Bitki proteinleri böcek hücrelerinde salgılanan Baculovirus ifade vektörel çizimler oluşturmak için değiştirme

JoVE Journal
Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Burada, bitki salgılanan proteinler için protein kristalizasyon büyük miktarlarda üretmek için böcek hücre ve baculovirus protein ifade sistemi kullanan iletişim kurallarını mevcut. Bir baculovirus ifade vektör GP67 ya da böcek hemolin sinyal peptid bitki protein salgılanması ifade böcek hücrelerinde ile değiştirildi.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Chakraborty, S., Trihemasava, K., Xu, G. Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells. J. Vis. Exp. (138), e58283, doi:10.3791/58283 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Rekombinant salgı ökaryotik proteinler yapısal ve biyokimyasal araştırmalar ifade etmek bilim adamları için bir mücadele vardı. Böcek hücre baculovirus-aracılı ifade sistem rekombinant ökaryotik salgı proteinler bazı translasyonel modifikasyonlar ile ifade etmek için kullanılan sistemlerinden biridir. Salgı proteinler için protein glikozilasyon, disülfür bağları oluşumu ve diğer translasyonel modifikasyonlar salgı yollar aracılığıyla yönlendirilmesi gerekir. Varolan böcek hücre ifade salgı bitki proteinlerin artırmak için bir baculovirus ifade vektör ya bir GP67 eklenmesi ya da bir hemolin sinyal peptid sırası organizatörü ve çoklu klonlama siteleri arasında tarafından değiştirilir. Bu yeni tasarlanmış değiştirilmiş vektör sistemi başarıyla Arabidopsis thalianaçözünür rekombinant salgılanan bitki reseptör proteinler yüksek bir verim üretti. İki ifade bitki proteinleri, Arabidopsis TDR ve PRK3 plazma membran reseptörleri, ekstrasellüler etki x-ışını crystallographic çalışmalar için kristalize. Değiştirilmiş vektör sistemi salgı rekombinant proteinler de hayvan krallığının bir ifade için kullanılabilir gelişmiş bir araçtır.

Introduction

X-ışını crystallographic çalışmalar için özellikle Biyokimya ve biyofizik karakterizasyonu için homojen rekombinant proteinlerin büyük miktarlarda üretme yeteneğine sahip olması bir araştırma laboratuvarı için zorunludur. Escherichia coli, mantar, böcek hücreleri, memeli hücreleri, bitki hücreleri, vb aralarında gibi birçok tanınmış Contegra ifade sistemleri vardır, böcek hücre baculovirus-aracılı ifade sistem en çoğunlukla teknikleri yapısal olarak katlanmış büyük ölçekli rekombinant ökaryotik proteinler protein kristalizasyon1için büyük miktarlarda üretmek için kullanılır.

İfade vektörel çizimler baculovirus ifade sisteminin güçlü polyhedrin veya yüksek bir verim rekombinant proteinler hücre içi2,3üretmek için P10 organizatörü içerecek şekilde tasarlanmıştır. Rekombinant baculovirus yapmak için faiz gen Autographa californica multi-nucleopolyhedroviral genom polyhedrin (polh) odağı içeren bir böcek vektörü klonlanmış. Elde edilen yapı sonra sıralı ve onun doğru açık okuma çerçevesi (ORF) doğrulanır. Doğru yapı sonra transfection sürecinde ana bilgisayar böcek hücresine tanıttı. Gen ilgi viral Genom tarafından Homolog rekombinasyon eklenir. Bu olay rekombinant üretmek için hangi sonra çoğaltır virüs parçacıkları1budded rekombinant viral genom üretiminde sonuçlanır.

İfade sisteminde en sık kullanılan böcek hücreleri Sf9 ve yüksek beş (Hi5) hücrelerdir. Spodoptera frugiperda, pupa yumurtalık hücrelerinden elde edilen Sf21, klonal bir izole Sf9 hücrelerdir ve ebeveyn Trichoplusia ni yumurtalık hücre satırı TN-3684,5dan türetilmiş bir klonal izole Hi5 hücrelerdir. Hi5 hücreleri genellikle rekombinant proteinler6daha yüksek miktarlarda üretmek için seçili iken eş transfections, virüs amplifikasyon ve plak deneyleri Sf9 hücreleri üzerinde yapılmaktadır. Hi5 hücreleri mutasyona uğramış virüs üretmek için onların eğilimi nedeniyle üretimi ve virüs ettiklerinizden amplifikasyon için uygun değildir fazlalaştı. Geleneksel olarak, 25-30 ° C sıcaklık aralığı böcek hücreleri ekimi için iyi olarak kabul edilir. Ancak, 27-28 ° C en uygun sıcaklık böcek hücre büyüme ve enfeksiyon7,için8olduğu bildirilmiştir.

Giriş Gen önceki bir güçlü sinyal sırasında salgılanan proteinler yüksek ifade için gereklidir. Sinyal sıra verimli bir şekilde çevrilmiş Rekombinant protein endoplazmik retikulum protein salgılanması ve translasyonel modifikasyonlar uygun katlama ve sabitleme3için gerekli için deliklere. Protein GP64/67, bal arısı melittin ve diğerleri, baculovirus örtmek gibi sinyal peptid dizileri, baculovirus-aracılı ifade sistemleri3salgı rekombinant proteinlerin ifadesi kolaylaştırmak için seçildi. GP67 sinyal peptid getirilmesi ile karşılaştırıldığında içsel sinyal peptid hedef gen9kullanarak salgılanan bir Rekombinant protein, ifade verimini artırmak için gösterilmiştir. Hemolin bir bakteri enfeksiyonu10indüklenen dev ipek güve Hyalophora cecropia, hemolymph proteindir. İndüklenen ifade nispeten yüksek seviyede nedeniyle, gen sinyal peptid dizisi rekombinant proteinlerin salgılanmasını ifade baculovirus-böcek hücre sisteminde arabuluculuk için kullanılabilir.

A. thaliana Tracheary öğesi farklılaşma inhibitör faktör reseptör (TDR) ve polen reseptör kinaz her ikisi de proteinler11,12 bitki lösin yönünden zengin tekrar reseptör benzeri kinaz (LRR-RLK) ailesine ait 3 (PRK3) . Yapısı ve fonksiyonu, bu ailenin diğer bitki salgılanan proteinler yapısal ve biyokimyasal karakterizasyonu kolaylaştırmak için bitki reseptör protein, de eğitim için baculovirus-böcek hücre ifade sistem için değiştirildi protein verim kalitesi ve üretim geliştirmek. Ekstrasellüler etki alanları TDR ve PRK3 başarıyla baculovirus-böcek hücre ifade sisteminde iki değiştirilmiş ifade vektörel çizimler kullanarak ifade edilmiştir. Her iki ekstrasellüler etki alanı TDR ve PRK3 proteinlerin kristalize. Ya bir GP67 ya da hemolin sinyal dizisi düzenleyici ve birden çok klonlama arasında dahil ederek ifade ve arıtma rekombinant salgılanan bitki proteinleri iki değiştirilmiş baculovirus ifade vektörel çizimler ile büyük miktarda Bu makale raporları siteleri.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Not: Bir böcek cep/baculovirus sistemi ile değiştirilmiş ifade vektörel çizimler salgı bitki protein ifade ve kristalizasyon için kullanılır.

1. bir Baculovirus ifade vektör GP67 sinyal peptid bitki Protein salgılanması ifade ile modifikasyonu

  1. Bir 5' BglII kesme makinası13, GP67 salgılanması sinyal sıra ve NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI ve XhoI (Şekil 1A) ile bir çok klonlama site içeren bir DNA parçası sentez.
    Not: BglII ve BamHI sindirilmiş beri DNA aynı yapışkanlı sona sonuçlandı, tavlanmış ligasyonu sırayla BglII ve BamHI siteleri tarafından yarilabilir değil bir sıra mutasyona iken Doğrusallaştırılmış vektör sindirilir DNA parçası ligate ya BglII ya da BamHI14.
  2. BglII ve XhoI ile DNA'ın Özeti 4 µg ve14BamHI ve XhoI ile bir ifade vektör DNA 4 µg. 1 x konsantrasyon tepki arabellek (50 mM potasyum asetat, 20 mM Tris-asetat, 10 mM magnezyum asetat ve 100 µg/mL BSA, pH 7,9 25 ° c) DNA'daki ile her Restriksiyon enzimi ile 10 birim mix ve 4 h için 37 ° C'de karışımı kuluçkaya.
    1. Eksize DNA parçası ve bir DNA jel ekstraksiyon kiti15tarafından Doğrusallaştırılmış vektör DNA arındırmak.
  3. Yöneyin Doğrusallaştırılmış DNA 400 ile mix 100 ng ng sindirilir DNA parçası 1 x T4 DNA ligaz tepki arabellek (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP ve 10 mM DTT, pH 7.5 25 ° c) ve 5 adet T4 DNA içeren bir 10 µL ligasyonu tepki karışımı ligaz. 16 ° C 16 h için tepki karisimin kuluçkaya.
  4. 5 µL ligasyonu karışımı DH5α yetkili hücre bir standart dönüştürme protokol sonrası 100 µL dönüştürmek ve bir ampisilin-LB agar plaka16üzerinde elde edilen kolonileri seçin. 5-10 kolonileri kadar almak ve her koloni 220 devir/dakika ve 37 ° C 16 h için titreyen bir kuluçka 100 µg/mL ampisilin içeren LB Orta 2 ml büyür.
  5. Her plazmid DNA ile DNA miniprep kit17 ayıklamak ve klonlar tarafından DNA sıralama bir astar AGTATTTTACTGTTTTCGTAACAG ile onaylayın.
  6. PCR yükseltmek A. thaliana TDR gen parçası kodlama artıkları sentetik bir TDR gen üzerinden 30-642 oluşturmak (ileri astar: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, geriye doğru astar: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). 0,5 mM dNTP mix, 0.2 µM astar, şablonun DNA 0.1 µg, 0.4 mM MgCl2ve 1 tepki adet DNA polimeraz içeren DNA polimeraz tepki arabellekte 30 döngüleri için DNA yükseltmek.
    1. 30 95 ° C'de ilk denatürasyon PCR döngüsü adımlar için küme s ve sonra 30 döngüleri denatürasyon 95 ° C'de 30 s, 30 s ve uzantısına sahip bir son 5 min için 72 ° C'de 72 ° c için 1 dakika, uzantısı için 55 ° C'de tavlama.
  7. PCR parçası ve yazmamalı ve BamHI kısıtlama endonükleaz enzimleri ile değiştirilmiş vektör sindirmek. Gen parça Doğrusallaştırılmış vektör ile ligate. Yöneyin Doğrusallaştırılmış DNA 400 ile mix 100 ng ng sindirilir DNA parçası T4 DNA ligaz reaksiyon tamponu ve 5 adet T4 DNA ligaz içeren bir 10 µL ligasyonu tepki karışımı. 16 ° C 16 h için tepki karisimin kuluçkaya.
  8. 5 µL ligasyonu karışımı DH5α yetkili hücre bir standart dönüştürme protokol sonrası 100 µL dönüştürmek ve bir ampisilin-LB agar plaka16üzerinde elde edilen kolonileri seçin. Doğru klon DNA sıralama tarafından onaylayın.

2. bir Baculovirus ifade vektör böcek Hemolin sinyal peptid bitki Protein salgılanması ifade ile modifikasyonu

  1. Bir 5' BglII kesme makinası13, böcek hemolin salgılanması sinyal sıra ve NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI ve XhoI (Şekil 1B) ile bir çok klonlama site içeren bir DNA parçası sentez.
  2. BglII ve XhoI ile DNA'ın Özeti 4 µg ve14BamHI ve XhoI ile bir ifade vektör DNA 4 µg. 1 x konsantrasyon tepki arabellek (50 mM potasyum asetat, 20 mM Tris-asetat, 10 mM magnezyum asetat ve 100 µg/mL BSA, pH 7,9 25 ° c) DNA'daki ile her Restriksiyon enzimi ile 10 birim mix ve 4 h için 37 ° C'de karışımı kuluçkaya.
    1. Eksize DNA parçası ve bir DNA jel ekstraksiyon kiti15tarafından Doğrusallaştırılmış vektör DNA arındırmak.
  3. Yöneyin Doğrusallaştırılmış DNA 400 ile mix 100 ng ng sindirilir DNA parçası 1 x T4 DNA ligaz tepki arabellek (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP ve 10 mM DTT, pH 7.5 25 ° c) ve 5 adet T4 DNA içeren bir 10 µL ligasyonu tepki karışımı ligaz. 16 ° C 16 h için tepki karisimin kuluçkaya.
  4. 5 µL ligasyonu karışımı DH5α yetkili hücre 100 µL dönüştürmek ve koloniler ampisilin-LB agar plaka üzerinde seçin. 5-10 kolonileri kadar almak ve 2 mL LB ortamda 100 µg/mL 220 devir/dakika ve 37 ° C 16 h için titreyen bir kuluçka ampisilin içeren her koloni büyür.
  5. Plazmid DNA ile DNA miniprep kit17 ayıklamak ve klonlar tarafından DNA sıralama bir astar AGTATTTTACTGTTTTCGTAACAG ile onaylayın.
  6. A. thaliana polen reseptör kinaz 3 (PRK3) gen parça PCR yükseltmek artıkları 20-237 sentetik bir PRK3 gen yapısı üzerinden kodlama (ileri astar: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, geriye doğru astar: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). 0,5 mM dNTP mix, 0.2 µM astar, şablonun DNA 0.1 µg, 0.4 mM MgCl2ve 1 tepki adet DNA polimeraz içeren DNA polimeraz tepki arabellekte 30 döngüleri için DNA yükseltmek.
    1. 30 95 ° C'de ilk denatürasyon PCR döngüsü adımlar için küme s ve sonra 30 döngüleri denatürasyon 95 ° C'de 30 s, 30 s ve uzantısı için 30 72 ° C'de 55 ° C'de tavlama her döngüsü ve 5 min için 72 ° C'de son uzantısı içinde s.
  7. PCR parçası ve yazmamalı ve BamHI kısıtlama endonükleaz enzimleri ile değiştirilmiş vektör sindirmek. Gen parça Doğrusallaştırılmış vektör ile ligate. Yöneyin Doğrusallaştırılmış DNA 400 ile mix 100 ng ng sindirilir DNA parçası T4 DNA ligaz reaksiyon tamponu ve 5 adet T4 DNA ligaz içeren bir 10 µL ligasyonu tepki karışımı. 16 ° C 16 h için tepki karisimin kuluçkaya.
  8. 5 µL ligasyonu karışımı DH5α yetkili hücre bir standart dönüştürme protokol sonrası 100 µL dönüştürmek ve bir ampisilin-LB agar plaka16üzerinde elde edilen kolonileri seçin. Doğru klon DNA sıralama tarafından onaylayın.

3. üretim ve Baculovirus amplifikasyon oluşturur rekombinant Protein ifade kaset yataklık

  1. DH10Bac yetkili hücre baculovirus ifade sistem1protokol sonrası 40 µL dönüştürmek için yapı plazmid kullanım 100 ng. 48 h 37 ° C'de dönüştürme plakaları kuluçkaya.
  2. İki beyaz kolonileri her dönüştürme plaka almak, her koloni 2 mL 50 µg/mL sefaloridin, 7 µg/mL gentamisin ve 10 µg/mL tetrasiklin içeren LB orta aşılamak. Ayıklamak ve DNA bacmid doğrulamak için baculovirus ifade sistem1 Protokolü izleyin. Aliquot her DNA 20 µL her, ile iki tüpler ve borular-20 ° C'de depolayın
    Not: Aşağıdaki adımları aseptik ameliyat gerektirir.
  3. Bir monolayer Kültür medya % 10 fetal Sığır serum (FBS) ve 100 µg/mL (veya 100 I.U./mL) ile penisilin-streptomisin antibiyotik 27 ° C'de Sf9 hücrelerinin % 80 izdiham bir 6-şey plaka için büyür. Doku kültürü plaka üzerinde kapalı alan yüzdesini temel izdiham yüzdesini tahmin ediyoruz.
  4. İki steril 1.5 mL santrifüj tüpleri aşağıdaki çözümleri hazırlayın.
    1. Tüp 1: her transfection için bacmid DNA unsupplemented Sf9 hücre kültür orta antibiyotikler olmadan 100 µL içine 20 µL oranında seyreltin. Seyreltme karışımı yavaşça tüp tarafında flicking tarafından.
    2. Tüp 2: her transfection için unsupplemented Sf9 hücre kültür orta antibiyotikler olmadan 100 µL içine lipid transfection reaktif 8 µL oranında seyreltin. Seyreltme yukarı ve aşağı 6 x için pipetting tarafından iyice karıştırın.
  5. İki çözüm birleştirmek, onları karışımı yavaşça yavaşça yukarı ve aşağı 3 x için pipetting tarafından ve onları 20-40 dakika oda sıcaklığında kuluçkaya.
  6. Sf9 monolayer her şey hücreleri 2 x 3 mL unsupplemented Sf9 hücre kültür orta olmadan antibiyotik ile yıkayın. Her transfection için unsupplemented Sf9 hücre kültür orta antibiyotikler olmadan 0.8 mL lipid-DNA karışımı içeren her tüpün ekleyin. Tüpler içeriğini karışımı yavaşça yavaşça yukarı ve aşağı 3 x için pipetting tarafından. Tabak yıkama medyadan Aspire edin ve transfection karışımı ile örnekleri yerleşimi.
  7. Transfection karışımı eklenmesinden sonra 27 ° C'de 5 h transfected plaka kuluçkaya Tam Sf9 hücre kültür veya % 10 FBS ve 100 µg/mL (100 I.U./mL) içeren orta ile transfection ortamı değiştirin penisilin-streptomisin antibiyotik. 4 d için 27 ° C'de transfected plaka kuluçkaya.
  8. Hasat ve rekombinant baculovirus yükseltmek.
    1. Süpernatant steril 15 mL konik tüp içinde virüslü plaka, kuluçka sonra 4 d toplayın. Süpernatant vasıl 1010 x g hücre artıkları kaldırmak 5 min için spin. Pelet atmak ve süpernatant temiz bir tüp için dikkatle boşaltmak ve 4 ° C ilâ 1 yıl için saklayın.
      Not: Bu P0 virüs olduğunu. Bu uzun bir süre için bölünmemeli ve-80 ° C'de depolanmış olabilir.
    2. Rekombinant her virüs yükseltmek için % 80 izdiham monolayer 150 mm tabakta Sf9 hücrelerin büyümek. Plaka medyadan Aspire edin, 2 mL P0 virüs hücreleri yapışık plaka ekleyin ve 1 h 27 ° C kuluçka plaka kuluçkaya. Orta hücre ile karıştırmak için plaka her 15dk rock.
      1. 25 mL % 10 FBS ve 100 µg/mL (veya 100 I.U./mL) içeren tam Grace'in medya ekleyin penisilin-streptomisin antibiyotik. P1 geçit virüs almak için 27 ° C kuluçka 3 d plaka kuluçkaya.
    3. Steril 50 mL konik tüp ve 1010 x g hücre artıkları kaldırmak 5 min için spin virüslü plaka süpernatant toplamak. Süpernatant temiz bir tüp için dikkatle boşaltmak ve 4 ° C ilâ 1 yıl için saklayın.
      Not: P1 virüs bölünmemeli ve saklı-80 ° C'de daha uzun bir süre için olabilir.
    4. Virüs--dan P1 P2 geçiş için yükseltmek için bir monolayer 150 mm tabakta Sf9 hücrelerinin % 90 izdiham için büyümek, medya plaka Aspire edin, P1 virüs 2 mL plaka ekleyin ve 1 h 27 ° C kuluçka için kuluçkaya.
    5. 3.8.2 ve 3.8.3 virüslerin P2 ve P3 pasajlar edinmek için adımları yineleyin. P3 virüs 2 aydan fazla tutmayın.

4. protein ifade, NiNTA ve kristalizasyon ile arıtma

  1. 2 x 106 100 devirde bir 27 ° C kuluçka Shaker yoğunluğu kültür medya 100 µg/mL (veya 100 I.U./mL) ile penisilin-streptomisin antibiyotiklere Hi5 böcek hücrelerinin 1 L kültür. Spin aşağı hücreleri 570 x g 5 min için de, süpernatant dikkatle boşaltmak, 20 mL taze üretilen P3 şunun hücrelerde resuspend ve 1 h. yavaşça sarsmak için her 15 dk x 1 hücreleri resuspend için spin şişe oda sıcaklığında saklayın.
  2. Hücreleri 1 litre 100 µg/mL (veya 100 I.U./mL) ile Kültür medya penisilin-streptomisin antibiyotikler, transfer 100 devirde bir 27 ° C kuluçka Shaker 72 h. Spin 1.010 x g 5 min için de hücreleri aşağı için hücre kültür ve süpernatant toplamak.
  3. Kullanım pH göstergesi süpernatant 8,0 pH 0,1 M HCl veya 0.1 M NaOH ekleyerek ayarlayın ve 20 mM Tris tampon pH 8.0, 100 mM NaCl ve 5 mM imidazole içeren bir son konsantrasyonu, bağlama arabellek eklemek için şeritler. Üzerinde ifade O'nun öğesini Rekombinant protein verim tahmini göre belirli bir miktar NiNTA reçine (10-40 mL) ekleyin.
    1. Çözüm manyetik heyecan üzerinde 1 h. Yıkama için 4 ° C'de düşük hız ile reçine mix ve standart NiNTA arıtma Protokolü18takip ilişkili protein elute.
  4. Saf protein iyon değiştirme için konu ve filtrasyon Kromatografi yanı sıra homojen bir örnek vermeye diğer protein saflaştırma yöntemleri jel.
    Not: TDR ectodomain için 20 mM Tris, pH 8, 100 mM NaCl kullanılan jel filtrasyon arabellek. PRK3 ectodomain için 20 mM BIS-Tris, pH 6, 100 mM NaCl tercih edilen jel filtrasyon arabellek kullanılmıştır.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Şekil 1' de gösterildiği gibi iki değiştirilmiş pFastBac1 baculovirus ifade vektörel çizimler salgılanan proteinler ile GP67 ya da hemolin sinyal sıra hedef gen içsel sinyal sırasını değiştirmek için ifade etmek için kullanılmıştır. Viral GP67 ve böcek hemolin genler hücrelerde yüksek salgı ifade düzeyleri olmasını gösterdi. Füzyon protein ile ikisinden biri bu iki sinyal sıralarının salgı ifade düzeyleri büyük ölçüde düzeldi bekleniyor. Aynı birden çok klonlama siteleri (MCS) bu iki değiştirilmiş vektörel çizimler içinde mühendislik. NotI en yaygın altı-nükleotid dizisi içinde birçok kısıtlama sitesi mevcut yerine bir sekiz-nükleotid dizisi olduğundan NotI sitesi en 5'-tarafında MCS, kasıtlı olarak yerleştirildi. Bu nedenle, yazmamalı sitesi hedef genlerin daha az kısıtlama sindirim ve çoğu hedef genlerin başka kısıtlama sites'ı kullanarak ile karşılaştırıldığında daha uygun kopyalama yapma çoğu kısıtlama site daha mevcuttur. Yazmamalı ve bir aşağı akım sınırlama sitesi arasında hedef Gen klonlama sadece üç amino asit kalıntıları, GGR, hedef gen önceki tanıtacak.

PBac1-GP67 ve pBac1-Hem başarıyla TDR ve PRK3, A. thaliana reseptörlerinin ekstrasellüler etki alanları sırasıyla ifade etmek için kullanılmıştır (Şekil 2). Sonra rekombinant proteinler mühendislik C-terminal 6-histidin etiketini kullanarak NiNTA tarafından saf, ortalama protein verim 20 mg/L Hi5 hücrelerin tutarlı. Her protein saflık yakın veya SDS-sayfa ve Coomassie boyama ile incelendiğinde % 50 daha yüksek olduğunu.

Rekombinant proteinler TDR ve PRK3 ekstrasellüler etki alanlarının daha fazla boyutu dışlama Kromatografi (Şekil 2) tarafından saf. Saf protein 5 mg/mL konsantre ve sonra kristalizasyon tarama için tabi. Protein kristalleri 20 µm büyük boyutta (Şekil 3) tespit edildi kadar her protein ön kristalleri vermiştir, koşulları optimize. Kristal yapıları her iki proteinlerin bildirilen11,12olmuştur.

Figure 1
Şekil 1: haritalar değiştirilmiş pFastBac1 vektörlerin. Bu panellerde gösterilen DNA dizileri yerleştirildi sinyal peptid sıra ve hedef genlerin için birden çok klonlama siteleri (MCS) sahip olmak pFastBac1 vektör organizatörü polyhedrin aşağı. Her iki vektörel çizimler aynı MCS içerir. PBac1-GP67 vektör polyhedrin organizatörü klonlama sitelerin aşağı dizisi bir (A) Bu panel gösterir. Tercüme GP67 sinyal peptid amino asit dizisi kırmızı renklidir. MCS her benzersiz kısıtlama sitede yukarıda etiketli sitenin adı ile çizilir. (B) Bu panel pBac1-Hem vektör polyhedrin organizatörü klonlama sitelerin akıntı yönünde bir dizisini gösterir. Çevrilen hemolin sinyal peptid amino asit dizisi kırmızı renklidir. MCS her benzersiz kısıtlama sitede yukarıda etiketli sitenin adı ile çizilir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2: baculovirus-böcek hücre sistemi değiştirilmiş pFastBac1 vektörler ile Protein ifadesi. (A) TDR ectodomain nikel-benzeşme ve boyutu dışlama Kromatografi tarafından (S), saf Hi5 böcek hücrelerinde, ifade ve SDS-sayfa jel üzerinde çözüldü. Nikel reçine bir kez 5 mM imidazole (yıkama 1) ve 20 mM imidazole (yıkama 2) ile ikinci kez içeren bir arabellek ile yıkandı. (B) Bu ifade ve nikel benzeşme arıtma (NiNTA), gösterilen SDS-sayfa analizi PRK3 ectodomain boyutu dışlama Kromatografi yanı sıra. Molekül ağırlığı (MW) işaretleri ilgili boyutları ile etiketlenir. Kırmızı oklar her panelinde ifadeler ve rekombinant TDR beklenen boyutları ve PRK3 ectodomain proteinler göstermek. Çok bantlı doğa'nın ifade proteinlerin nedeniyle heterojen glikozilasyon olasılığı daha yüksektir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: Protein kristalleri Arabidopsis thaliana TDR ve PRK3 ekstrasellüler etki alanlarının. (A) Bu panel gösterir A. thaliana TDR ekstrasellüler etki alanlarının protein kristalleri. (B) Bu panel protein kristalleri A. thaliana PRK3 ekstrasellüler etki gösterir. Bir ölçek çubuğu her resmin altında görüntülenir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Çeşitlilik içinde büyüklük ve istikrar proteinlerin biyolojik sistemlerde mevcut binlerce göz önüne alındığında, bu kez bir araştırma için ampirik laboratuvar hangi Contegra ifade sistem karar vardır belirli bir protein ifade için seçilecek. E. coli ifade sistem kez up19ölçeklemek için ilk kısa yaşam döngüsü nedeniyle protein ifade bakterilerin düşük maliyetli Kültür Medya ve göreceli kolaylığı için seçimdir. Ancak, E. coli kullanarak 60 kDa fazla boyutları ile büyük ökaryotik proteinlerin ifade sistemi genellikle dahil gövde veya toplama20Çözünmez proteinler sonuçları. Bu zor proteinlerine ifade ve diğer salgılanan proteinler için baculovirus-böcek hücre ifade sistem koli basilidaha avantajlı olabilir. Özellikle salgılanan ökaryotik proteinler ifade edilirken, bu değiştirilmiş baculovirus-böcek hücre ifade sistem bir tercih olacaktır.

Bitki salgılanan proteinler, dahil olmak üzere birçok salgılanan ökaryotik proteinler, protein katlama ve salgı21sırasında karmaşık glikozilasyon, disülfür oluşumu ve diğer translasyonel modifikasyonlar gerekir. E. coli sistemleri birçok ökaryotik proteinler22için gerekli karmaşık değişiklikleri işlemek için hücresel makine var mı. Maya E. coli23daha nispeten daha gelişmiş bir glikozilasyon sistemi vardır. Ancak, daha yüksek ökaryotik türler ve tesisleri salgılanan proteinler ifadesi için baculovirus-böcek hücre sistemi önemli bir avantaj sunuyor. Glikozilasyon protein katlanması etkiler ve istikrar24, birçok salgılanan rekombinant proteinlerin ifade E. coli ve Maya sistemleri düşük verim var ve muhtemelen yanlış protein katlanması nedeniyle toplamak için eğilimindedir. Baculovirus-böcek sistem salgılanan ökaryotik proteinler25ifade için ideal bir sistemdir yapar protein glikozilasyon geliştirmek için değiştirildi. Bu çalışmada, sinyal GP67 ve hemolin peptidler protein kristalizasyon için iki bitki reseptör protein salgılanması ifade rehberlik için başarılı bir şekilde kullanılmıştır. Akılda bu çalışmalar ile olsa da, her iki sinyal peptid seçimi kritik bir adımdır ve bir dizi farklı organizmalar hedef genler daha sistematik karşılaştırmalı çalışmalar ihtiyacı var.

GP67 ve hemolin sinyal peptidler protein salgılanması ifade geliştirmek için kullanma fikri hem genler yüksek ifade verimleri tarafından tahrik edildi. Ancak, protein salgılanması ve ardından değişiklik makine ifade ana ifade rekombinant proteinler ile üzerilerine Eğer salgılanan rekombinant proteinler yeterli değişiklikler, özellikle glikozilasyon olmayabilir. Değiştirilmiş her iki vektörel çizimler başarıyla birçoğu meyletmek-e doğru toplamak, muhtemelen nedeniyle yanlış veya yetersiz glikozilasyon olan çok sayıda bitki salgı proteinler11,12,26, ifade etmek için kullanılmaktadır. Bu nedenle, bu zor proteinlerine ifade test edilecek her iki güçlü ve zayıf sinyal peptid serileri sahiptir ve ifade rekombinant proteinlerin kalitesini mukayese edilebilir gerekiyor. Zayıf sinyal peptid sıra protein genel verimi düşürür göz önünde bulundurun; Ancak, protein salgılanması ve değişiklikleri işlemek için yeterli kapasite ifade ana salgı makine verebilir.

Böcek hücrelerinde Contegra salgılanan proteinler ifadesi ek olarak, memeli hücre ve bitki hücre ifade sistemleri başarıyla overexpression rekombinant memeli ve bitki proteinleri, sırasıyla27kullanılmıştır, 28,29. Kapaklı sistemleri, çevre endojen ifade ile karşılaştırıldığında memeli veya bitki salgılanan proteinler durumu iyi katlanmış proteinlerin verim için ana hücrelerde neredeyse yerel değişiklik makineleri sahip olacak. Yerli yakınındaki ifade sistemini kullanarak uyarı ifade rekombinant proteinler potansiyel olarak son ifade verim proteinlerin üzerinde olumsuz etkileri olabilir hücrelerin fizyolojik fonksiyonu ile girişime neden olabilir olduğunu.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Bu eser Guozhou Xu için Kuzey Carolina Eyalet Üniversitesi yeni öğretim başlangıç fonlar tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
Incubator shaker VWR Model Excella E25 27 oC
Incubator VWR Model 2005 27 oC
Centrifuge BECKMAN Model J-6 with a swing bucket rotor
Herculase II Fusion DNA Polymerase Agilent 600677-51 For PCR amplification of DNA
Thermal Cycler BIO-RAD Model C1000 Touch For PCR amplification of DNA
Incubator shaker New Brunswick Scientific Model I 24 For growing baceria culture
Customer DNA synthesis GENSCRIPT
BamHI (HF) New England Biolabs R3136S Restriction Endonuclease
BglII New England Biolabs R0144S Restriction Endonuclease
NotI (HF) New England Biolabs R3189S Restriction Endonuclease
XhoI New England Biolabs R0146S Restriction Endonuclease
T4 DNA ligase New England Biolabs M0202T DNA ligation
QIAquick Gel Extraction Kit Qiagen 28704 DNA purification from Agorase gel
QIAprep Spin Miniprep Kit Qiagen 27104 Plasmid DNA purification from bacteria culture
Agarose Thermo Fisher Scientific 15510-019 For DNA gel electropherosis
MAX Efficiency DH5α competen cell Invitrogen 18-258-012 For transformation of DNA ligation mixture
Lennox L LB Broth Research Product International Corp. L24066-5000.0 For making bacteria culture
Ampicillin sodium salt Thermo Fisher Scientific 11593-019 Antibiotics
Kanamycin Sulfate Thermo Fisher Scientific 15160-054 Antibiotics
Tetracycline Thermo Fisher Scientific 64-75-5 Antibiotics
Gentamicin Thermo Fisher Scientific 15710-064 Antibiotics
MAX Efficiency DH10Bac competent cells Thermo Fisher Scientific 10361-012 For making bacmid DNA
S.O.C. Medium Thermo Fisher Scientific 15544-034 For DNA transformation
CellFECTIN II Reagent Thermo Fisher Scientific 10362-101 Insect cell transfection reagent
Bac-to-Bac Expression System Thermo Fisher Scientific 10359-016 Baculovirus-insect cells expression kit
Bluo-gal Thermo Fisher Scientific 15519-028 For isolation of recominant Bacmid DNA
IPTG Thermo Fisher Scientific 15529-019 For isolation of recominant Bacmid DNA
pFastBac1 Thermo Fisher Scientific 10360014 Baculorirus expression vector
Sf9 cells Thermo Fisher Scientific 11496015 Sf9 monolayer cells
Hi5 cells Thermo Fisher Scientific B85502 High Five insect cells
Grace’s insect medium, unsupplemented Thermo Fisher Scientific 11595030 Sf9 cell transfection minimum medium
Grace’s insect medium, supplemented Thermo Fisher Scientific 11605102 Sf9 monolayer cell culture complete medium
Sf-900 II SFM Thermo Fisher Scientific 10902104 Sf9 suspension cell culture medium without FBS
Express Five SFM Thermo Fisher Scientific 10486025 Hi5 cell culture medium
Penicillin-Streptomycin Thermo Fisher Scientific 15140122 100 ml (10,000 I.U./ml)
L-Glutamine (200 mM) Thermo Fisher Scientific 25030081 100 ml
FBS Certified Thermo Fisher Scientific 16000-044 500 ml
6-well plates Thermo Fisher Scientific 08-772-1B Flat-bottom
150 mm plates Thermo Fisher Scientific 353025 100/case
1.5 ml Microcentrifuge Tubes USA Scientific 1415-2500 500 tubes/bag
15 ml conical screw cap centrifuge tubes USA Scientific 1475-0511 25 tubes/bag
50 ml conical screw cap centrifuge tubes USA Scientific 1500-1211 25 tubes/bag
Ni-NTA Superflow Qiagen 30430 NiNTA resin
pH-indicator strips EMD Millipore Corporation 1.09535.0001 pH 0 - 14

DOWNLOAD MATERIALS LIST

References

  1. Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. Protein production using the baculovirus-insect cell expression system. Biotechnology Progress. 30, 1-18 (2014).
  2. Khan, S., Ng, M. L., Tan, Y. J. Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system. Methods in Molecular Biology. 379, 35-50 (2007).
  3. Possee, R. D., King, L. A. Baculovirus Transfer Vectors. Methods in Molecular Biology. 1350, 51-71 (2016).
  4. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 13, 213-217 (1977).
  5. Hink, W. F. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature. 226, 466-467 (1970).
  6. Davis, T. R., et al. Comparative recombinant protein production of eight insect cell lines. In Vitro Cellular & Development Biology - Animal. 29A, 388-390 (1993).
  7. Wickham, T. J., Nemerow, G. R. Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system. Biotechnology Progress. 9, 25-30 (1993).
  8. Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion. Nature Biotechnology. 10, 1148-1150 (1992).
  9. Murphy, C. I., et al. Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides. Protein Expression and Purification. 4, 349-357 (1993).
  10. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science. 250, 1729-1732 (1990).
  11. Li, Z., Chakraborty, S., Xu, G. Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions. PLoS One. 12, e0175317 (2017).
  12. Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors. Scientific Reports. 8, 2796 (2018).
  13. Khorana, H. G. Total synthesis of a gene. Science. 203, 614-625 (1979).
  14. Bahl, C. P., Marians, K. J., Wu, R. A general method for inserting specific DNA sequences into cloning vehicles. Gene. 1, 81-92 (1976).
  15. Xu, W., Zhang, Y. Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative. Methods in Molecular Biology. 1387, 213-226 (2016).
  16. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology. 166, 557-580 (1983).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Reddy, B. G., et al. Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC. Protein Expression and Purification. 117, 67-75 (2016).
  19. Harris, T. J., Emtage, J. S. Expression of heterologous genes in E. coli. Microbiological Sciences. 3, 28-31 (1986).
  20. Kaur, J., Kumar, A., Kaur, J. Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements. International Journal of BIological Macromolecules. 106, 803-822 (2018).
  21. Guo, Y., Yang, F., Tang, X. An Overview of Protein Secretion in Yeast and Animal Cells. Methods in Molecular Biology. 1662, 1-17 (2017).
  22. Blight, M. A., Chervaux, C., Holland, I. B. Protein secretion pathway in Escherichia coli. Current Opinion in Biotechnology. 5, 468-474 (1994).
  23. Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology. 86, 403-417 (2010).
  24. Wormald, M. R., Dwek, R. A. Glycoproteins: glycan presentation and protein-fold stability. Structure. 7, R155-R160 (1999).
  25. Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. An Overview and History of Glyco-Engineering in Insect Expression Systems. Methods in Molecular Biology. 1321, 131-152 (2015).
  26. Li, Z., Chakraborty, S., Xu, G. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa. Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).
  27. Aricescu, A. R., Owens, R. J. Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology. Current Opinion in Structural Biology. 23, 345-356 (2013).
  28. Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells. Plant Biotechnology Journal. 12, 402-410 (2014).
  29. Dohi, K., et al. Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells. Archives of Virology. 151, 1075-1084 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics