziamento di campione (come descritto in 6,22).
  2. Analizzare i dati.
    Nota: Per separare i dati dal pool di campioni, letture di indice sono state identificate e separate (come descritto in 22).
  3. Generare i file FASTQ e utilizzare questo per l'analisi di dati successivi.

13. analizzare i dati in sequenza dalla libreria amplicone 16S

Nota: Questa operazione viene eseguita come descritto in Bice et al., 20176.

  1. Installare gli strumenti di analisi di dati liberamente disponibili (Vedi Tabella materiali; 24).
  2. Assemblare i file fastq demoltiplicato da dati in sequenza (come descritto in25,26). Scarta tutte le sequenze smontate.
  3. Eseguire analisi seguendo un'unità tassonomica aperta di de novo (OTU) picking protocollo (come descritto in 27).
    1. Bin sequenze in un file di singolo fastq di sampleID e sequenze di gruppo con 97% o maggiore somiglianza in OTUs, come descritto in 28. Allineare sequenze rappresentative del nucleo con lunghezza di sequenza minima di 150 e 75% per cento identità29,30. Assegnare tassonomia come descritto28.
      Nota: I campioni possono essere cestinati e analizzato31, seguita da assegnazione tassonomica e OTU tabella costruzione32.
    2. Creare un file di mapping che identifica i nomi descrittivi e le caratteristiche dei campioni per collegare a identificazione del campione e convalidare il file di mappatura33,34.
    3. Fare una rete OTU che collega OTUs a descrizioni di esempio utilizzando un file di mappatura35.
    4. Calcolare i riepiloghi di tassonomia in termini di relativa abbondanza Riassumendo taxa attraverso trame36.
    5. Esplorate alfa diversità dei campioni a profondità uniforme sequenziamento appropriato ai campioni. Per definire la profondità adeguata per alfa diversità, riepilogare conteggi totali osservati in ciascun campione utilizzando il comando di riassumere-table di bioma, come descritto in 37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Parecchi studi hanno dimostrato che la pratica della medicina mente-corpo migliora i risultati di salute. Allo stesso modo, nei topi, arricchimento ambientale migliora i risultati tra cui una migliore durata della vita e tumore ferito riparazione6. Di conseguenza, una procedura EE è stata sviluppata con l'obiettivo di definire il ruolo del microbiota in questo fenotipo mentre prima normalizzazione il microbioma prima dell'inizio dell'esperimento (Figura 1). D'importanza, tutti gli animali di allevamento sono integrati nella Colonia del mouse per almeno un mese prima dell'inizio dell'allevamento e cuccioli appena nati sono co-ospitati con le madri in una grande gabbia per normalizzare il microbiota trasmissione prima dell'esperimento. Quando gli animali sono tra 21 e 28 giorni di età, un numero uguale di ciascun genotipo è svezzato nel loro rispettivo alloggiamento, EE o ambienti NE (Figura 2A). A 16 settimane, sgabello da tutti gli animali raccolti e omogeneizzato (Figura 2B), seguita da isolamento del DNA batterico. Infine, 16S ampliconi sono amplificati da sgabello microbiome DNA e codice a barre indicizzati per consentire per la sequenziazione di tutte le librerie di microbiome simultaneamente (Figura 3). Le sequenze uniche identificate in WT e tumore animali del cuscinetto in condizioni NE sia EE sono mostrate in Figura 4. È interessante notare che, EE non migliora la biodiversità negli animali WT, ma aumenta considerevolmente la biodiversità negli animali del cuscinetto del tumore (Figura 4), dimostrando che questo metodo consente miglioramenti della biodiversità. Questo aumento della biodiversità può essere attribuito alla presenza aumentata del phylum Proteobacteria, con significativo aumenta nelle classi Alphaproteobacteria e Betaproteobacteria e diminuisce in patogeno Gammaproteobacteria (Figura 5 ; Supplemental tabella 1). L'aumento più grande è il Betaproteobacteria classe è il genere Sutterella, un probabile commensal coinvolti nella degradazione di IgA secrete (Figura 6, anche Vedi38).

Figure 1
Figura 1 : Una rappresentazione della timeline sperimentale. Le bande breve rappresentano windows 7 giorni, come la maggior parte del protocollo è realizzata in incrementi di 7 giorni. Questo aiuta anche nella visualizzazione dell'intervallo di età pup in tutto l'esperimento. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 : EE e NE alloggiamento condizioni e degli omogeneati sgabello (come descritto nel protocollo). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3 : 16S Microbiome libreria preparazione. (A) prodotti amplicone PCR non purificata derivata da DNA genomic sgabello. (B) indicizzazione grafico piatto progettato secondo il software utilizzato (Tabella materiali, 23). Le combinazioni di doppio indice, I7 (indice 1; Fila) e I5 (indice 2; Colonna), sono indicati per ogni campione. Ogni indice è 8 bp in lunghezza. I numeri di esempio si riferiscono ai numeri del mouse rispettivi dagli studi EE. (C) i prodotti di PCR di indice non purificata. (D) qualità delle analisi finale purificato e 16S librerie in pool. (A, C, D) Frecce nere denotano 550 bp amplicone e 668 raccolta indicizzata di bp. Le frecce rosse indicano prodotti non specifici che vengono eliminati dopo purificazione, come mostrato in D. Superiore e gli indicatori più bassi sono i marcatori di dimensione aggiunti al campione per misure di riferimento. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4 : Cambiamenti nella diversità alfa seguendo EE di Tcf4Het / + ApcMin / + animali. Alfa diversità di WT e Tcf4Het / + ApcMin / + tumore animali del cuscinetto. A 20.000 letture, NE ed EE di WT, p= 0,64 e NE ed EE di Tcf4Het / + ApcMin / +, p= 0,03 usando due campioni t-test con correzione di Welch. Adattato da Bice et al., 20176. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5 : EE-mediata cambiamenti successivi EE di Tcf4Het / + ApcMin / + animali. R-ggplot2 generati grafici box-whisker che denota modifiche in abbondanza del phylum Proteobacteria e classi Alphaproteobacteria, Betaproteobacteria e Gammaproteobacteria. Valori erratici sono notati come cerchi. p= 0,005 utilizzando due campioni t-test con correzione di Welch. Barre di errore calcolate utilizzando l'errore standard della media (SEM). Adattato da Bice et al., 20176. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 6
Figura 6 : Cambia nell'abbondanza relativa di Sutterella seguito EE di Tcf4Het / + ApcMin / + animali. Valori erratici sono notati come cerchi. p= 0,005 usando due campioni t-test con correzione di Welch. Barre di errore calcolate utilizzando SEM. adattato da Bice et al., 20176. Clicca qui per visualizzare una versione più grande di questa figura.

Supplemental Table 1
Supplementare tabella 1: classificazione dei batteri isolati da sgabello raccolti da topi NE ed EE. Classificazione tra genotipi a livello di Phylum (A), classe (B), (C) ordine, famiglia (D) e (E) genere. Comparazioni di NE ed EE dello stesso genotipo o WT a Tcf4Het / + ApcMin / +. P-valori sono calcolati utilizzando un t-test di due campioni con correzione di Welch. Adattato da Bice et al., 20176. Per favore clicca qui per scaricare questo file.

Elemento Superficie totale (pollici2) Superficie totale (cm2) Dimensioni della gabbia (pollici) L x W x H Cage dimensioni (cm) L x W x H
Un controllo gabbia (NE) 68,25 440.32 10.5 x 6.5 x 5.5 26,67 x 16,51 x 13,97
Una grande gabbia (EE) 264.36 1706.32 13,87 x 19.06 x 7.75 35,24 x 48.42 x 19.69
Due grandi gabbie (EE) 528.72 3412.64 2 @ 13.87 x 19.06 x 7.75 2 @ 35,24 x 48.42 x 19.69
Due piattaforme (EE) 93 600 2 @ 11,8 x 3,94 x 2,95 2 @ 30 x 10 x 7,5
Due grandi gabbie con due piattaforme (EE) 621.72 4013 2 @ 13.87 x 19.06 x 7,75 + 2 @ 11,8 x 3,94 x 2,95 2 @ 35,24 x 48.42 x 19.69 + 2 @ 30 x 10 x 7,5

Tabella 1: EE e NE gabbia dimensioni e ingombro a pavimento.

Animali ammessi in gabbia Richiesti pollici quadrati Per animale Area di gabbia EE (pollici2) Totali animali ammessi
Fino a 25 12 622,2 (4013 cm2) fino a 25
25 + 15 622,2 (4013 cm2) fino a 41
Donna con lettiera 51 622,2 (4013 cm2) fino a 12

Tabella 2: ammessi numeri di animali in gabbie basate su ingombro a pavimento 15 .

Un amplicone PCR primer
Avanti 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3 '
Invertire 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3 '
Locus specifiche sequenze vengono visualizzate in grassetto e la non in grassetto è la sequenza di adattatore di sporgenza.

Tabella 3: amplicone PCR primer.

Reazione di un amplicone PCR istituito
Volume
DNA microbico (5ng/μl) 2,5 µ l
Forward Primer (1 μM; dal punto 5.1.2) Μl 5.0
Reverse Primer (1 μM; dal punto 5.1.2) Μl 5.0
2 x HotStart Ready Mix 12.5 μl
Totale 25.0 μl

Tabella 4: amplicone PCR Mix.

Impostare l'amplicone PCR
95 ° C per 3 minuti
25 cicli di:
95 ° C per 30 secondi
55 ° C per 30 secondi
72 ° C per 60 secondi
72 ° C per 3 minuti
Mantenere a 4 ° C

Tabella 5: Amplicone PCR programma impostato.

Gruppo di codici a barre indice PCR
DNA 2,5 µ l
Iniettore di indice 1 (N7XX) 2,5 µ l
Primer di indice 2 (S5XX) 2,5 µ l
2 x HotStart Ready Mix 12.5 μl
Acqua di grado PCR 5 μl
Totale 25 μl

Tabella 6: Indice miscela PCR.

Il programma di installazione di indice PCR
95 ° C per 3 minuti
8 cicli di:
95 ° C per 30 secondi
55 ° C per 30 secondi
72 ° C per 30 secondi
72 ° C per 5 minuti
Mantenere a 4 ° C
Conservare a-20 ° C

Tabella 7: programma PCR Indice Set up.

Formula di concentrazione di esempio per il pool
(Concentrazione di DNA in ng/μl) x 106 = concentrazione in nM
(660 g/mol x dimensione media biblioteca)
Un esempio da questo studio è:
(85,2 ng/μl) x 10 ^ 6 = 193,3 nM
(660 g / mol x 668 bp)

Tabella 8: Formula per la normalizzazione della prima pool di campioni

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Questa procedura permette l'analisi del microbiota isolato dalle feci dopo arricchimento ambientale di normale o animali del cuscinetto del tumore. Perché questi sono grandi esperimenti che coinvolgono allevamento per ottenere molti animali di sesso diverso e genotipi, normalizzando il microbioma tra animali prima dell'inizio dell'esperimento è essenziale per evitare la non-EE correlati effetti sul microbioma biodiversità.

Per coerenza tra condizioni NE ed EE, il processo di allevamento viene effettuato per garantire che tutti i topi hanno inizialmente l'esposizione ai microrganismi stessi e, pertanto, sono tenuti ad avere simili microbiome contenuto. È possibile, e probabilmente, quel genotipo del mouse colpisce microbiome composizione. Per questo motivo, i numeri del mouse al genotipo vengono mantenuti tra NE ed EE condizioni per essere certi che qualsiasi animale che sta consumando sgabello incontreranno una simile diversità del microbioma.

Alcune difficoltà sono evidenti quando progettazione EE esperimenti. In primo luogo, il numero totale di animali necessari per gli esperimenti è dipendente dai dettagli sperimentali, ma il numero totale è limitato anche dal numero di animali ammessi nella gabbia. Ad esempio, sopravvivenza del mouse circostante di dati storici in un esperimento preliminare di EE sono stati utilizzati per calcolare il numero di animali per definire il meccanismo sottostante hanno migliorato la sopravvivenza osservata negli esperimenti precedenti. Da questi dati, un totale di 17 animali nel gruppo di confronto sono stati richiesti per una potenza di 80% rilevare una differenza nella sopravvivenza in un t-test di retro dove alfa = 0,05. In questo modo, 4-5 animali nel gruppo di controllo vs 20-24 (o fino a 41) animali per gabbia nel gruppo sperimentale devono contenere un calcolo della potenza. Di conseguenza, molte gabbie di gruppo di controllo sono necessari con la gabbia sperimentale. Ulteriormente, con genotipi complessi, è difficile ottenere un numero sufficiente degli animali di ogni genotipo, che richiede il gran numero di femmine riproduttrici richieste. Tuttavia, con altri modelli dove sono presenti meno differenze di transgeniche, più animali dello stesso genotipo possono essere analizzati in questo sistema e un minor numero di allevatori sono necessari. Negli Stati Uniti, 12 femmine gravide possono essere alloggiate in 6332 di spazio (tabella 2). Il problema con questo è che invecchiano cuccioli, occupano più spazio. Dato che i cuccioli maschi sono separati dalla femminili cuccioli alle 14-21 giorni, un'eccezione approvata alla regola spazio in alcuni paesi può essere fattibile. In caso contrario, maschi e femminili cuccioli possono essere genotipizzati selezionato e poi separato in giovane età con le madri a rimanere sotto i numeri di massima del mouse. È essenziale per ottenere l'approvazione per questi studi e per aderire ai regolamenti locali per le limitazioni di spazio. Infine, con microbiota, il numero di animali necessari per rilevare anche piccole differenze nella composizione del microbiota è difficile da calcolare a priori. Mentre in questo studio, le differenze significative nel microbiota sono stati trovati con 4 animali per gruppo, è possibile che l'aumento di tale numero di animali rivelerebbe microbiota che sono più variabili fra i topi EE o sono solo leggermente alterati dall'EE.

Questo metodo viene descritto il particolare attrezzature e biancheria da letto che sono usati, che sulla superficie potrebbero non essere essenziale. Tuttavia, diversi problemi non ovvio che influiscono sulla consistenza possono essere incontrati e devono essere affrontate prima dell'imbarco su questi molto grandi, costosi e studi che richiede tempo. Una questione importante è la ventilazione della gabbia. Con un gran numero di animali in una gabbia, ventilazione diventa un problema ed è un problema che molti ricercatori non prendere in considerazione quando si tenta di fornire ambienti coerenti tra gabbie sperimentali e di controllo. Tutte le gabbie nel setup descritto sono collocate in un armadio ventilato per equalizzare la ventilazione attraverso lo sperimentale e di controllo gabbie. Questo non può essere realizzato quando utilizzando gabbie che non rientrano in un ventilato. Altri mezzi per normalizzare la ventilazione tra sperimentale e controllare gli animali potrebbero essere testati e applicati in modo coerente, ma questi metodi non sono esplorati in questo studio. Simili problemi di coerenza derivano con biancheria da letto. Nel sistema del modello di cancro del colon utilizzato in questo studio, gli animali che hanno malattia digestiva saranno ingerire determinati tipi di biancheria da letto, soprattutto pannocchia di granturco bedding, portando a blocchi digestivi e malattia. È importante tenere a mente se gli animali sono noti per ingerire la biancheria da letto quando non altrimenti occupato, come l'ambiente di controllo. Questo fenomeno e gli effetti sulla salute incoerente successive influirà profondamente tutti i dati.

Il gene 16S ribosomal è stato utilizzato come mezzo per studiare popolazioni batteriche. Esso contiene nove regioni che esprimono la variabilità genetica, V1-V9 e sparpagliate regioni conservate che rimangono relativamente invariate tra specie batteriche39. La regione di V1-V3, in particolare, fornisce la più alta probabilità di identificazione di specie-livello39. V1-V3 simili studi sul cancro colorettale (CRC) e Adenoma colorettale avanzato trovato cambiamenti in tre phyla di interesse: Proteobacteria, Firmicutes e Bacteroidetes21,40,41. Esso inoltre è stato segnalato che l'esercizio può spostare la popolazione microbica e condurre ad un aumento in Firmicutes42. Per questo motivo, questo studio ha identificato popolazioni microbiome utilizzando primer V1-V3 seguendo un protocollo prep. libreria metagenomica 16S22 per definire potenzialmente gli effetti dell'arricchimento ambientale su questi phyla conosciuti per essere alterata in adenoma e CRC. Questa procedura può essere modificata per amplificare e altre regioni variabili dei geni del rRNA 16S di sequenza. Un modo è usare sonda partita per capire la classificazione filogenetica del microbiota presente nel campione che verrà identificato dalla sonda. In questo modo, le sonde possono essere mirati specificamente definire e classificare filogeneticamente microbi di interesse. Questo consente una diversa caratterizzazione del microbiota presente in campioni di feci e può rivelare ulteriori alterazioni di EE-dipendenti nel microbioma del tumore in topi che possono influenzare la progressione della malattia del cuscinetto.

Utilizzando questa procedura, il genere Sutterella è stato identificato come il genere più alterato seguito EE del tumore animali del cuscinetto. Questa procedura può essere adattata per ospitare gli studi che utilizzano qualsiasi metodo significato per analizzare gli effetti di una perturbazione sul microbioma composizione nei modelli geneticamente modificati della malattia umana. Ad esempio, al posto di EE, topi potrebbero essere inoculati con Sutterella per definire se l'inoculazione Sutterella è sufficiente per aumentare la biodiversità microbica e ferita riparazione in 16-settimana-vecchio maschio tumore animali del cuscinetto.

Senza dubbio, l'aspetto più singolare di questo protocollo è la preoccupazione per normalizzare il microbiota prima del EE e mantenimento della diversità microbiome durante gli studi EE. Poiché gli studi microbiome sono in continuo miglioramento, è probabile che metodi più robusti per la caratterizzazione del microbioma sorgeranno, e la caratterizzazione del microbioma in questo protocollo diventerà obsoleta. Ad esempio, con lo studio corrente, le sonde utilizzate per amplificare il rRNA 16S hanno pregiudizi, a seconda delle sonde che vengono scelti e non caratterizzano tutti i batteri presenti nel microbioma. Mentre i metodi utilizzati per rilevare e caratterizzare il microbioma senza dubbio migliorerà, il fondamento di base di progettazione e l'esecuzione EE esperimenti mentre mantenendo la normalizzazione del microbioma in mente rimarrà un aspetto essenziale della EE esperimenti.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori dichiarano che non hanno conflitti di interesse.

Acknowledgements

Ringraziamo B. Dalley nel nucleo della University of Utah genomica per sequenza di biblioteca e K. Boucher nel nucleo della University of Utah Biostatistica per consulenza statistica e l'accesso a questi tecnici core supportati dal premio del National Cancer Institute P30 CA042014. Il progetto descritto è stato sostenuto dal National Cancer Institute sovvenzioni P01 CA073992 e K01 CA128891 e la Huntsman Cancer Foundation.

Materials

Name Company Catalog Number Comments
Teklad Diets/Harlan Labs Chow Harlan Labs 3980X Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.
Cell-Sorb Plus bedding Fangman Specialties 82010 Autoclave prior to use.
AIMS Tattooing System For Neonates AIMS NEO-9 https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.
Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system Lab Products 82120ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Life Span Enrichment Device Lab Products 82109ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Cage 13-7/8" Length X 19-1/16" Width X 7-3/4" Depth Lab Products 82100ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 AllerZone Micro-Isolator filter top Lab Products 82101ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Tunnel Bio-Serv K3323 or K3332 Connect cages together and use for enrichment
Grommet to connect Tunnel to cages Fabricated by the University of Utah Machine Shop n/a Be certain the material is resistant to chewing and autoclavable
Fast-track wheel Bio-Serv K3250 or K3251 Use with mouse igloo and floor
Mouse Igloo Bio-Serv K3328, K3570 or K3327 Use with Fast-track wheel and floor
Mouse Igloo floor Bio-Serv K3244 Use with mouse Igloo and Fast-Track
Mouse Hut Bio-Serv K3272, K3102 or K3271
Crawl Ball Bio-Serv K3330 or K3329
Bio-hut Bio-Serv K3352 Wood pulp hut used for sheltering and nesting
Adhesive film  VWR 60941-072 Use to temporarily cover drilled hole in large cage to prevent mice from escaping
Laminar Flow Ventilated Rack Techniplast Bio-C36 The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.
1.5 mL Microfuge Tube- RNAse and DNAse free Any supplier
QIAamp DNA Stool MiniKit Qiagen 51504 This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE
Waterbath (capable of heating to 95) Any supplier For 94 degree incubation of stool samples to lyse cells.
Waterbath (capable of heating to 70 degrees) Any supplier For 70 degree incubation of stool samples 
Ethanol (200 proof) Sigma Aldrich E7023
Fluorometer: Qubit ThermoFisher Scientific Q33216
Qubit dsDNA broad Range Assay Kit ThermoFisher Scientific Q32850
EB Buffer or 10 mM Tris pH 8.5 Qiagen 19086
Experiment specific primers Any Supplier
PCR grade water Any supplier
2X KAPA HiFi HotStart Ready Mix  Kapa Biosystems KK2601 For Amplicon Amplification (1.25 mL allows 100 rxns).
Agarose for running diagnostic gels Any supplier
TapeStation High Sensitivity D1000 Screen Tape Trace Agilent 5067-5583 TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.
Agencourt AMPure XP Magnetic Beads Beckman Coulter A63880 Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions
Magnetic stand Life Technologies AM10027
Library Preparation Guide Illumina Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.
Unique Dual Indexing Illumina Illumina Experiment Manager Software Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html
Nextera XT 96 Index Kit Illumina FC-131-1002 Used to add barcodes to amplicons
MicroAmp Optical 96-well reaction plate Applied Biosystems/ThermoFisher N8010560
TruSeq Index Plate Fixture Illumina FC-130-1005
Adhesive clear plate seal Applied Biosystems /ThermoFisher 4360954 Applied Biosystems/ThermoFisher Microamp adhesive film
Sequencing by MiSeq with v3 reagents and dual 300 bp reads Illumina MS-102-3003
PhiX Control Kit Illumina FC-110-3001
Proteinase K (600 mAU/ml) Qiagen 19131 Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit
Data Analysis Tools Qiime QIIME software Tools Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime
Step 13.2. Qiime FastQ Join method  (http://code.google.com/p/ea-utils  ).  For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).
Step 13.3. Qiime De-Novo OTU picking protocol http://qiime.org/scripts/pick_de_novo_otus.html.
Step 13.3.1. Open Taxonomic Units (OTUs) using Uclust Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).
Step 13.3.1. Pynast Pynast Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010). 
Step 13.3.1. Pynast Pynast_Greengenes DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study
13.3.1. Note:  Qiime Multiple Split Libraries http://qiime.org/scripts/multiple_split_libraries_fastq.html.
13.3.1. Note:  Qiime Pick de novo OTUs script http://qiime.org/scripts/pick_de_novo_otus.html 
Step 13.2.2. Qiime Create a mapping file http://qiime.org/documentation/file_formats.html.
Step 13.2.2. Qiime Validate a mapping file http://qiime.org/scripts/validate_mapping_file.html.
Step 13.3.3. Qiime Link the OTU to sample description to mapping file http://qiime.org/scripts/make_otu_network.html.
Step 13.3.4. Qiime Summarize Taxa through plots http://qiime.org/scripts/summarize_taxa_through_plots.html.
Step 13.3.5. Qiime Biome Summarize table http://biom-format.org/documentation/summarizing_biom_tables.html  In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.

DOWNLOAD MATERIALS LIST

References

  1. Bechard, A., Meagher, R., Mason, G. Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice. Journal of the American Association for Laboratory Animal Science : JAALAS. 50, (2), 171-174 (2011).
  2. Jankowsky, J. L., et al. Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease. J Neurosci. 25, (21), 5217-5224 (2005).
  3. Kondo, M., et al. Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression. Eur J Neurosci. 27, (12), 3342-3350 (2008).
  4. Reichmann, F., Painsipp, E., Holzer, P. Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system. PLoS One. 8, (1), 54811 (2013).
  5. Cao, L., et al. Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition. Cell. 142, (1), 52-64 (2010).
  6. Bice, B. D., et al. Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model. Cell reports. 19, (4), 760-773 (2017).
  7. Moser, A. R., Pitot, H. C., Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, (4940), 322-324 (1990).
  8. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108, (12), 4914-4919 (2011).
  9. Holmdahl, R., Malissen, B. The need for littermate controls. Eur J Immunol. 42, (1), 45-47 (2012).
  10. Ubeda, C., et al. Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J Exp Med. 209, (8), 1445-1456 (2012).
  11. Spor, A., Koren, O., Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 9, (4), 279-290 (2011).
  12. Fujiwara, R., Watanabe, J., Sonoyama, K. Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers. Br J Nutr. 99, (6), 1174-1177 (2008).
  13. Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation. Lab Anim. 44, (2), 88-103 (2010).
  14. Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice. Frontiers in behavioral neuroscience. 3, 25 (2009).
  15. National Research Council (U.S.). Update of the Guide for the Care and Use of Laboratory Animals. Institute for Laboratory Animal Research (U.S.). National Academies Press. Washington, D.C. 220 (2011).
  16. Silver, L. M. Mouse genetics : concepts and applications. Oxford University Press. New York. (1995).
  17. Chen, M., Kan, L., Ledford, B. T., He, J. Q. Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently. Journal of the American Association for Laboratory Animal Science : JAALAS. 55, (2), 189-198 (2016).
  18. Truett, G. E., et al. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  19. Cole, J. R., et al. Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucleic Acids Res. 42, 633-642 (2014).
  20. Bosshard, P. P., Zbinden, R., Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int J Syst Evol Microbiol. 52, Pt 4 1263-1266 (2002).
  21. Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS One. 7, (6), 39743 (2012).
  22. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina. Available from: https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  23. Illumina Experiment Manager. Illumina. Available from: https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html (2017).
  24. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7, (5), 335-336 (2010).
  25. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis. Durham, NC. (2011).
  26. Knight, R., Caporaso, J. G. QIIME: Multiple Paired Ends Script. QIIME. Available from: http://qiime.org/scripts/multiple_join_paired_ends.html (2017).
  27. Knight, R., Caporaso, J. G. QIIME: De-Novo OTU Picking Protocol. QIIME. Available from: http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  28. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26, (19), 2460-2461 (2010).
  29. Caporaso, J. G., et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26, (2), 266-267 (2010).
  30. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72, (7), 5069-5072 (2006).
  31. Knight, R., Caporaso, J. G. QIIME: Multiple Split Libraries Fastq Script. QIIME. Available from: http://qiime.org/scripts/multiple_split_libraries_fastq.html (2017).
  32. Knight, R., Caporaso, J. G. QIIME: De Novo Otus Script. QIIME. http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  33. Knight, R., Caporaso, J. G. QIIME: Links to Sample Identification. QIIME. Available from: http://qiime.org/documentation/file_formats.html (2017).
  34. Knight, R., Caporaso, J. G. QIIME: Validation of Mapping File. QIIME. Available from: http://qiime.org/scripts/validate_mapping_file.html (2017).
  35. Knight, R., Caporaso, J. G. QIIME: Link of OTUs to Sample Description Using Mapping File. QIIME. Available from: http://qiime.org/scripts/make_otu_network.html (2017).
  36. Knight, R., Caporaso, J. G. QIIME: Summarize Taxa Through Plots. QIIME. Available from: http://qiime.org/scripts/summarize_taxa_through_plots.html (2017).
  37. Knight, R., Caporaso, J. G. QIIME: Biome Summarize Table Command. QIIME. Available from: http://qiime.org/documentation/summarizing_biom_tables.html (2017).
  38. Moon, C., et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature. 521, (7550), 90-93 (2015).
  39. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69, (2), 330-339 (2007).
  40. Chen, H. M., et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am J Clin Nutr. 97, (5), 1044-1052 (2013).
  41. Zhu, Q., et al. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS One. 9, (6), 90849 (2014).
  42. Evans, C. C., et al. Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity. PLoS One. 9, (3), 92193 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics